ID: 1129196385

View in Genome Browser
Species Human (GRCh38)
Location 15:73969700-73969722
Sequence CTGAACATACACGTGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129196385_1129196390 11 Left 1129196385 15:73969700-73969722 CCATGGTGCACGTGTATGTTCAG No data
Right 1129196390 15:73969734-73969756 CCTCTGCTTAGAACCCTGCAGGG No data
1129196385_1129196391 12 Left 1129196385 15:73969700-73969722 CCATGGTGCACGTGTATGTTCAG No data
Right 1129196391 15:73969735-73969757 CTCTGCTTAGAACCCTGCAGGGG No data
1129196385_1129196388 10 Left 1129196385 15:73969700-73969722 CCATGGTGCACGTGTATGTTCAG No data
Right 1129196388 15:73969733-73969755 TCCTCTGCTTAGAACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129196385 Original CRISPR CTGAACATACACGTGCACCA TGG (reversed) Intergenic
No off target data available for this crispr