ID: 1129196387

View in Genome Browser
Species Human (GRCh38)
Location 15:73969725-73969747
Sequence GTTCTAAGCAGAGGAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129196387_1129196397 24 Left 1129196387 15:73969725-73969747 CCTCATGTTCCTCTGCTTAGAAC No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data
1129196387_1129196396 15 Left 1129196387 15:73969725-73969747 CCTCATGTTCCTCTGCTTAGAAC No data
Right 1129196396 15:73969763-73969785 ACTGAACACAGCCCTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129196387 Original CRISPR GTTCTAAGCAGAGGAACATG AGG (reversed) Intergenic
No off target data available for this crispr