ID: 1129196397

View in Genome Browser
Species Human (GRCh38)
Location 15:73969772-73969794
Sequence AGCCCTTCCTGTGGCCTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129196392_1129196397 2 Left 1129196392 15:73969747-73969769 CCCTGCAGGGGCTCCCACTGAAC No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data
1129196389_1129196397 15 Left 1129196389 15:73969734-73969756 CCTCTGCTTAGAACCCTGCAGGG No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data
1129196386_1129196397 25 Left 1129196386 15:73969724-73969746 CCCTCATGTTCCTCTGCTTAGAA No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data
1129196393_1129196397 1 Left 1129196393 15:73969748-73969770 CCTGCAGGGGCTCCCACTGAACA No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data
1129196387_1129196397 24 Left 1129196387 15:73969725-73969747 CCTCATGTTCCTCTGCTTAGAAC No data
Right 1129196397 15:73969772-73969794 AGCCCTTCCTGTGGCCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129196397 Original CRISPR AGCCCTTCCTGTGGCCTACC AGG Intergenic
No off target data available for this crispr