ID: 1129196926

View in Genome Browser
Species Human (GRCh38)
Location 15:73973849-73973871
Sequence GCCGGCCGGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129196920_1129196926 -3 Left 1129196920 15:73973829-73973851 CCCCGCACTCGGTGCGGCCGGCC No data
Right 1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG No data
1129196921_1129196926 -4 Left 1129196921 15:73973830-73973852 CCCGCACTCGGTGCGGCCGGCCG No data
Right 1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG No data
1129196917_1129196926 4 Left 1129196917 15:73973822-73973844 CCGCGGGCCCCGCACTCGGTGCG No data
Right 1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG No data
1129196922_1129196926 -5 Left 1129196922 15:73973831-73973853 CCGCACTCGGTGCGGCCGGCCGG No data
Right 1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG No data
1129196913_1129196926 21 Left 1129196913 15:73973805-73973827 CCGGGTGGGCGTGGGCTCCGCGG 0: 24
1: 132
2: 639
3: 651
4: 528
Right 1129196926 15:73973849-73973871 GCCGGCCGGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129196926 Original CRISPR GCCGGCCGGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr