ID: 1129198480

View in Genome Browser
Species Human (GRCh38)
Location 15:73984789-73984811
Sequence CGCCAGAGGCTGCTTCGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129198472_1129198480 23 Left 1129198472 15:73984743-73984765 CCAGGGCCTCAGACAGGAAGGGC 0: 1
1: 0
2: 7
3: 61
4: 409
Right 1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1129198473_1129198480 17 Left 1129198473 15:73984749-73984771 CCTCAGACAGGAAGGGCTGTAGA 0: 1
1: 0
2: 1
3: 22
4: 209
Right 1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129198480 Original CRISPR CGCCAGAGGCTGCTTCGGAC TGG Exonic
901232472 1:7648889-7648911 CGCCAGAGGCTGCTATAGGCCGG - Intronic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
1067057196 10:43059092-43059114 CCCCAGAGGCTGCTTGGGCCAGG - Intergenic
1067804694 10:49384670-49384692 GGACAGAGGCTGGTGCGGACAGG - Intronic
1073072283 10:100802309-100802331 TGGCAGAGGCTGCTTAAGACTGG - Intronic
1075603040 10:123784698-123784720 CACCAGAGGCTGCTTCGTGAGGG - Intronic
1076519442 10:131071843-131071865 CGCCAGAGGCTGACTCGCACTGG + Intergenic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078627310 11:12969245-12969267 TGCCAGAGGCTGTTCCGAACTGG + Intergenic
1084211835 11:67627994-67628016 AGCCAGGGGCTGCTTAGGGCGGG + Exonic
1096269235 12:50151114-50151136 GGCCAGAGGGTGCTAGGGACCGG - Intronic
1103903726 12:124316640-124316662 CCCCAGAGGCTGCTGGGGACAGG + Intergenic
1108404170 13:50082820-50082842 CGCAACAGGCAGCTTAGGACCGG - Intronic
1113914346 13:113861892-113861914 CGACAGAGGCTGCTGGGGCCAGG + Intronic
1119659376 14:76439473-76439495 CGCCAGCGGCGGCTTTGGCCTGG + Exonic
1121680670 14:95790405-95790427 TTCCAGGGGCTGCTTAGGACTGG + Intergenic
1122996755 14:105269274-105269296 CCTCAGAGGATGCTTCGGGCTGG - Intronic
1123162033 14:106287678-106287700 CGCCAGAGGCCGGGTCGGAGCGG - Intergenic
1129198480 15:73984789-73984811 CGCCAGAGGCTGCTTCGGACTGG + Exonic
1133063649 16:3191283-3191305 CGCCAGAGGCTCCTTCCGCAGGG - Intergenic
1133203284 16:4217814-4217836 CAGCAGAGCCAGCTTCGGACAGG + Intronic
1140795680 16:78435316-78435338 CGGCAGAGGCTGCTGCACACTGG - Intronic
1148134726 17:45284862-45284884 GGGCAGAGGCTCCTTCGGAGAGG - Exonic
1148225729 17:45896657-45896679 CGCCTGAGGCTGTTTCTGATTGG + Intronic
1156128937 18:33944504-33944526 CTCCAGAGGCTACTTTGGAGGGG - Intronic
1160567659 18:79797342-79797364 CCCCAAAGGCTGCTTTGGAGTGG + Intergenic
1165194761 19:34093281-34093303 CTTCAGATGCTGCTTGGGACCGG + Intergenic
926153800 2:10439458-10439480 AGCCAGAGGTTGGTTCTGACTGG - Intergenic
928180835 2:29067186-29067208 AGCCAGAGGCTGCTCAGAACGGG - Intronic
928927869 2:36597475-36597497 TGCCAGGCGCTGCTTCGCACAGG - Intronic
933746806 2:85577691-85577713 AGCCAGAGGGGGCTTGGGACTGG + Intronic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
940423923 2:153509402-153509424 CCGCAGCGGCTGCTTCAGACGGG + Intergenic
946404109 2:219483674-219483696 CGCCAGCGGCTGCTGCGGGGAGG + Exonic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
947793776 2:232882033-232882055 CTCCAGGGGCTGCTTCCTACTGG - Intronic
948206291 2:236164389-236164411 CGCCAGATACTGCGGCGGACAGG - Intergenic
1172626573 20:36350843-36350865 CCCCAGAGGCTGCTTGTGATTGG + Intronic
1175240036 20:57540440-57540462 CGCCAGTGGCTCCTTCGGCCTGG + Intergenic
1175929179 20:62485566-62485588 CGCCAGAGGCAGCCGCAGACCGG + Intergenic
1182886764 22:33780417-33780439 CGACAGGGGCTGCTGGGGACTGG - Intronic
1183688418 22:39375039-39375061 TGCCAAAGGCTGCTTCTGAAGGG - Intronic
953187380 3:40651517-40651539 TGCCAGAGGCTGCTTAAGGCAGG + Intergenic
961324775 3:126103617-126103639 AGCCAAGGGCTGCTTCTGACTGG + Exonic
968232046 3:197009998-197010020 GGCAAGAGGCTGCTTCTCACAGG - Intronic
969503643 4:7570386-7570408 TGCCAGAGGCTGCTTCCGGGTGG + Intronic
969586359 4:8096501-8096523 CGTCAGAGGATGCTAAGGACAGG - Intronic
973759271 4:54101571-54101593 CGTCAGAGCCTCCTGCGGACCGG - Exonic
992204864 5:74421485-74421507 AGCCAGAGGGTGCTTCCCACTGG + Intergenic
994041508 5:95264677-95264699 GGCCAGGGGGTGCTTTGGACAGG - Intronic
998204033 5:140146421-140146443 CGCCCGCGGCTGCTTCGGAGGGG - Intergenic
1002524113 5:179806266-179806288 CGCCCGTGGGTGCTCCGGACCGG - Intronic
1002681613 5:180969615-180969637 CGCCAGAGGCGGCTGAGGCCTGG + Intergenic
1012278956 6:97305848-97305870 CTCCAGAGGCAGCTGCGGTCAGG + Intergenic
1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG + Intronic
1024226932 7:47332498-47332520 AGCCACAGGCTGCTTCAGAAGGG + Intronic
1025729846 7:64099870-64099892 TGCAAGAGGCTGCATCCGACAGG + Intronic
1025929513 7:65982591-65982613 TGCAAGAGGCTGCATCAGACAGG - Intergenic
1029011980 7:97271789-97271811 AGCCAGAGGCTGCTTCAGAAGGG - Intergenic
1032858918 7:135859231-135859253 TGGCAGTGGCTGCTTCAGACAGG + Intergenic
1033656994 7:143381319-143381341 GGCTGGAGGCTGCTCCGGACCGG + Exonic
1036618170 8:10404565-10404587 CGTCAGCAGCTGCTTCTGACAGG + Intronic
1049409329 8:142465385-142465407 GGCCAGAGGCTGCAGCGGCCTGG + Intronic
1049805219 8:144535716-144535738 AGCCTGAGCCTGCTTGGGACTGG + Intronic
1050181991 9:2933115-2933137 TGGCAGCGGCTGCTTCGCACAGG - Intergenic
1060770124 9:126326663-126326685 CGCCCGAGGCTGGCTCGGGCGGG - Intergenic
1188776007 X:34219607-34219629 GGCCAGAGGCTGGTTCTTACAGG + Intergenic
1193415138 X:81212760-81212782 TGCCAGGGACTGCTTGGGACAGG + Intronic