ID: 1129199615

View in Genome Browser
Species Human (GRCh38)
Location 15:73991250-73991272
Sequence ACTTGGGCTCCTGAATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129199615_1129199623 17 Left 1129199615 15:73991250-73991272 CCTGGAGATTCAGGAGCCCAAGT 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1129199623 15:73991290-73991312 CAGCTCCAGAATCTGGGATGAGG 0: 1
1: 0
2: 1
3: 21
4: 271
1129199615_1129199620 10 Left 1129199615 15:73991250-73991272 CCTGGAGATTCAGGAGCCCAAGT 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1129199620 15:73991283-73991305 GCCGAGACAGCTCCAGAATCTGG 0: 1
1: 0
2: 1
3: 9
4: 74
1129199615_1129199622 11 Left 1129199615 15:73991250-73991272 CCTGGAGATTCAGGAGCCCAAGT 0: 1
1: 0
2: 1
3: 25
4: 280
Right 1129199622 15:73991284-73991306 CCGAGACAGCTCCAGAATCTGGG 0: 1
1: 0
2: 0
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129199615 Original CRISPR ACTTGGGCTCCTGAATCTCC AGG (reversed) Intronic
901063453 1:6484492-6484514 AGTTGGGCTCATGGTTCTCCCGG - Intronic
902410968 1:16211402-16211424 ACTTGGGTTCTGGAAGCTCCTGG + Intronic
904352526 1:29918067-29918089 ACCTGGGTGCCTGAAGCTCCAGG + Intergenic
905043970 1:34982161-34982183 CCCTGAGCTCCTGGATCTCCTGG - Intronic
905121341 1:35684385-35684407 TCTTGTCCTCCTGGATCTCCTGG - Intergenic
905734752 1:40317300-40317322 GCTGGGGCTCCTGAATATGCGGG + Intronic
905761068 1:40558814-40558836 AGTTGGGCTCCTGAGTCTAGTGG - Intergenic
906951018 1:50334564-50334586 ACCTGGGATCCTCAATCTCAGGG - Intergenic
907267403 1:53271357-53271379 ACATGGGCTCCTGAAGGTCCAGG + Intronic
907364781 1:53949159-53949181 ACCTGGGCTCCTCAAAATCCTGG - Intronic
907371074 1:54004133-54004155 AGCTGGGCTCCTGAGTCTGCTGG - Intergenic
907372481 1:54012271-54012293 GCTTGGGCTCCTGAATGGGCAGG + Exonic
909164772 1:72205825-72205847 ACTTGGCCTCCTGAGTAGCCAGG - Intronic
909759323 1:79269572-79269594 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
910760791 1:90729532-90729554 AATTGGGCTCCTGCATCTCCTGG - Intergenic
911205194 1:95085584-95085606 ATTTGGACCCCTGACTCTCCAGG + Intergenic
912819288 1:112854422-112854444 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
915359999 1:155280377-155280399 CCTTGGCCTCCTGAATATCTGGG + Intronic
917932901 1:179836805-179836827 AGTTGGGCTCCTGACTCTGGTGG - Intergenic
919297691 1:195722822-195722844 AGCTGGGCTCCTGAGTCTGCTGG - Intergenic
920718837 1:208367802-208367824 TCTTTGGCTCCGGGATCTCCTGG + Intergenic
921094320 1:211874172-211874194 AGTTGGGCTCCTGAGTCTAGTGG - Intergenic
922717569 1:227885274-227885296 ACCTGGGCCCCTGAACTTCCAGG - Intergenic
923587820 1:235290844-235290866 ACTTGGCCTCCTGAAGCTCTGGG - Intronic
1068003775 10:51369056-51369078 CCTTGGGCTTCGAAATCTCCAGG - Intronic
1068695786 10:59966937-59966959 ACTTAGGCTCCTATATCTCTGGG + Intergenic
1070768559 10:79069769-79069791 ACTTGTGCGTCTGAATTTCCAGG + Intronic
1070942484 10:80359405-80359427 ATTTGGGCTCCTGAGTCTAGTGG - Intronic
1073485119 10:103812375-103812397 ACTCTGGCTCCTGAATGTCTGGG - Intronic
1073729345 10:106271017-106271039 ACTTGGTGACCTGCATCTCCAGG - Intergenic
1073730444 10:106281298-106281320 ACTTGGGCTCCTGTTGCTGCAGG + Intergenic
1073917459 10:108422697-108422719 ACTGGGTCTCCTGAATTTTCTGG - Intergenic
1074561612 10:114540275-114540297 ACTTGGGCTGCTAGACCTCCCGG - Intronic
1076984544 11:225859-225881 GCTTGAGATCCTGAATCTGCGGG - Intronic
1079491736 11:20996455-20996477 ACTGGGGCTACTGATTCTCCAGG + Intronic
1079756724 11:24274192-24274214 ACCTGGGCTCCTGAGTCTGGTGG - Intergenic
1080138914 11:28891068-28891090 AGCTGGGCTCCTGAGTCTGCTGG + Intergenic
1083424500 11:62576092-62576114 CCTTGGCCCCCTGAATCTCCAGG - Exonic
1084684026 11:70683226-70683248 CCTTGGCCTCCTGAAGCTCTGGG + Intronic
1085002164 11:73048491-73048513 ACTTCTGCTCATGAATCTGCAGG + Intronic
1087759807 11:102093417-102093439 GCTTGAGCTCCTGGATCTCTAGG + Intergenic
1088814764 11:113413351-113413373 ACGTGGGCTCCATATTCTCCTGG + Intronic
1089523192 11:119079274-119079296 CCTTGAGCTCTTGGATCTCCTGG - Exonic
1089698711 11:120231309-120231331 CCTTGGGCTCCTTAGTCTCAGGG + Intergenic
1090063432 11:123483500-123483522 CCTTAGCCTCCTGAATATCCAGG + Intergenic
1092471858 12:8787718-8787740 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
1092473053 12:8795177-8795199 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
1092498288 12:9020160-9020182 CCTTGGCCTCCTGAGTCTCTGGG + Intergenic
1093710704 12:22327258-22327280 ATTTAGACTCCTGAAACTCCAGG + Intronic
1093876881 12:24359005-24359027 ACTTGGATTCCTCAATTTCCAGG - Intergenic
1097999059 12:65921768-65921790 ACTTTTTCTCCTGGATCTCCAGG - Intronic
1098781610 12:74694178-74694200 ACTTGGCCTCCTGAAGCGCTGGG + Intergenic
1101178278 12:102180450-102180472 TCTTGGCCTCCTAAAGCTCCGGG - Intronic
1101603936 12:106233482-106233504 AGTTGGGCTCCTGAGTCTAGTGG + Intergenic
1103439133 12:120950234-120950256 ACCTGGGCTCCTGACTCTGGTGG - Intergenic
1103783306 12:123414021-123414043 AGCTGGGCTCCTGAGTCTGCTGG - Exonic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1104563490 12:129859670-129859692 AGCTGGGTTCCTGAATCTTCTGG + Intronic
1104779934 12:131413567-131413589 CCCTGGGCTCCTGCAGCTCCGGG + Intergenic
1105048317 12:133025689-133025711 CCTTGGCCTCCTGAAGCTCTGGG - Exonic
1106790890 13:33153909-33153931 ACTTAGGTTCCTGAATGTCTTGG - Intronic
1107414987 13:40192066-40192088 AGTTGGGTACCAGAATCTCCTGG - Intergenic
1108757519 13:53521871-53521893 ACTTGGACTTCTGAACTTCCTGG + Intergenic
1109159789 13:58958090-58958112 AGCTGGGCTCCTGAGTCTCGTGG - Intergenic
1110300643 13:73922842-73922864 ACTAGGGCTCCTGATTGGCCAGG + Intronic
1110497932 13:76190544-76190566 ACCTGGGCTCCTGAATCTAGTGG + Intergenic
1110854114 13:80278561-80278583 ACCTGGGCTCCTGAGTCTAATGG - Intergenic
1112613187 13:100976148-100976170 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
1115471838 14:33776011-33776033 ACATGGGCTTTTGAATCTCTTGG - Intronic
1117302602 14:54443504-54443526 AGCTGGGCTCCTGAGTCTCGGGG + Intergenic
1119520373 14:75280184-75280206 TACTGGGCTCCTGCATCTCCGGG - Intronic
1119667947 14:76498431-76498453 CCTTGGCCTCCAGCATCTCCAGG - Exonic
1119673356 14:76536658-76536680 ACTTGGGCTCCTGAGTCTGGGGG - Intergenic
1120229679 14:81829373-81829395 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
1120704671 14:87734638-87734660 AGTTGGGCTCCTGAGTCTAGTGG - Intergenic
1120709855 14:87781722-87781744 ACTTGGGATCTTGAAACTGCTGG + Intergenic
1121048702 14:90805862-90805884 ACTTGGCCTCCTTGATCCCCCGG + Intronic
1121102356 14:91258641-91258663 ACTTGGGCATCTGAATGCCCGGG + Intergenic
1122632451 14:103113137-103113159 CCTGGGGCTCCTGCATGTCCTGG + Intergenic
1122650259 14:103222098-103222120 ACCTGCCCTCCTGAGTCTCCGGG + Intergenic
1123143496 14:106105907-106105929 ACCTGGGATCCTGAAAGTCCAGG - Intergenic
1125603749 15:40928825-40928847 ACAAGGGCTCCAGAAGCTCCAGG + Intergenic
1128860489 15:71066855-71066877 ACTGGGGCTCTTGACTCTCATGG - Intergenic
1129199615 15:73991250-73991272 ACTTGGGCTCCTGAATCTCCAGG - Intronic
1129767223 15:78177993-78178015 ACTTACGCTCCTGAATCTTCTGG + Intronic
1130557516 15:84933219-84933241 ACTTGGACTCCTCCACCTCCGGG - Exonic
1132927277 16:2437406-2437428 CCTTAGGCTCCTGACTTTCCAGG - Intronic
1132978589 16:2722701-2722723 ACTTGGGCTCCTGAAGAACAAGG + Intergenic
1133945763 16:10346958-10346980 ACTTGTGCCCCAGAATCTCTAGG + Intronic
1135682794 16:24472623-24472645 CCTTGGTCTCCTGAGTCTCTGGG + Intergenic
1135944591 16:26854728-26854750 ATTTGGGCTACAGAATCTTCAGG + Intergenic
1137038003 16:35583289-35583311 AGATGGCCTCCTGAATTTCCAGG - Intergenic
1139019101 16:62725292-62725314 ACCTGGGCTCCTGAATCTGGTGG + Intergenic
1139957997 16:70702299-70702321 GCTTGTGCTCCAGAGTCTCCTGG - Intronic
1141365678 16:83440527-83440549 CCTTGGCCTCCTGAAGCTCTGGG - Intronic
1141434201 16:83989975-83989997 CCTAGGGCTCCTGGATCTCCAGG - Intronic
1144312336 17:14024738-14024760 CAATGAGCTCCTGAATCTCCTGG - Intergenic
1144332418 17:14236587-14236609 CAATGAGCTCCTGAATCTCCTGG + Exonic
1144802234 17:17937561-17937583 ACTTGGGGTCCTCAATCACTGGG - Intronic
1146416094 17:32634701-32634723 AATTGTGCTCATGAATCTCCAGG - Intronic
1147201653 17:38806278-38806300 AACTGGGCTCCTGACTCACCTGG + Exonic
1149621221 17:58046767-58046789 ACTTGGGCTCCTTCACTTCCTGG - Intergenic
1149790997 17:59477046-59477068 CCTTGGCCTCCTGAAGCTCTGGG + Intergenic
1149836088 17:59914093-59914115 ACTTGGCCCTCTGAATCTACAGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150440028 17:65183623-65183645 ACTTGTGTTTCTGGATCTCCGGG + Intronic
1150742340 17:67789418-67789440 CCTTGGCCTCCCGAAGCTCCGGG + Intergenic
1151311481 17:73295292-73295314 ACTTGGGCTCCAGCACCGCCCGG - Intronic
1151345487 17:73498881-73498903 GCTTGGGGTCCTGAAGATCCTGG + Intronic
1151438424 17:74113241-74113263 AACTGGGCTCCTGAATCTGGTGG - Intergenic
1151893969 17:76967895-76967917 ACTTGAGCTCCTCAGCCTCCTGG - Intergenic
1153656406 18:7286663-7286685 ATTGGGGCTCCTGATTCTCAGGG - Intergenic
1153792201 18:8588754-8588776 ACCTGGCCTCCTGGATCTGCAGG - Intergenic
1157967659 18:52226428-52226450 ACTCAGTCTCCTCAATCTCCTGG - Intergenic
1158553964 18:58459827-58459849 ACCTGGGCTCCTGAGTCTAGTGG + Intergenic
1158845106 18:61433725-61433747 ACTTGGGCACTTGCCTCTCCTGG + Intronic
1160045922 18:75387275-75387297 GCCTGGGCTCCTGGAACTCCAGG - Intergenic
1162325726 19:9997982-9998004 ACTTGGGGTCCTGGGGCTCCTGG + Exonic
1162765482 19:12916863-12916885 CCTTGGCCTCCTGAATAGCCAGG + Intronic
1163900697 19:20097004-20097026 ACATGGCCTCGTCAATCTCCAGG + Intronic
1165267006 19:34668598-34668620 ACCTGGGCTCCTGAGTCTGGTGG + Intronic
1167314326 19:48755122-48755144 ACTTGGGCTCCTGGGTCTGAGGG - Intronic
1167387380 19:49171821-49171843 ACTTGGGCTCCTGGGTCTGAGGG + Intronic
1167705621 19:51079390-51079412 GCCTGGGCTCCTGGGTCTCCAGG - Intronic
924986093 2:271363-271385 ACTTGGGCTCCACATTCTCAGGG + Intronic
925309726 2:2873969-2873991 ACTCGTGCTCTGGAATCTCCAGG + Intergenic
925347208 2:3179475-3179497 ACTTGCGCTCCTGTATCTGCAGG + Intergenic
927084525 2:19661206-19661228 ACTAGTGTTCCTGAATTTCCTGG - Intergenic
928217001 2:29370239-29370261 ACTTGTTCTCCTGGATCTCTGGG + Intronic
929890782 2:45917578-45917600 AGCTGGGCTCCTGAATCTGGTGG - Intronic
931318965 2:61157921-61157943 ACTTGGGCTCCAGATGGTCCAGG - Intronic
932486560 2:72087334-72087356 AGCTGGGCTCCTGAATCTGATGG + Intergenic
932897416 2:75654773-75654795 ATTTGACCACCTGAATCTCCTGG - Exonic
932902130 2:75712027-75712049 AGTTGGGCTCCTGAGTCTGGTGG + Intergenic
935445650 2:103153686-103153708 ACTTGAGCTTCTGACTCTGCAGG + Intergenic
937127322 2:119482832-119482854 CCTTGGCCTCCTGAGACTCCAGG - Intronic
937596931 2:123684228-123684250 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
937991151 2:127663280-127663302 ACTTGGCCTCCTGAGTCTGGGGG + Intronic
938308469 2:130269654-130269676 CCTGGAGATCCTGAATCTCCTGG - Intergenic
938576084 2:132606005-132606027 ACCTGGGCTCCTGCTTCTCAGGG - Intronic
939215624 2:139234591-139234613 ACCTGGGCTGCTGCATCTTCTGG - Intergenic
939898996 2:147827312-147827334 AGCTGGGCTCCTGAGTCTACTGG + Intergenic
943002126 2:182341516-182341538 TCTGGGGCTGCTGAATCTTCAGG - Intronic
944228520 2:197371019-197371041 AGCTGGGCTCCTGAGTCTCGTGG + Intergenic
944857847 2:203785481-203785503 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
945888865 2:215407321-215407343 ACTTTTGCTCATGAATCTGCAGG - Exonic
946467987 2:219929519-219929541 ACCTGGGCTCTGGAATCACCTGG + Intergenic
948525149 2:238566839-238566861 CCTGGGGCTCCTGAAGCCCCCGG + Intergenic
948873051 2:240813221-240813243 CCTGGGGCTCCTTACTCTCCAGG - Intronic
1169775888 20:9252819-9252841 TCTTTGGATCCTGAAGCTCCTGG + Intronic
1169821169 20:9711745-9711767 CCTTTGGTTCCTGAATCTCTGGG + Intronic
1173601682 20:44299587-44299609 ACCTGGGCTCCTGAGTCTGGTGG + Intergenic
1174429978 20:50460694-50460716 ACTTGGACTCCTGTAGATCCGGG - Intergenic
1175683076 20:61005602-61005624 CCTTGGGCTCCTGTGTCTTCTGG - Intergenic
1176019032 20:62953252-62953274 ACCTGGCCTCCTGACTGTCCTGG - Intronic
1176052723 20:63129052-63129074 ACGTGGGCACCTGACTTTCCTGG + Intergenic
1179007797 21:37530270-37530292 TCTTGGCCTCCAGAATCTCTGGG - Intergenic
1180996267 22:19967220-19967242 GATTGGGCTCCTGAGTCCCCTGG + Intronic
1181180340 22:21063438-21063460 CCTTGGCCTCCTGAGTCTACAGG - Intronic
1181427173 22:22851217-22851239 ACTTAAGTTCCTGAATCTCCTGG + Intronic
1181870022 22:25890854-25890876 CCTTGAGCTCCTGGACCTCCCGG - Exonic
1184176079 22:42789862-42789884 CCTTGGCCTCCTGAATATCTGGG - Intergenic
1184895298 22:47403163-47403185 CCTTGGCCTCCTGAGTATCCAGG - Intergenic
950757152 3:15184780-15184802 ACCTGAGCTCCTGAATCTGTGGG - Intergenic
951610268 3:24484053-24484075 TCTTGGGCTCCTCCATCTTCAGG - Intronic
951980595 3:28562117-28562139 ACTTGGGTGTCTGAAACTCCAGG - Intergenic
953665580 3:44923685-44923707 CCTTGGCCTCCTGAATATCCAGG - Intronic
954905132 3:54055111-54055133 GCTTGTTCTCCTGATTCTCCAGG + Intergenic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
958798839 3:98733262-98733284 ACTGGGGCTCCAGGATCCCCGGG - Intronic
958890246 3:99775201-99775223 ACCTGGGCTCCAGTCTCTCCTGG + Intronic
958928706 3:100186659-100186681 ACTTGGGCTCTTGTCTTTCCTGG - Intronic
960077516 3:113504482-113504504 CCTCGGCCTCCTGAACCTCCTGG - Intronic
960531541 3:118771228-118771250 ACTTGACTTCCTGAATCTTCTGG - Intergenic
960823370 3:121757839-121757861 ACCTGGGCTTCTGAATATGCTGG + Intergenic
961504776 3:127362774-127362796 ACTTGCCCACCTGAGTCTCCAGG - Intergenic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
962158819 3:132977747-132977769 ACTTGGGCTTCCTAATATCCTGG + Intergenic
965220129 3:165918353-165918375 ACCTGGGCTCCTGAGTCTGGTGG - Intergenic
969325343 4:6440894-6440916 ACTTGGCCTCCTTCATGTCCTGG - Intronic
969654895 4:8491317-8491339 ACCTGGGCTCCTGAGTCTGGTGG - Intronic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
969881964 4:10182038-10182060 CCTGGGGCTTCTGAATGTCCTGG + Intergenic
971377025 4:26063877-26063899 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
971804968 4:31345269-31345291 ACTTGGCCTCCCGAATTTCTGGG - Intergenic
974590504 4:63942789-63942811 AGCTGGGCTCCTGAATCTGGCGG - Intergenic
976191801 4:82494358-82494380 CCTTGGGCTTCTGAATTTCTAGG + Intronic
977885685 4:102250204-102250226 ACCTGGGCTCCTGAGTCTAGTGG - Intergenic
978254795 4:106681355-106681377 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
978579575 4:110218505-110218527 ACTTTTCCTCCTGAACCTCCAGG + Intergenic
978905064 4:113995755-113995777 ACTTGGCCTCCTGAAGCACTGGG + Intergenic
979532116 4:121779947-121779969 TCTTGGCCTCCTGAATAGCCAGG + Intergenic
979612578 4:122704749-122704771 ACATGGACACCTGACTCTCCAGG + Intergenic
979755950 4:124339465-124339487 ACCTGGGCTCCTGAGTCTGGTGG + Intergenic
980051845 4:128047466-128047488 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
980827243 4:138088499-138088521 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
983758021 4:171365942-171365964 ACTTGGGCCCCTAACTCTCCAGG - Intergenic
984275653 4:177607015-177607037 AGTTGGGCTCCTGAGTCTAGTGG - Intergenic
984946132 4:184969925-184969947 ACTGGGCCTCCTGAGTCTCCTGG + Intergenic
985422601 4:189799676-189799698 ACTTGGGATCCTGAATAACCAGG - Intergenic
987373279 5:17212584-17212606 ACTTGGAATGCTTAATCTCCTGG + Intronic
987543914 5:19288198-19288220 ACCTGGGCTCCTGAGTCTGGTGG + Intergenic
988035494 5:25823224-25823246 AGCTGGGCTCCTGAGTCTGCTGG - Intergenic
994239944 5:97407612-97407634 ACCTGGGCTCCTGAGTCTAGTGG + Intergenic
995112298 5:108441988-108442010 ACCTGGGCTCCTGAGTCTGGCGG - Intergenic
995700481 5:114929361-114929383 AGCTGGGCTCCTGAGTCTACTGG + Intergenic
997294680 5:132762097-132762119 CCTGGTGCTCCTGATTCTCCAGG + Intronic
998063001 5:139133776-139133798 ATTTGTTTTCCTGAATCTCCTGG + Intronic
999690359 5:154140978-154141000 AGTGGGGCTCCTGAATATCTTGG + Intronic
1001583962 5:172820361-172820383 ACTTGGGCCCCAGACTCCCCAGG + Intergenic
1001723826 5:173879578-173879600 ACATGGGCTGCTGAATCTGAAGG + Intergenic
1003050766 6:2779071-2779093 ACTGGGGCTCCTAAGTCACCAGG - Intronic
1003506604 6:6745623-6745645 TGCTGGGCTCCTGAATCTGCTGG - Intergenic
1003578238 6:7316730-7316752 AGCTGGGCTCCTGAATCTAGTGG - Intronic
1004196498 6:13510942-13510964 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
1004861304 6:19806917-19806939 ACCTGGGCTCCTGAATCTGATGG - Intergenic
1004914690 6:20320621-20320643 AGTTGGGCTCCTGAGTCTAGTGG + Intergenic
1005600781 6:27424734-27424756 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
1006637090 6:35468663-35468685 ACTTGGTGTCCGGAATCTACGGG + Intronic
1007938748 6:45757170-45757192 CCTTGTGCTGCTGAATCTCTAGG + Intergenic
1008587443 6:52962538-52962560 AGCTGGGCTCCTGAATCTGCTGG - Intergenic
1009913141 6:69959033-69959055 ACTTTGGCTTCTGAGTTTCCAGG - Intronic
1010523309 6:76868368-76868390 ACTTAGTCTCTTGAATCTCTGGG - Intergenic
1011338273 6:86284725-86284747 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
1012578146 6:100829138-100829160 AGTTGGGCTCCTGAGTCTGGTGG - Intronic
1013512703 6:110859022-110859044 ACTTGGGGTCATGTATCTGCCGG - Intronic
1015142939 6:129956178-129956200 ACTTGGCCTCCTAAATCCCTGGG - Intergenic
1016631602 6:146239840-146239862 AATTCGGTTCCTGAATCTCCGGG - Intronic
1017325178 6:153134076-153134098 AGCTGGGCTCCTGAGTCTGCTGG + Intergenic
1017903412 6:158737888-158737910 ACCAGGGCTCCTAAATCTCTGGG - Intronic
1018361783 6:163078177-163078199 AGTTAGGCTCCTGAGTCTCCAGG - Intronic
1019414219 7:919974-919996 AGTAGGGCTCCTGCTTCTCCGGG + Exonic
1020644921 7:10802953-10802975 GCTTGGGTTCCTGAATCACCAGG + Intergenic
1020980043 7:15055534-15055556 AGGTCGGCTCCTGAATCTTCAGG - Intergenic
1021567810 7:22032273-22032295 ACCTGGGCTCCTGAGTCTGATGG - Intergenic
1021630754 7:22644559-22644581 CCTTGAACTCCTGAAACTCCTGG + Intergenic
1024127267 7:46312235-46312257 TCTAGGGGTCCTCAATCTCCAGG - Intergenic
1024219804 7:47278564-47278586 ACTGGGGCTCAGGAATCTGCAGG - Intronic
1024676934 7:51645737-51645759 CCCTGTGCTCCTCAATCTCCAGG + Intergenic
1024740150 7:52344713-52344735 ACTTGTTCTCCTGACTCTCTTGG + Intergenic
1032103273 7:129001519-129001541 ACTTGGGCATCTGCATCTCTTGG + Intronic
1034937704 7:155210436-155210458 AGGAGGGCTCCTGCATCTCCTGG + Intergenic
1035764466 8:2094851-2094873 AATTGGGATCCTAAATCTCAGGG + Intronic
1036059026 8:5294258-5294280 CCTTGTTCTCCTGAATCTTCAGG + Intergenic
1036184763 8:6613597-6613619 CCTTGGGCTCCTGTCTCCCCGGG - Intronic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036258074 8:7221052-7221074 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036310124 8:7679648-7679670 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036359411 8:8066454-8066476 ACGTTGGCCCCTGAATCACCGGG + Intergenic
1036616047 8:10388591-10388613 TCTTGGCCTCCTGAAGCTTCAGG - Intronic
1036654682 8:10670626-10670648 CCTTGGCCTCCTGAAGCTCTTGG - Intronic
1036827072 8:11986025-11986047 ACTAGGGATCCTGAAAGTCCAGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036891544 8:12600498-12600520 ACGTTGGCCCCTGAATCACCGGG - Intergenic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1037116894 8:15237584-15237606 CCTTGAGCTCCTCAATGTCCAGG + Exonic
1037957464 8:23070687-23070709 ACCTGGGCTCCTGAGTCTGGTGG - Intergenic
1039338504 8:36621408-36621430 ACTTTGGCTCTGGTATCTCCAGG - Intergenic
1040607455 8:48948522-48948544 ACTTGGCCTTCTAGATCTCCAGG + Intergenic
1041688077 8:60662565-60662587 ACTTGAGCCCCTCAACCTCCAGG - Intergenic
1043051741 8:75393826-75393848 ACTTTGGCTCCAGAAACCCCTGG - Intergenic
1043129852 8:76447522-76447544 AGCTGGGCTCCTGAATCTGGTGG - Intergenic
1043352408 8:79377110-79377132 ACCTGGGCTCCTGAGTCTGGTGG - Intergenic
1043435409 8:80232262-80232284 AGGTGGGCTCCTGAATCTGGTGG + Intergenic
1043694405 8:83201805-83201827 ACTTGAACTCCTGTTTCTCCTGG + Intergenic
1043773354 8:84233233-84233255 ACTTGGGCTCCCAAAGCTCTGGG + Intronic
1044441727 8:92231229-92231251 ACCTGGGCTCCTGAGTCTGGTGG + Intergenic
1044633390 8:94300240-94300262 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
1045178432 8:99752976-99752998 TCCTGGGCTCTGGAATCTCCAGG + Intronic
1046302267 8:112311438-112311460 TGTTGGGCTTCTGAACCTCCAGG - Intronic
1049016123 8:139921404-139921426 TCATGGGCTTCTGAAGCTCCTGG - Intronic
1049058234 8:140255768-140255790 CCTTGGGCTCCTGAATAGCCAGG - Intronic
1049838144 8:144753722-144753744 ACTTTGGGTCCTGAATCTTCTGG - Exonic
1050310151 9:4344419-4344441 ACTTGGCCTCCTGGAAATCCTGG + Intronic
1051305004 9:15699951-15699973 AGTTGGGCTCCTGAGTCTGGTGG - Intronic
1055405902 9:75973572-75973594 CCTTGGCCTCCTGGATCTCCGGG + Intronic
1056019118 9:82423291-82423313 ACTGGGTCTCCTGAGTCTCAGGG - Intergenic
1056549055 9:87636231-87636253 GCTTGGACTCCTGGATGTCCTGG + Intronic
1056736012 9:89209812-89209834 AGGTGGGCTCCTGAGTCTCCTGG + Intergenic
1057053846 9:91946713-91946735 ACTTGAGCTCCCTAATCTGCAGG - Intronic
1057511220 9:95680784-95680806 AGTTGGGCTCCTGAGTCTGGTGG + Intergenic
1057808365 9:98237739-98237761 TCTGGGGCTCTTGAATTTCCAGG + Intronic
1060473404 9:123967451-123967473 TCTTTAACTCCTGAATCTCCAGG + Intergenic
1061812045 9:133167842-133167864 ACTTGTCCTCCTGAAACACCAGG - Intergenic
1186056136 X:5651653-5651675 ACTTGGGCTCCTAAAGTGCCGGG - Intergenic
1186066539 X:5772202-5772224 ACTTGGTCTCCTGCCTCTCTGGG + Intergenic
1186066951 X:5776592-5776614 ACTTGGGATCCAGACTCTCTGGG - Intergenic
1186161548 X:6782176-6782198 ACTAGGGCACCGGAATTTCCCGG - Intergenic
1187139135 X:16575905-16575927 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
1188166882 X:26873608-26873630 ACCTGGGCTCCTGAGTCTGGTGG - Intergenic
1190218525 X:48495962-48495984 CCTTGGGCTTCAGGATCTCCTGG - Intergenic
1190887035 X:54539458-54539480 TCTTTGGTTCCTGGATCTCCTGG + Intronic
1190988378 X:55521456-55521478 ACTTGGGCTCCTTGATATGCTGG + Intergenic
1191227318 X:58057141-58057163 ACTTGGAATTCTGAAACTCCTGG - Intergenic
1192096221 X:68213882-68213904 TCTTGGACTCCTGAACTTCCTGG + Exonic
1195111680 X:101656870-101656892 ACTGGGGCTGCAGAGTCTCCTGG - Exonic
1195259293 X:103117018-103117040 AGCTGGGCTCCTGAGTCTGCTGG - Intergenic
1196616231 X:117769486-117769508 AGCTGGGCTCCTGAATCTGGTGG + Intergenic
1196793904 X:119487771-119487793 AGTTGGGCTCCTGAGTCTGGTGG - Intergenic
1198664236 X:139003933-139003955 ACCTGGGCTCCTGAGTCTGGTGG - Intronic
1200852789 Y:7903093-7903115 ACTGGGGCTCCAGAATGTCACGG - Intergenic
1201232561 Y:11879466-11879488 ACCTGGGCTCCTGAGTCTGTGGG - Intergenic
1201271027 Y:12253841-12253863 CCTTGGCCTCCTGAAGTTCCGGG + Intergenic
1202272532 Y:23085556-23085578 AGCTGGGCTCCTGAATCTAGTGG - Intergenic
1202293494 Y:23335126-23335148 AGCTGGGCTCCTGAATCTAGTGG + Intergenic
1202425529 Y:24719300-24719322 AGCTGGGCTCCTGAATCTAGTGG - Intergenic
1202445260 Y:24950785-24950807 AGCTGGGCTCCTGAATCTAGTGG + Intergenic