ID: 1129203282

View in Genome Browser
Species Human (GRCh38)
Location 15:74019052-74019074
Sequence CAGTCTTACCAGAGGGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129203272_1129203282 13 Left 1129203272 15:74019016-74019038 CCTGGGTGGCAGCCCTTTGATTC 0: 1
1: 0
2: 1
3: 5
4: 118
Right 1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 159
1129203270_1129203282 19 Left 1129203270 15:74019010-74019032 CCTGGCCCTGGGTGGCAGCCCTT 0: 1
1: 0
2: 3
3: 46
4: 345
Right 1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 159
1129203275_1129203282 0 Left 1129203275 15:74019029-74019051 CCTTTGATTCAGGATCTGCACCT 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 159
1129203271_1129203282 14 Left 1129203271 15:74019015-74019037 CCCTGGGTGGCAGCCCTTTGATT 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 159
1129203274_1129203282 1 Left 1129203274 15:74019028-74019050 CCCTTTGATTCAGGATCTGCACC 0: 1
1: 0
2: 0
3: 14
4: 152
Right 1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG 0: 1
1: 0
2: 0
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129203282 Original CRISPR CAGTCTTACCAGAGGGCTGG GGG Intronic
901202542 1:7474890-7474912 CAGTCCTTCCTGAGGGCTGCAGG - Intronic
902110517 1:14074496-14074518 CAGTCTTAGAAGAAGGCTTGGGG + Intergenic
905870594 1:41402016-41402038 CACTATGACCACAGGGCTGGAGG - Intergenic
907570160 1:55476099-55476121 CTGTCTTCCCAGAGGAGTGGAGG + Intergenic
911093550 1:94037204-94037226 CAGCCTTTTCAGAGAGCTGGAGG - Exonic
913537006 1:119782771-119782793 GAGTATTACCTGAGGGCTGGGGG - Intergenic
917452119 1:175155945-175155967 CAGCCTCAAAAGAGGGCTGGAGG + Intergenic
917631729 1:176897389-176897411 AAGTCTTGCCAGAGGGCTTGAGG + Intronic
917812443 1:178672219-178672241 GAGTCCTACCAGAGACCTGGAGG + Intergenic
919641565 1:200049995-200050017 CAGTCTTAACAGCGTGCTGATGG - Intronic
920183652 1:204147563-204147585 GAGTCTTAGCAGACGGTTGGGGG - Intronic
922443574 1:225677537-225677559 CAGCCTCTCCGGAGGGCTGGAGG + Intergenic
923106257 1:230856247-230856269 CAGGCCTACCAGAGAGCTCGAGG + Intronic
923779453 1:237009160-237009182 CAGTCTCCCCAAAGGCCTGGAGG - Intergenic
1063395180 10:5680091-5680113 CTGTCGTACCAGAGTGATGGTGG - Intergenic
1067242234 10:44506715-44506737 CTGTGTTGGCAGAGGGCTGGGGG + Intergenic
1072519795 10:96221311-96221333 CAGGCTAAACAGAGAGCTGGAGG - Intronic
1074377359 10:112951188-112951210 CCGCCTTCCCAGAGGGGTGGAGG - Exonic
1074561101 10:114535936-114535958 CAGATTTACCAGGGGGATGGTGG + Intronic
1076997068 11:303069-303091 CAGTGATACCAGTGGGCTTGGGG + Intergenic
1081315615 11:41625755-41625777 CACTCTCATCAGAGGCCTGGCGG - Intergenic
1083276162 11:61598178-61598200 CATTCTTACGAGAGACCTGGAGG - Intergenic
1084488847 11:69467142-69467164 CAATCTTACCTGAGCCCTGGAGG + Intergenic
1084520584 11:69660192-69660214 CAGTCTTCCCTTAGGGCTGCAGG - Intronic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1087216872 11:95504191-95504213 CAGTCTTCCCAGAGAGCATGTGG + Intergenic
1087283254 11:96235848-96235870 CAGTCATACCAGAAAGCTGCGGG + Intronic
1091315329 11:134610349-134610371 CCGGCTTCCCTGAGGGCTGGAGG + Intergenic
1096398006 12:51281316-51281338 CAGCCTTACGGGAGGGATGGAGG - Exonic
1096978933 12:55717371-55717393 CAGGCTTGCCAGAGGGTGGGAGG - Intronic
1101570512 12:105949159-105949181 CAACCTTACAAAAGGGCTGGAGG + Intergenic
1103411021 12:120711129-120711151 CTGGCCTGCCAGAGGGCTGGGGG - Intronic
1103593656 12:122010012-122010034 CAGTCTGGCCGGTGGGCTGGGGG - Intergenic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1103995435 12:124826940-124826962 CAATCTCAGGAGAGGGCTGGGGG + Intronic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104749431 12:131229054-131229076 CATTCTTCCCAGTGGGCTCGTGG - Intergenic
1105451336 13:20502682-20502704 CAGTGTTACCACTGGCCTGGAGG - Intronic
1107531431 13:41285776-41285798 CAGTTTTCCCATTGGGCTGGAGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115337351 14:32255107-32255129 CAGTCCTAGAAGAGGGCTGAAGG - Intergenic
1122614884 14:103010429-103010451 GAGTCTCACCAGAGGGATAGGGG - Intronic
1122814830 14:104307262-104307284 TGGTCTTGCCAGAGGGCTGGCGG + Intergenic
1125972994 15:43927280-43927302 AAGTGATACCAGTGGGCTGGGGG - Intronic
1126761256 15:51971959-51971981 GATTCTTACCAGGGGGCGGGGGG + Intronic
1127574370 15:60275552-60275574 CAGTTTTGCCAGAGGGTTTGAGG - Intergenic
1127695821 15:61446119-61446141 CAGTTTTAGTAGAGTGCTGGGGG + Intergenic
1127836077 15:62792336-62792358 CATTCTTACCAGGTGGCTGGAGG + Intronic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1129775190 15:78232076-78232098 CACTCTTAGCAGCAGGCTGGAGG - Intronic
1130932748 15:88441427-88441449 CAGCCTTAGTAGAGGACTGGAGG - Intergenic
1131423537 15:92326843-92326865 CAGTCCTGCCTGAGGGCTGAGGG + Intergenic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1137554393 16:49461508-49461530 CAGTCCTCCCAGAGGGCCAGGGG + Intergenic
1138489712 16:57369635-57369657 CAGCCCTACCAGAGGGCTAGAGG - Intergenic
1138823479 16:60289779-60289801 AGGTCTTCCCAGAGGGCTGCAGG - Intergenic
1140138451 16:72229948-72229970 ACATATTACCAGAGGGCTGGAGG + Intergenic
1141440923 16:84029137-84029159 CAGTCAGACCTGAGGCCTGGAGG - Intronic
1141825500 16:86476849-86476871 CAGTCTTACCTGAGTCCAGGAGG + Intergenic
1141923288 16:87150710-87150732 CAATCTTACCACAGGGATGGGGG + Intronic
1142434697 16:90048610-90048632 CAGTCTCACCAGACGCCTGAAGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1146911282 17:36649935-36649957 AAGTCTGACCTGGGGGCTGGGGG + Intergenic
1148382607 17:47210530-47210552 CAGCCTTAGGACAGGGCTGGGGG + Intronic
1148644208 17:49210195-49210217 CCGTCATACCAGAGGACTGTGGG - Intronic
1152880134 17:82809726-82809748 CAGGCTTCCCAGAGCCCTGGCGG + Exonic
1152883004 17:82831120-82831142 GAGTCTTCCCAGTGCGCTGGAGG + Exonic
1153227770 18:2910966-2910988 CACTCTGAGCAGAGGCCTGGAGG - Intronic
1153595619 18:6722367-6722389 CAGTCTTTCCAGAGGACTTGAGG + Intergenic
1153617421 18:6947598-6947620 CAGTCTTTCCCGTGGGCTGTTGG + Intronic
1155332307 18:24730740-24730762 CTGCCTTGCCAGAGTGCTGGAGG + Intergenic
1156310557 18:35918473-35918495 CCGTCTGGCCAGAGAGCTGGGGG + Intergenic
1156476527 18:37409189-37409211 CAGTCCTCCCAGAAAGCTGGTGG - Intronic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1163848531 19:19650782-19650804 CAGTGTTGCCACAGGGCTGCTGG - Intronic
1164562249 19:29300305-29300327 CAGTGTAAGCAGAGGGGTGGAGG - Intergenic
1202645793 1_KI270706v1_random:140099-140121 CACTTTGACCAGTGGGCTGGTGG + Intergenic
925868997 2:8253180-8253202 CAGCCTCCCCAGAGTGCTGGAGG + Intergenic
927997576 2:27496718-27496740 TGGGGTTACCAGAGGGCTGGGGG + Intergenic
933006182 2:76998320-76998342 CAGTCTAACTAGAGAGCTGAGGG + Intronic
933006265 2:76999256-76999278 CAGTCTAACTAGAGAGCTGAGGG - Intronic
935840926 2:107109468-107109490 CAGTCTTACCAAAGGGGTAAAGG + Intergenic
936057543 2:109272184-109272206 CAGTCATTGCAGAGGGCTGTGGG - Intronic
938574405 2:132590732-132590754 CAGTCTTCCCAGGTGGTTGGTGG - Intronic
940048704 2:149437813-149437835 CAGTCTTACTTGAAGGATGGAGG - Exonic
940650431 2:156435949-156435971 CCGCCTTGCCAGCGGGCTGGCGG - Intronic
946760149 2:222985498-222985520 CAGTCTTCCCAAAGGCTTGGAGG + Intergenic
947534663 2:230933277-230933299 CAGTCTGCCCAGGTGGCTGGAGG - Intronic
947593916 2:231399352-231399374 CAGTCTCCCCAGAGGCCGGGCGG + Exonic
1169247912 20:4038355-4038377 CAGTCAGCCCAGAGGGCGGGTGG + Intergenic
1170610365 20:17907791-17907813 CAGCCTTATGAAAGGGCTGGAGG - Intergenic
1170830140 20:19832821-19832843 GGGTCTTACCAAAGGGCTTGAGG - Intergenic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172133588 20:32672829-32672851 CTGTCTTCCCACAGGGCTGTGGG + Intergenic
1172560882 20:35887419-35887441 CAGGCTTACCTGATGGTTGGCGG + Intronic
1173558065 20:43982204-43982226 CAGTCTTCTCAGAGAGTTGGTGG + Intronic
1173561832 20:44011608-44011630 CAGTTTTACCAGATGGCTGAGGG + Intronic
1173750397 20:45470933-45470955 CAGTCTTTCCCCAGGGCTGGGGG - Intronic
1174180082 20:48669047-48669069 CATCCTTCCCAGAGGGCTGCAGG - Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1176606089 21:8832650-8832672 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1176993222 21:15522780-15522802 CAGTCTTATAAGAAGGCTTGCGG + Intergenic
1177112344 21:17043518-17043540 GAATCTTACCACAGGGCAGGAGG + Intergenic
1179781320 21:43702654-43702676 CAGCCCTACCTGGGGGCTGGAGG + Intergenic
1180348387 22:11724256-11724278 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180356160 22:11842348-11842370 CACTTTGACCAGTGGGCTGGTGG - Intergenic
1180382097 22:12149979-12150001 CACTTTGACCAGTGGGCTGGTGG + Intergenic
1181413194 22:22739327-22739349 CAGTCTGCCGGGAGGGCTGGAGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182252380 22:29011376-29011398 CATTCACACCATAGGGCTGGTGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1184881094 22:47304586-47304608 CACTCTCACCATGGGGCTGGAGG - Intergenic
950161220 3:10762755-10762777 CAGACACACCTGAGGGCTGGGGG + Intergenic
951114508 3:18844253-18844275 CAGCTTTACCACAGGGCTGGGGG + Intergenic
953069670 3:39506565-39506587 TTATCTTACCAGAGGGGTGGAGG + Intronic
953998266 3:47536882-47536904 CAGTCTCAGCAGAGAGCTGTGGG - Intergenic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
955339937 3:58117478-58117500 CAGGCTAACCAGAGGTCTTGGGG - Intronic
960949421 3:122989443-122989465 AAGCCTTACCAGAGCCCTGGTGG - Intronic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
964872037 3:161323912-161323934 CAGGCTTACCAAAAGGCTGAAGG + Intergenic
968284145 3:197498542-197498564 CAGTCTCCCCAGAGCACTGGTGG + Intergenic
968716312 4:2162257-2162279 CATTCCTCCCAGTGGGCTGGTGG - Intronic
969232787 4:5843222-5843244 CTGTCTAACCAGGGGGTTGGAGG - Intronic
969289207 4:6227877-6227899 CAGTCTAACCAGAGAACTGAAGG - Intergenic
969415637 4:7056127-7056149 CCGTCTGACCAGTTGGCTGGCGG + Exonic
969654790 4:8490481-8490503 CATTCCTCCCAGTGGGCTGGTGG + Intronic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
973372019 4:49258517-49258539 CACTTTGACCAGTGGGCTGGTGG + Intergenic
973388986 4:49536801-49536823 CACTTTGACCAGTGGGCTGGTGG - Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
976027013 4:80700406-80700428 CAGTATTATCAGTGGGATGGTGG + Intronic
979745929 4:124213006-124213028 CTGTTTTACCAGATGGCTGCTGG - Intergenic
980511784 4:133800210-133800232 CAGTTAAACCAGATGGCTGGAGG - Intergenic
986859447 5:11909511-11909533 TATTCTTACCAGAGGCATGGAGG - Intergenic
990213392 5:53504726-53504748 AAGTCTGAACAGAGGGGTGGTGG - Intergenic
990345438 5:54866221-54866243 CATTCCTCCCAGAGGGCTCGTGG - Intergenic
990347892 5:54887019-54887041 GTGTCCTACCAGAGTGCTGGAGG + Intergenic
995229250 5:109740054-109740076 CAGGCTTAACAAAGGGCTGGAGG - Intronic
997596624 5:135111474-135111496 CAGGTCTACCAGAGTGCTGGAGG - Intronic
1001720110 5:173850042-173850064 AAGTCTGACCATAGGTCTGGTGG - Intergenic
1002068123 5:176662661-176662683 CAGCATTACCACAGGTCTGGCGG + Intergenic
1002703292 5:181142456-181142478 CAGTCAGATCAGAGGGCTGAGGG - Intergenic
1003125438 6:3351990-3352012 CAGCCTTACCAGTCGGGTGGTGG - Intronic
1006583727 6:35091896-35091918 AAGTGTTCCCAGAGGGCTGGTGG + Intergenic
1006908041 6:37546043-37546065 CAGCCTATCTAGAGGGCTGGAGG + Intergenic
1014772862 6:125476558-125476580 CAGGCTTCCCAGAGTGCTTGTGG - Intergenic
1015237576 6:130988532-130988554 CAGGCTTTCCTGAGGGGTGGCGG + Intronic
1019634150 7:2066667-2066689 CAGACTTCCCAGAAGGCTGCGGG + Intronic
1023840904 7:44097012-44097034 CAGGCTCACCCCAGGGCTGGAGG + Intergenic
1024827268 7:53405962-53405984 CAGTCTTATAAAAGGGCTGGAGG + Intergenic
1025791747 7:64694228-64694250 CTGTCTTTCCAGAGGCCTGGAGG - Intronic
1027859410 7:83556831-83556853 GAGCCTTACAAAAGGGCTGGAGG + Intronic
1028957948 7:96714780-96714802 GAGACTTACCAGAGACCTGGTGG - Intergenic
1035716036 8:1755609-1755631 CGGTCTGCCCAGAGGGCTGGGGG + Intergenic
1035996289 8:4551204-4551226 CAGTATTACAGGAGGGTTGGTGG - Intronic
1037767934 8:21783226-21783248 CAGCCTCAGCAGAGAGCTGGGGG + Intronic
1038049864 8:23798457-23798479 CAGGCTCCCCAGAGGGCTCGAGG + Intergenic
1042205793 8:66328631-66328653 CATTCATTCAAGAGGGCTGGGGG - Intergenic
1043803822 8:84645650-84645672 AAGTCTGACCAAAGGACTGGGGG - Intronic
1048841097 8:138566942-138566964 TGGTCTTACAAGAGGGCTGGAGG + Intergenic
1051367643 9:16332533-16332555 CAGACCTACCAGGGAGCTGGAGG + Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1056519443 9:87386621-87386643 CAGCCTTTCCTGAGAGCTGGTGG + Intergenic
1057502494 9:95606817-95606839 CAATGTTAGCAGAGGCCTGGAGG + Intergenic
1058868215 9:109180683-109180705 CAGTCTTACGAGATGGATGATGG - Intronic
1060417799 9:123445107-123445129 CCTTCTTCTCAGAGGGCTGGAGG - Intronic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1190370414 X:49735047-49735069 CAGTCTTACCAGATTGTAGGTGG - Intergenic
1194779634 X:98009232-98009254 CAGCCTTATAAAAGGGCTGGAGG - Intergenic
1195314006 X:103660029-103660051 CATTCTGACCAGCAGGCTGGTGG - Intergenic
1197354690 X:125423515-125423537 TAGTGTTTGCAGAGGGCTGGGGG + Intergenic
1199800946 X:151250187-151250209 CAGTCTCAGGAGAGAGCTGGAGG - Intergenic
1200049816 X:153422860-153422882 AGGTCTTCTCAGAGGGCTGGGGG - Intergenic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic