ID: 1129204092

View in Genome Browser
Species Human (GRCh38)
Location 15:74025144-74025166
Sequence CTCTTGATGGGCCATGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129204088_1129204092 -6 Left 1129204088 15:74025127-74025149 CCTAAATGCCAAAGTTGCTCTTG 0: 1
1: 0
2: 0
3: 17
4: 196
Right 1129204092 15:74025144-74025166 CTCTTGATGGGCCATGAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129204092 Original CRISPR CTCTTGATGGGCCATGAGCC AGG Intronic
901832028 1:11898593-11898615 CTCTGGAAGGGCCATGCGCTTGG + Intergenic
905923207 1:41732653-41732675 CTCTTGCTGGGCTCTGTGCCTGG + Intronic
914885621 1:151582018-151582040 CTCTGGCTGTGCCATAAGCCAGG + Exonic
915540316 1:156561925-156561947 GTCTTGAAGGGCCTTGAGCAAGG + Exonic
922699588 1:227750986-227751008 CTCCTGCTGGGAAATGAGCCGGG + Intronic
922849949 1:228723914-228723936 CCCTTGATGGTCCATTTGCCTGG + Intergenic
1064867375 10:19896094-19896116 CTCTTGATCTGCCATGATCTTGG + Intronic
1068142222 10:53023382-53023404 TTCTTGCTGGGGGATGAGCCTGG + Intergenic
1073175320 10:101552792-101552814 CTTTTGAGTGGCCATGAGCATGG - Intronic
1076054323 10:127358946-127358968 CTCTAGATGGGCTATGAGACCGG + Intronic
1077143313 11:1034358-1034380 CTCATGCTGGGCCCTGAGCCTGG + Intronic
1081701674 11:45156397-45156419 CTCTTGATGGGCCCTGCACCAGG + Intronic
1081853542 11:46290235-46290257 CTGGTGTTGGGCCAGGAGCCAGG - Intronic
1083277755 11:61606760-61606782 CTCTCGATGGCACAGGAGCCTGG - Intergenic
1089755876 11:120686470-120686492 CTATTGTAAGGCCATGAGCCTGG - Intronic
1090637027 11:128695475-128695497 CTCTTGCTGAGCCCTGAGCAGGG - Intronic
1090942135 11:131396177-131396199 CTACTGATGGGCAATGAGACTGG + Intronic
1094490696 12:30958811-30958833 CCCTTGATGGCCCAAGAGCGTGG + Intronic
1095652626 12:44630642-44630664 CTTGTGATGGGACATGACCCTGG - Intronic
1096760685 12:53839547-53839569 CTCTGGATGGGACGTGAGCCTGG + Intergenic
1097614996 12:61873050-61873072 CTCTTGATGTTCCATGATCCAGG - Intronic
1101429526 12:104615427-104615449 CACTGGATGGGACATGAGGCAGG - Intronic
1102526912 12:113519185-113519207 CTCTTGAAGGTTCTTGAGCCTGG - Intergenic
1102712005 12:114936374-114936396 CTGTTGAGAGGCCATGAGGCTGG + Intergenic
1102734233 12:115143936-115143958 CTCATTTTGGGCCCTGAGCCAGG + Intergenic
1103193672 12:119024152-119024174 CCCATGATGGGCCAGGAGCTGGG - Intronic
1103949625 12:124543730-124543752 CCCGTGCTTGGCCATGAGCCAGG - Intronic
1104017479 12:124970752-124970774 CTCCACATGTGCCATGAGCCTGG - Intronic
1104184705 12:126419319-126419341 CTCTTTCTTGGCCATCAGCCAGG - Intergenic
1104912877 12:132248079-132248101 TGCCTGCTGGGCCATGAGCCAGG + Intronic
1107789525 13:43987668-43987690 GACTTGATGGGCCATGAGAGAGG + Intergenic
1110548969 13:76790657-76790679 CTCTTGGTGGGGGATGAGCTTGG - Intergenic
1110619956 13:77584380-77584402 CCCCTGCTGGGCCAGGAGCCAGG - Intronic
1113112755 13:106841601-106841623 CTGTTGAGTGGCCACGAGCCTGG - Intergenic
1113692480 13:112321335-112321357 CTCTGGATGTACCATCAGCCTGG - Intergenic
1114422756 14:22598365-22598387 CTCTCTCTGGGCCATGATCCTGG + Intronic
1119343854 14:73905002-73905024 CCCTTTATGTGCCATGAGTCTGG + Exonic
1121155085 14:91675627-91675649 CCCTTGATGGGGAATCAGCCTGG + Intronic
1122704824 14:103614123-103614145 CTCCTCATGGGCCATGATTCAGG + Intronic
1122938473 14:104970641-104970663 CCCCTGATGGGCCAGGAGCCTGG + Intronic
1123933418 15:25182765-25182787 GGCATCATGGGCCATGAGCCAGG + Intergenic
1124375390 15:29126115-29126137 GTCTTGATGGCCCCTGAGCCAGG - Intronic
1127808277 15:62540964-62540986 CTCTTGATCTGTCATGAGCAGGG - Intronic
1127892231 15:63263771-63263793 CTTTTGCTAGGCCATGAGGCTGG - Exonic
1128876851 15:71208838-71208860 GTCATGATGGGCCATGAGCCAGG - Intronic
1129204092 15:74025144-74025166 CTCTTGATGGGCCATGAGCCAGG + Intronic
1130105008 15:80922423-80922445 CTCTTGGTGGCCCCTGAGCTGGG + Intronic
1132845881 16:2000591-2000613 CTCTTGATGGGCACGGTGCCTGG - Intronic
1133580152 16:7136938-7136960 CTCGTCATGGCCCATGGGCCAGG + Intronic
1134797665 16:17056751-17056773 CTCCTGATGGCCCAGGACCCAGG - Intergenic
1135348590 16:21710043-21710065 CTCAGGTTGGGCCAAGAGCCAGG + Exonic
1136909457 16:34134253-34134275 CGCCTGATGGGCCTTGAGCCTGG + Intergenic
1137714350 16:50589151-50589173 CTCTTGGTGAGCCTTGGGCCTGG + Intronic
1138289694 16:55836329-55836351 ATCTTCATAGGCCAAGAGCCAGG - Intergenic
1138721505 16:59087481-59087503 CTCTTGATCAGGCATGAGCTTGG + Intergenic
1139335704 16:66229604-66229626 CTCTTTATGGGTCATGGGCCAGG - Intergenic
1139383682 16:66550153-66550175 CTCTTTAAGGGCCAGGCGCCGGG - Exonic
1141616926 16:85214995-85215017 CTCTAGCTGGGCCTTGCGCCTGG - Intergenic
1147121270 17:38336542-38336564 TTCTGGATGTGACATGAGCCAGG - Intronic
1151556492 17:74849478-74849500 CTCAGGATGGGCCATGGCCCAGG - Intronic
1153655467 18:7278213-7278235 CTCTTGACAGGACATAAGCCTGG - Intergenic
1157684814 18:49633574-49633596 CTATTGATAGGCCATCAGACTGG + Intergenic
1157688027 18:49658675-49658697 CTCATGAAAGGCCATAAGCCAGG - Intergenic
1161198452 19:3000600-3000622 CTCTGGCAGGGCCATGTGCCCGG - Intronic
1161395924 19:4044988-4045010 CTCTGCATGGGCCCAGAGCCGGG - Exonic
1161730616 19:5958564-5958586 CACTTGATGGGACAAGAGCAAGG + Intronic
1163431296 19:17269281-17269303 CTCCTGAGGGGCCATGGCCCTGG - Intronic
1166283753 19:41811087-41811109 CCCTGGATGGGCCCAGAGCCTGG + Intronic
1166410586 19:42553625-42553647 CCCTGGATGGGCCCAGAGCCTGG - Intronic
932081732 2:68721961-68721983 CACTTGCTGGGCCATGGGGCAGG + Intronic
932626214 2:73297904-73297926 CTAATGATGGGCCATGAGCAGGG - Intergenic
935605649 2:104970033-104970055 CTCTGAATGGGCCATGAGACAGG + Intergenic
937245035 2:120486989-120487011 CTCTGCATGGGCCGTGTGCCAGG + Intergenic
947591964 2:231390965-231390987 CTCTTGGTGGGCCTTGAGCCAGG - Intergenic
948231301 2:236351418-236351440 CCCTTCCTGGGCCAGGAGCCAGG + Intronic
948674277 2:239587911-239587933 CTCCTGCTGGGCCGTGAGCCAGG + Intergenic
1171364608 20:24615430-24615452 CTCTTGCTGGGTCAGGAGCTTGG - Intronic
1171771575 20:29326491-29326513 CGCCTGGTGGGCCTTGAGCCTGG - Intergenic
1171904924 20:30892979-30893001 CGCCTGATGGGCCTTGAGCCTGG + Intergenic
1172125637 20:32623713-32623735 CTGTGGAGGGGCCATGACCCCGG + Intergenic
1173289168 20:41699350-41699372 CTCATGAGAGACCATGAGCCAGG + Intergenic
1175874089 20:62221271-62221293 CTCTTGGTGGGTCCTCAGCCTGG - Intergenic
1176150189 20:63586849-63586871 CTCTTGCTGGGCCGTGAGTCTGG + Intergenic
1180025353 21:45158067-45158089 CTCTTCTTGGGCCAGCAGCCTGG + Intronic
1180073222 21:45449126-45449148 CTGGTGAAGGGTCATGAGCCGGG - Intronic
1180338355 22:11599164-11599186 CGCCTGATGTGCCTTGAGCCTGG + Intergenic
1181505929 22:23357147-23357169 GTCTTCATAGGCCAAGAGCCAGG + Intergenic
1181969783 22:26681399-26681421 CTGTTTATAGGCCATGGGCCAGG - Intergenic
1182543318 22:31057399-31057421 CTCTTGCTGGGCAAGGAGCTAGG + Intergenic
1183047596 22:35232538-35232560 CCTGTGATGGGCCATGAGCCAGG - Intergenic
1183782217 22:40006287-40006309 CTCTTGATGGACCAGGACTCAGG + Intronic
1183834383 22:40440250-40440272 CTCTTCATAGCCCATGAGGCAGG + Intronic
1184480872 22:44746120-44746142 CCCTTTATGGGCCAGGATCCTGG - Intronic
949919547 3:8990395-8990417 CTCTGGCTTAGCCATGAGCCTGG + Intronic
949940274 3:9149366-9149388 CTTTTGATGTCCCATGAGGCAGG + Intronic
954143408 3:48621854-48621876 CTCATGAAAGGCCATGGGCCTGG - Exonic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
960181466 3:114585277-114585299 CTCTTGAGGGGACAAGAGCATGG + Intronic
961594623 3:128006676-128006698 CTCCGGATGGGTCCTGAGCCAGG + Intergenic
962510145 3:136090839-136090861 CTCTTGATATGCCATGAACATGG - Intronic
964535175 3:157713567-157713589 CTGTTTATGGGCCATGTGACTGG - Intergenic
965597548 3:170423252-170423274 ATCCGGATGGGCCAGGAGCCCGG + Exonic
966433893 3:179861586-179861608 TTCATGGTGGCCCATGAGCCTGG - Intronic
967702593 3:192610820-192610842 CTCTTGCTGTGCCCTCAGCCTGG + Intronic
969427402 4:7133354-7133376 CTGGTGATCTGCCATGAGCCTGG - Intergenic
970731694 4:19112474-19112496 TTCTTGAAGGGACATGAGTCTGG - Intergenic
974115701 4:57576548-57576570 GACTTGATGGGCCATGCGCTAGG - Intergenic
974179698 4:58367982-58368004 CTGTTAATGGGCCCTGAGTCCGG - Intergenic
978491375 4:109315095-109315117 CTCTTGTAGGGCCATGAGTGAGG - Intergenic
980692138 4:136309256-136309278 CTCTTGCTGGGTCTTGAGCCTGG + Intergenic
982758309 4:159250955-159250977 CTCGTGCTGGCCCATGAGCGTGG - Intronic
983373590 4:166896589-166896611 ATAAAGATGGGCCATGAGCCTGG - Intronic
985986204 5:3518640-3518662 CTCAGCATGGGCCAAGAGCCCGG - Intergenic
986343572 5:6813542-6813564 CTCATGCTTGGCCAGGAGCCAGG - Intergenic
990166126 5:52995246-52995268 GTCTTGAAGGGCCTTGAGCAGGG + Intronic
993847518 5:92962956-92962978 CCCTGGCTGGGCCATGTGCCAGG + Intergenic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
1001028184 5:168241990-168242012 CTCTGGATAGGCCATCATCCTGG + Intronic
1006409843 6:33866667-33866689 CTCATCCAGGGCCATGAGCCAGG - Intergenic
1007472399 6:42099371-42099393 CTGATGATGGGGCATGAGCATGG + Intergenic
1015401625 6:132794575-132794597 TTCTTGATGTGGCTTGAGCCTGG - Intronic
1015834308 6:137403666-137403688 CTCTTGAGTGACCATGAGCAAGG - Intergenic
1016795340 6:148111229-148111251 CTCTTCATGGGTCTTGAGACAGG + Intergenic
1023905278 7:44517332-44517354 CTTGTGATAGGCCATGAACCTGG + Exonic
1032389271 7:131545224-131545246 CTCTTGAGGGGCCACCAGCCTGG + Intronic
1034070373 7:148179188-148179210 CTCCTGATGGGCCTTGAGTCAGG - Intronic
1035225190 7:157428761-157428783 CTCTTGATGAGACATGAACCAGG - Intergenic
1036454469 8:8894570-8894592 CTCTGGATGTGTCAAGAGCCTGG + Intergenic
1036794063 8:11742844-11742866 CTCTGGATGGGACATGGGCCTGG + Intronic
1045511644 8:102816271-102816293 CCCTGGCTGGGCCAGGAGCCTGG + Intergenic
1047122481 8:121921383-121921405 CGTTTGTTGGGCCATGAACCTGG - Intergenic
1049344895 8:142133584-142133606 CTCGGGAAGGGCCTTGAGCCGGG + Intergenic
1049479603 8:142815579-142815601 CTCTTAAAGGGGCATGAGCCGGG + Intergenic
1052856246 9:33408335-33408357 CTCTAGCTGGGCTAGGAGCCAGG - Intergenic
1057803051 9:98201599-98201621 CCCCAGATGGGCCATCAGCCTGG + Exonic
1059026406 9:110637539-110637561 CCCTAGATGGGCAATGAGCATGG + Intergenic
1060373696 9:123099204-123099226 CTCTTGCTGGCTCATGAGTCTGG + Intronic
1060419016 9:123454293-123454315 GTCTTGATGTGTCAGGAGCCAGG - Intronic
1061445578 9:130635484-130635506 CCCTAGAAGGGCCATGAACCTGG - Intronic
1061882121 9:133573786-133573808 CTCCTGATGGGGCAGGGGCCTGG - Intronic
1062015762 9:134290539-134290561 ATCCTGATGGCCCAAGAGCCGGG + Intergenic
1062554407 9:137107459-137107481 CTCCTGATGGACCCTGACCCAGG - Intronic
1062586387 9:137251754-137251776 CTGTTGTTGGGCCCGGAGCCGGG + Exonic
1190148428 X:47920051-47920073 CTTTTGATAGGCCATTAGCATGG + Exonic
1190291620 X:48996849-48996871 CTCTTCATCTGACATGAGCCTGG - Intronic
1192082729 X:68063910-68063932 GTCTTGGTGGGCCCAGAGCCTGG + Exonic
1195211400 X:102654587-102654609 CTCTTGATTGGCCATGTGCATGG - Exonic
1196832719 X:119788759-119788781 GTCCTGATGGGCCTTGAGACAGG - Intronic
1197429384 X:126342101-126342123 CTCTTTCTGAGCCATGAGCTGGG - Intergenic