ID: 1129204710

View in Genome Browser
Species Human (GRCh38)
Location 15:74030055-74030077
Sequence CAGGAGCCAGCACTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 440}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129204694_1129204710 21 Left 1129204694 15:74030011-74030033 CCCATGAGAAGGACCCACCGCGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 440
1129204701_1129204710 7 Left 1129204701 15:74030025-74030047 CCACCGCGGGGTTCTGGTACCTG 0: 1
1: 0
2: 0
3: 8
4: 56
Right 1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 440
1129204703_1129204710 4 Left 1129204703 15:74030028-74030050 CCGCGGGGTTCTGGTACCTGGCA 0: 1
1: 0
2: 1
3: 2
4: 105
Right 1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 440
1129204696_1129204710 20 Left 1129204696 15:74030012-74030034 CCATGAGAAGGACCCACCGCGGG 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 440
1129204700_1129204710 8 Left 1129204700 15:74030024-74030046 CCCACCGCGGGGTTCTGGTACCT 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG 0: 1
1: 0
2: 4
3: 50
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129204710 Original CRISPR CAGGAGCCAGCACTGTGCTG GGG Intronic
900159242 1:1215729-1215751 CAGTTGCCAGCAATATGCTGGGG - Intergenic
900552454 1:3263624-3263646 CAGGAGCCAGCAGAGAGCTGTGG - Intronic
900690343 1:3977032-3977054 CAGGAGCCATCACGCGGCTGCGG + Intergenic
900714769 1:4137231-4137253 CTGGAGCATGCACTGTGCAGTGG + Intergenic
901450973 1:9336955-9336977 CAGGCCCCAGCACTGTGAAGCGG - Intronic
901789460 1:11646767-11646789 CCGGAGCCTGCACTGGGCTATGG - Intergenic
902195047 1:14792065-14792087 CAGCAGGCAGCCCTGTGCTTGGG - Intronic
902373289 1:16018264-16018286 CAGGATCCAGCCCTGTGCAGTGG - Exonic
902636187 1:17736468-17736490 CAGCAGGCAGCAGGGTGCTGGGG - Intergenic
902839503 1:19066163-19066185 CAGGACTCAGCACAGTCCTGTGG + Intergenic
903172463 1:21562777-21562799 CAGGAGCCAGCAAGGGGTTGGGG - Intronic
903755410 1:25657219-25657241 CAGGACCCAGAACTGTGCCCTGG - Intronic
904330246 1:29753967-29753989 CAGGAGCAAGCCCGGGGCTGTGG + Intergenic
904336860 1:29803515-29803537 GAGGAGCCAGGACAGAGCTGTGG - Intergenic
904471876 1:30741176-30741198 CAGGAGCCAGCACCCTGAGGGGG - Intronic
904750710 1:32740330-32740352 CAGGAACCAGCCCTGTACTCTGG - Intergenic
905091765 1:35435951-35435973 CAGGACCCAGAACACTGCTGAGG - Intronic
905368657 1:37470731-37470753 GATGAGCCGGCAGTGTGCTGTGG - Intergenic
905910153 1:41647956-41647978 CAGTAGCAAGGACTGGGCTGGGG - Intronic
906035864 1:42750120-42750142 CAGCATCCAGCACAGAGCTGAGG + Intronic
906087991 1:43152377-43152399 CAGGAGCCAGCCCTGGGAAGAGG - Intronic
906191514 1:43902250-43902272 CAGGAGGCAGCTCTGTGTTCTGG + Intronic
906780695 1:48570441-48570463 CAGGAGGAAGAACAGTGCTGTGG + Intronic
907597755 1:55735350-55735372 CCAGAGCCTTCACTGTGCTGAGG + Intergenic
910430291 1:87153286-87153308 CAGGAGTCTGCAGTCTGCTGGGG + Intronic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
912394307 1:109328912-109328934 CAGGAGCCAGCCTGGTGCAGGGG - Intronic
912545516 1:110448378-110448400 GAGGAGGCAGCACTTTGCTGGGG - Intergenic
913333148 1:117683851-117683873 CATGTGCCAGCACTGTGCTGTGG - Intergenic
913366789 1:118047965-118047987 CAGGAACCAGCCCAGTGCTCAGG - Intronic
913556522 1:119972669-119972691 GAGAAGCAAGCACTGTGCTTGGG + Intronic
914943140 1:152040190-152040212 CTGGAGCCAGCAAGGAGCTGAGG + Intronic
915715542 1:157941282-157941304 CAGGACCCAGCACAGTGAGGTGG + Intergenic
917784579 1:178440076-178440098 CAGGCACCTGCAATGTGCTGGGG - Intronic
918384506 1:183992062-183992084 CAGGAGTGAGCACTTAGCTGAGG - Intronic
919904304 1:202067512-202067534 CAGGAGGCAGGACTGGGCTGAGG - Intergenic
920372794 1:205490122-205490144 CGGGGCCCAGCAGTGTGCTGTGG - Intergenic
922035340 1:221842170-221842192 ATGGTGCCAGCACTGTGCTCTGG - Intergenic
922966413 1:229694595-229694617 CAGGAGGCAGGGCTCTGCTGGGG - Intergenic
922979705 1:229815202-229815224 GAGGAACCAGCCCTGTTCTGAGG - Intergenic
923149007 1:231217524-231217546 GAGGAGCCACCACTTTCCTGGGG + Intronic
923323591 1:232860404-232860426 CAGCAGCCACCTCTATGCTGTGG - Intergenic
923519496 1:234724984-234725006 CAGGAGCCAGTACGTGGCTGTGG + Intergenic
923634043 1:235677052-235677074 CACCAGCCAGCCCTGTGCTTTGG + Intronic
1063227937 10:4033825-4033847 CAGGAGGCAGATGTGTGCTGAGG + Intergenic
1064103439 10:12482183-12482205 CAGGAGCCAGCACTATGCTACGG - Intronic
1065278755 10:24113628-24113650 CAGGAGCCAGCTCTGCTCAGTGG - Intronic
1065307792 10:24384932-24384954 GAGGGGCCAGCACTGGGGTGAGG - Intronic
1067168126 10:43881743-43881765 CTGGGGCCAGCACTGCCCTGTGG - Intergenic
1067849368 10:49745067-49745089 TAGGAGGCAGCCCTGAGCTGGGG - Intronic
1069003079 10:63287317-63287339 TAGGAGACAACACTGTTCTGTGG + Intronic
1069786452 10:70991144-70991166 CAGGAGCTCCCACTTTGCTGTGG - Intergenic
1070772525 10:79090655-79090677 CAAGAGCCAGCAGTGTGCAGCGG + Intronic
1070883084 10:79866228-79866250 CAGGAACCAGCAATCTTCTGAGG - Intergenic
1071649652 10:87382543-87382565 CAGGAACCAGCAATCTTCTGAGG - Intergenic
1072036359 10:91566399-91566421 CAGGGCCCAGCTCTATGCTGTGG - Intergenic
1072319120 10:94231924-94231946 CATGAGCCAGTACTGGTCTGCGG + Intronic
1072785463 10:98276841-98276863 CAGGCTCCAGGACAGTGCTGGGG + Intergenic
1073110687 10:101061538-101061560 CGGGAACCAGCCCTGGGCTGCGG + Intergenic
1073761523 10:106633835-106633857 CAAGACCCAGCACTGTTTTGAGG + Intronic
1075067829 10:119301538-119301560 CTAGAGCCACCTCTGTGCTGTGG - Intronic
1075118160 10:119644493-119644515 CAGGAAGCAGGACTGTGCAGAGG + Intergenic
1075239530 10:120765369-120765391 CACCAGCCAGTACAGTGCTGGGG - Intergenic
1075441237 10:122480658-122480680 TGGGAGCCAGCCCTGTGCTCTGG + Intronic
1076522702 10:131090917-131090939 CAGGAGGCAGCACTGTGGGCAGG + Intergenic
1076522715 10:131090965-131090987 CAGGAGGCAGCACTGTGGGCAGG + Intergenic
1076671648 10:132124148-132124170 CATGACCCAGCACTGGGGTGGGG + Intronic
1076755863 10:132571316-132571338 CAGGTCCCAGCAGTGTGATGAGG - Intronic
1076797174 10:132803999-132804021 CAGGGCCCAGCCCTGTGCTTGGG + Intergenic
1076845557 10:133067922-133067944 CTGTGGCCAGCACAGTGCTGGGG - Intergenic
1077485276 11:2835672-2835694 CAGGAGCCTGCAGCATGCTGGGG + Intronic
1077663340 11:4088292-4088314 CAGAGGCCAGGACTGGGCTGTGG - Intronic
1078245328 11:9569345-9569367 CAGCAACCAGCACTGTGCCTTGG - Intergenic
1079335140 11:19564483-19564505 CGGCAGCCAGCACTCTGCCGAGG - Intronic
1080276993 11:30513921-30513943 CAGGAGACAGCACTGTAGTGAGG - Intronic
1081835531 11:46150250-46150272 AAGCTGCCATCACTGTGCTGCGG - Intergenic
1081971852 11:47204837-47204859 CAGGAGCCAACACAGGGCAGTGG - Intergenic
1082955354 11:58864216-58864238 CAGGGGCCAGCCTTGTTCTGGGG + Intronic
1083289621 11:61682554-61682576 CAGGAGGAAGCACTTTGCTTGGG + Intronic
1083594864 11:63914387-63914409 CAGGAGCAAGCACTGGGCATGGG - Intronic
1083647275 11:64179520-64179542 CTGGAGCCCGCACTATGTTGCGG + Intergenic
1083741330 11:64713027-64713049 CGGGGGCCAGCACGGTGCAGAGG + Exonic
1084323387 11:68385772-68385794 CAGGCCCCAGCACCGTGCCGGGG - Intronic
1084891103 11:72237555-72237577 CACCAGCCAGCACTTTCCTGGGG + Exonic
1085283317 11:75344759-75344781 CAGGAGCCCCCAGTGTGATGGGG + Intronic
1085327596 11:75618937-75618959 CAGGAGTCAGAGCTGTGGTGGGG - Intronic
1085499997 11:77011463-77011485 CAGAAGCCTTCACTGTGTTGAGG + Intronic
1087142924 11:94783605-94783627 CAGGATCTAGAACTGTGCTTGGG - Intronic
1087557027 11:99733940-99733962 CAGGTGCCAGAGCTCTGCTGGGG - Intronic
1090062658 11:123477332-123477354 AAGTACCCAGCACTGTGCTAGGG - Intergenic
1091187074 11:133656572-133656594 CAGGAGCCAGCACAGTCCTTGGG + Intergenic
1091445556 12:542650-542672 CAGGAGCCAGCACTCTGAGTGGG - Intronic
1091786252 12:3244903-3244925 CAGCATCCAGTATTGTGCTGTGG + Intronic
1091882324 12:3989991-3990013 CAGAATCCAGCTCTGGGCTGAGG - Intergenic
1092147818 12:6226923-6226945 CAGAAGGGAGCCCTGTGCTGGGG + Intronic
1092793328 12:12088002-12088024 CAGGAGCAAGAACTGTGGTGGGG - Intronic
1092915951 12:13189185-13189207 AATCAGCCAGCACTGGGCTGAGG + Intergenic
1093679288 12:21982155-21982177 CAGGACCCAACACATTGCTGTGG + Intergenic
1094126895 12:27032869-27032891 CCTGAGCCAGCACTGGACTGTGG + Intronic
1094667246 12:32533015-32533037 CAGGAGCCAATACAGTGCTGAGG - Intronic
1096178991 12:49540313-49540335 CAGGAGCCAGGAATGTATTGGGG - Intronic
1096736202 12:53657065-53657087 TAGGAGGCAGCACAGTGCAGTGG + Intronic
1097314504 12:58157551-58157573 CAGGCCCCAGCACTGGGATGGGG - Intergenic
1100697993 12:97116625-97116647 CAGAAGACAGCTCTGGGCTGAGG - Intergenic
1101751066 12:107582759-107582781 CAGGAGGCAGCACAGTCCGGTGG - Intronic
1101853294 12:108421685-108421707 CAGGAGCCACGACGGTGCTTTGG + Intergenic
1103903527 12:124315697-124315719 CAGAAGCCAGCACTGTGGCAGGG + Exonic
1104035703 12:125095820-125095842 GTGGAGCCAGCACAGTGGTGAGG + Intronic
1104144336 12:126018369-126018391 CAGGACCCAGCATAGAGCTGGGG - Intergenic
1104159686 12:126166186-126166208 CAGGAACCAACAGTGAGCTGTGG - Intergenic
1105971110 13:25429870-25429892 CAGGAGTCAGCAGGGTGCAGTGG + Intronic
1106004208 13:25753336-25753358 CATGAGTCAGCACTGAGCTGGGG - Intronic
1106313189 13:28571663-28571685 AAGGAGCTAGCACTCTACTGGGG - Intergenic
1106599432 13:31175130-31175152 TGGCACCCAGCACTGTGCTGAGG - Intergenic
1107574048 13:41697761-41697783 CAGGAGCCAATACTGGTCTGCGG + Intronic
1107735883 13:43398167-43398189 TATGCTCCAGCACTGTGCTGTGG - Intronic
1108945653 13:56019684-56019706 CTGGGGCCAGCCCAGTGCTGGGG + Intergenic
1110979322 13:81875329-81875351 CAGGAGCCAGAATTCTGCTAGGG + Intergenic
1112423496 13:99275295-99275317 CAGGAGGCAGCTCCGTGGTGAGG - Intronic
1112432555 13:99363568-99363590 CAGGTGGAAGCCCTGTGCTGAGG - Intronic
1113202560 13:107883260-107883282 ACGAAGCCAGCACAGTGCTGAGG - Intergenic
1113555476 13:111230529-111230551 CAGGAGCCTGGACAGTGGTGGGG + Intronic
1113617145 13:111688937-111688959 CAAGATCCAGCACTGTACGGAGG - Intergenic
1113622675 13:111774208-111774230 CAAGATCCAGCACTGTACGGAGG - Intergenic
1113923268 13:113926449-113926471 CAGGGGCCACCACTGGGATGAGG + Intergenic
1113923959 13:113930080-113930102 CGGCAGCCAGCACTGGGCTGTGG + Intergenic
1114051327 14:18921321-18921343 CAGGAACCAGCACTTGGGTGGGG + Intergenic
1114111235 14:19480604-19480626 CAGGAACCAGCACTTGGGTGGGG - Intergenic
1116888937 14:50248954-50248976 CAGCAGCCAGCCATGTGGTGTGG + Intronic
1118110359 14:62711628-62711650 CAGGAGCCAGCAATGCACAGCGG + Intronic
1118276785 14:64392632-64392654 GAGGAGGCAGCACCGTGCTTAGG - Intronic
1118444285 14:65837610-65837632 GAGAAGCCAGCACTATGCTGGGG + Intergenic
1118628046 14:67676377-67676399 CAAGTCCCAGCATTGTGCTGTGG - Intronic
1121121504 14:91378572-91378594 CAGGAGGTGGCAGTGTGCTGGGG - Intronic
1121314100 14:92950950-92950972 GAGGAGCCAGCAGTGTGCTGAGG - Intronic
1121578634 14:95009630-95009652 CAGGGGCCAGCAGTTTGCAGAGG + Intergenic
1121811539 14:96895556-96895578 GAGGAGTCACCACTCTGCTGTGG + Intronic
1122088191 14:99321182-99321204 CAGGAGCCAGCCGTGTGCCCAGG - Intergenic
1122592543 14:102865215-102865237 CAGGAGCCAGTTCAGTCCTGTGG + Intronic
1122722503 14:103730205-103730227 CAGGAGGCCACACTGAGCTGGGG - Intronic
1122830423 14:104393085-104393107 CTGGGGCCAGCACTGTGTGGGGG + Intergenic
1122879141 14:104682221-104682243 CAGGAGGCAGCAGTGTGGGGAGG + Intergenic
1124009815 15:25829691-25829713 CAGGAGCCAGGAGAGAGCTGGGG + Intronic
1124154940 15:27217575-27217597 CAGGATCCTGCTCCGTGCTGTGG + Intronic
1124410162 15:29430280-29430302 GAGGGGCCAGGGCTGTGCTGTGG - Intronic
1124800857 15:32831519-32831541 CAGGAGCCAGGGCTTTGCAGAGG + Intronic
1124819589 15:33031307-33031329 GAGGAGCCAGCACTGTGGAGAGG + Intronic
1124871928 15:33552232-33552254 CATGGGTCAGCACTGTGCTGTGG + Intronic
1125363523 15:38889385-38889407 CAGAAGAGAGCATTGTGCTGGGG + Intergenic
1125746984 15:42003971-42003993 CTGGAGACATGACTGTGCTGAGG - Intronic
1125957303 15:43799355-43799377 CAGGAGGCAGCAGATTGCTGAGG + Exonic
1126798882 15:52282518-52282540 CAGGAGCCAGGTCTGTGCCACGG - Intronic
1126911079 15:53417753-53417775 CAGTACCTAGCACTGTGCTTGGG - Intergenic
1126977939 15:54206922-54206944 CAAAAGAAAGCACTGTGCTGAGG + Intronic
1127286698 15:57539351-57539373 CAGGATCCAGCCCTGTCTTGGGG - Intronic
1127654913 15:61046694-61046716 CAGGATCCAGGACTGAACTGAGG + Intronic
1127848691 15:62894476-62894498 CAGAAGCCAGCCATGTGATGGGG - Intergenic
1128086186 15:64888370-64888392 CAGGAGGAAGCCCTGTGGTGGGG - Intronic
1128237968 15:66080367-66080389 CAGGAGCCAGGTGTGTGCTGCGG - Intronic
1128303293 15:66580899-66580921 CAGAAGCCAGGACTGTCCTGTGG + Intergenic
1128805332 15:70526624-70526646 CAGGAGCCACGTCTTTGCTGGGG + Intergenic
1128914469 15:71547154-71547176 CAGGAGCCAGCTGGGAGCTGGGG - Intronic
1129123095 15:73414999-73415021 CAGGAGCCTCCACTGTGATGAGG - Intergenic
1129204710 15:74030055-74030077 CAGGAGCCAGCACTGTGCTGGGG + Intronic
1130257687 15:82333386-82333408 CAGCAGCCAGCCCTGTGCCAGGG - Intergenic
1130597251 15:85256577-85256599 CAGCAGCCAGCCCTGTGCCAGGG + Intergenic
1130649301 15:85752916-85752938 CAGAAGCCAGCACAGAGCTTGGG - Intergenic
1131075390 15:89492243-89492265 CAGGAGCTAGAACGGGGCTGGGG - Intronic
1131252735 15:90840960-90840982 AGGGAGCCAGCACTGGGCAGGGG - Intergenic
1131440143 15:92453788-92453810 TAGGCTCCAGCCCTGTGCTGGGG + Intronic
1132473392 16:119566-119588 CTGGAGCCGGCACTGCCCTGCGG + Intronic
1132507426 16:318481-318503 CAGGAGCCATCTGAGTGCTGAGG - Intronic
1133898477 16:9951126-9951148 ATGGAGGAAGCACTGTGCTGGGG - Intronic
1134241387 16:12509449-12509471 CAGAAGCCAAGACTGAGCTGTGG - Intronic
1135045482 16:19151529-19151551 TATGAGCCAGCACTGCCCTGGGG - Intronic
1135137899 16:19898320-19898342 GAGGAGGCAGCACTGGGCAGAGG + Intergenic
1135226941 16:20668986-20669008 CAGGAGACAGAACTCTGCAGTGG + Intronic
1135354187 16:21755969-21755991 CAGGAGCCTGAACTGTGTTCTGG + Intronic
1135452677 16:22572110-22572132 CAGGAGCCTGAACTGTGTTCTGG + Intergenic
1135732064 16:24903092-24903114 CAGGAGCCACTGCTGGGCTGGGG - Intronic
1136527238 16:30839597-30839619 AAGGAGGCAGCCATGTGCTGAGG + Intronic
1138336843 16:56260152-56260174 CAGGTGCAGGCACTGTGCTAAGG - Intronic
1139254772 16:65530399-65530421 CAGAAGCCAGCAGAGAGCTGTGG - Intergenic
1139478189 16:67213639-67213661 CAGGAGCCAGCCCTGGACTTGGG - Intronic
1140964954 16:79956892-79956914 CAGGAACAAGCCCTTTGCTGGGG - Intergenic
1141444259 16:84047892-84047914 CAGCAGCCAACACAGGGCTGGGG + Intergenic
1141805731 16:86340326-86340348 CATGAGCCAGGGCAGTGCTGGGG - Intergenic
1142199399 16:88753951-88753973 CAGGAGCCTGCCCTGCCCTGTGG + Intronic
1142263008 16:89051276-89051298 CAGGAGCCCGGGCTGGGCTGAGG - Intergenic
1142400029 16:89853782-89853804 AAGGTGCCAACACTGTGGTGAGG - Intronic
1142752326 17:1996410-1996432 CAGCAGCCAGCCCTCTGCAGGGG - Intronic
1142864028 17:2779626-2779648 CAGAGGCCAGCACTGGGCAGAGG + Intronic
1143161258 17:4872955-4872977 GAGGAGACAGGGCTGTGCTGAGG - Intronic
1143393608 17:6575275-6575297 CAGGTGGCAGGAATGTGCTGTGG + Intergenic
1144754217 17:17669632-17669654 CAGGAGCCAGCTCTGCTCTGAGG - Intergenic
1145124235 17:20286957-20286979 CAGGAGCCAGGACTTTCTTGGGG - Intronic
1145242352 17:21247428-21247450 CACGAGCCTGCCCTGTGCTGGGG - Intronic
1146252341 17:31359179-31359201 CAGGAGGCAGCATGGTGTTGGGG + Intronic
1146901604 17:36592540-36592562 CAGGAGCCAGGACTGAGGTTGGG + Intronic
1146929794 17:36768902-36768924 CTGGAGGCAGCAATGTGCAGAGG + Intergenic
1147325218 17:39666747-39666769 CAGAAGCCAGGACTGGGCAGCGG - Intergenic
1147925110 17:43941233-43941255 CAGGGGCAAGCACTGTGCCCAGG + Intronic
1148053287 17:44779647-44779669 CAGGGCCCAGCACTGAGCTCCGG + Intronic
1148591022 17:48816936-48816958 CTGGAGCCAGCACCGGGCTTTGG + Intronic
1148798386 17:50208447-50208469 CTGGGGCCAGCCGTGTGCTGGGG + Intergenic
1149990974 17:61383402-61383424 GAGGAGACAGCACTGTGCCCAGG - Intronic
1151333177 17:73423315-73423337 TAGGAGTCAGCCCTGGGCTGGGG - Intronic
1151810879 17:76440948-76440970 CAGCACCCAGCACAGTGCAGGGG + Intronic
1152141958 17:78541706-78541728 GAGGAGGCAGGACTGGGCTGAGG - Intronic
1152420186 17:80188559-80188581 CAGGAGGCCGCTCTCTGCTGCGG - Intronic
1152528554 17:80903419-80903441 CAGGGGCCGCCACTGTTCTGTGG - Intronic
1152756258 17:82088325-82088347 CAGACGCCCGCTCTGTGCTGAGG - Intronic
1153444329 18:5154985-5155007 CAGAAACCAGCCCTGTGGTGTGG - Intronic
1155424645 18:25694328-25694350 TAGGAGCCAGCACAGTGTAGTGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156694939 18:39754484-39754506 AAGGACACAGAACTGTGCTGAGG + Intergenic
1157539428 18:48489220-48489242 CAGGAGCCAGCTCTCTGCTTGGG - Intergenic
1157692955 18:49698684-49698706 CAGGTGCCAGAACCCTGCTGGGG + Intergenic
1157716975 18:49894526-49894548 CATGATGCAGCACTGTGCTTTGG - Intronic
1158276005 18:55768263-55768285 CAGGAGCCTCCACTGGGCTTTGG + Intergenic
1159505322 18:69328261-69328283 CAGGCGCCAGCAAAGTGATGTGG - Intergenic
1159798569 18:72869524-72869546 GAGGAACCAGCACTTTGGTGTGG - Intergenic
1160086025 18:75778265-75778287 CCGGAGCCCTCCCTGTGCTGGGG + Intergenic
1160239665 18:77113973-77113995 CAGGAGCCAGCCCTGGGCTAGGG + Intronic
1160478781 18:79219070-79219092 CAGTAGTCAACAGTGTGCTGGGG + Intronic
1160855577 19:1215681-1215703 CAAGAGGCAGCCCTGAGCTGGGG + Intronic
1161280137 19:3441560-3441582 CAGGGGCCAGGCCTGTTCTGAGG - Intronic
1161326804 19:3668037-3668059 CAGGAGCCAGGGCAGGGCTGGGG - Intronic
1161649981 19:5478329-5478351 CAGCAGCCAGCGCGCTGCTGGGG - Intergenic
1161706856 19:5826264-5826286 GAGTGGCCAGGACTGTGCTGGGG - Intronic
1162126506 19:8502363-8502385 CAGGAGCCCGCGCTGTCCTGGGG + Intronic
1163638755 19:18450105-18450127 CAGGAGCCAGGGCCATGCTGAGG - Intronic
1165230860 19:34385791-34385813 CAGGAGCCAGCATTGAGCACAGG + Intronic
1165434813 19:35789994-35790016 TAGGAGCCAGGACGGGGCTGTGG - Intergenic
1166612672 19:44212891-44212913 CAGGTGCCACCACTGTTCTAAGG - Intronic
1168325177 19:55535193-55535215 CTGAGGCCAGCCCTGTGCTGGGG - Intronic
925476595 2:4223673-4223695 TAGGAGCCAGCAATGGCCTGTGG - Intergenic
925716902 2:6792299-6792321 CAGGAGCCAGGGCAGTGGTGTGG + Intergenic
925853849 2:8110407-8110429 CAGGAGGCAGTAGTGTGGTGTGG - Intergenic
925906227 2:8541020-8541042 CAGAAGCCAGCCCAGGGCTGTGG + Intergenic
926209982 2:10862524-10862546 CAGGAGCCCACACTGTGCCATGG + Intergenic
926461458 2:13135047-13135069 CAGGAGCCAGCACCCTTCTTAGG + Intergenic
927022501 2:19031704-19031726 CAGAAGCCATCACAGAGCTGTGG - Intergenic
927204014 2:20595602-20595624 CTGCAGCCTGCTCTGTGCTGCGG + Intronic
927383576 2:22506845-22506867 AAGGAGCCAGTACTGTGTTCTGG - Intergenic
928053642 2:28028170-28028192 CAACAGCCAGCACTGAACTGAGG - Intronic
931652725 2:64483060-64483082 CAGGAGGCAGCACGCTGCTGTGG + Intergenic
932188549 2:69719333-69719355 CAGGAGGCTGCAATGTGCTATGG - Intronic
932196151 2:69785815-69785837 CAGGATCGAGCACTGTCCAGAGG - Intronic
933474068 2:82766456-82766478 CAGAAGCCAACACAGTGCTGGGG - Intergenic
935174938 2:100641481-100641503 CAGGAGCAGGCACTGGGCTGGGG + Intergenic
935568822 2:104637441-104637463 CTGCAGCCAGGACTGTGGTGTGG - Intergenic
935888366 2:107648867-107648889 CATGAGCCAGCAAAGTGATGTGG - Intergenic
936636549 2:114265360-114265382 CAAGAGCCATCACTGTGCTCAGG - Intergenic
937017377 2:118618535-118618557 CAAGAGCCAGGGCTGTGCTGGGG - Intergenic
937298172 2:120822283-120822305 CTGGACCCAGCAGTGTGCTATGG + Intronic
937336549 2:121065834-121065856 CGGGAGCCAGGCCTGTGCAGTGG - Intergenic
937986714 2:127641322-127641344 CAGGTGCCAGCCTGGTGCTGCGG + Intronic
938271887 2:129979828-129979850 CAGGAGCCAGGGGTGTGCTTTGG - Exonic
938278243 2:130047129-130047151 CAGGTGCCAGCCATGAGCTGCGG + Intergenic
938329215 2:130437934-130437956 CAGGTGCCAGCCATGAGCTGCGG + Intergenic
938360731 2:130683559-130683581 CAGGTGCCAGCCATGAGCTGCGG - Intergenic
938437134 2:131290257-131290279 CAGGTGCCAGCCATGAGCTGCGG - Intronic
938444114 2:131363972-131363994 CAGGAGCCAGGGGTGTGCTTTGG + Intergenic
938900648 2:135796365-135796387 CAGAAGCCAGCAATGGCCTGTGG + Intronic
938978240 2:136500264-136500286 CTGGAGCCAGCCTTGTGGTGTGG + Intergenic
940800071 2:158123463-158123485 CAGCAGCCAGCACTGTGCCCAGG - Intronic
941452308 2:165674205-165674227 GAGGAGTCAGGACTTTGCTGAGG + Intronic
942068370 2:172293206-172293228 CAAGAGCCAGCACTGCAGTGTGG - Intergenic
942792135 2:179772819-179772841 CAGTGGGCAGCACTGTGCTTTGG + Intronic
944539377 2:200741593-200741615 CTGGAGCCAGGGCTGTGCTCTGG - Intergenic
944766537 2:202870960-202870982 CAGGAGCCATATCTGTGCCGTGG + Intronic
945391813 2:209273935-209273957 TATGAGGCAGCACTGTCCTGTGG + Intergenic
946394786 2:219437792-219437814 CAGGAGCTATCACTGGGCAGGGG - Intronic
946433014 2:219635563-219635585 CAGGAGTCAGGACGGGGCTGGGG - Intronic
947655226 2:231821065-231821087 GAGGAGCCAGGACACTGCTGAGG - Intergenic
948068389 2:235099952-235099974 AAAGAACTAGCACTGTGCTGGGG + Intergenic
948542372 2:238699719-238699741 CAGGAGCCTGGCCTCTGCTGGGG + Intergenic
948570195 2:238912987-238913009 CAGGAGCCAGCACAGGGAAGTGG - Intergenic
1170547715 20:17449269-17449291 CAAGAGCCAGCACTGTGGGTGGG - Intronic
1171017238 20:21553094-21553116 GAGGTGCCAGCATTATGCTGGGG + Intergenic
1171087459 20:22250802-22250824 GAGGGTCCAGAACTGTGCTGAGG + Intergenic
1172771877 20:37386772-37386794 CAGGACCCAGTGCTGTGATGGGG + Intronic
1172887151 20:38239092-38239114 CTGGAGCCAGCTCTGTGGGGCGG + Intronic
1172894745 20:38292567-38292589 CAGAATCCAGTAATGTGCTGGGG + Intronic
1173016385 20:39229677-39229699 CAGCAGCCATCTCTGTGCAGTGG + Intergenic
1174295104 20:49540159-49540181 CAGGAGGGAGCCCGGTGCTGGGG + Intronic
1175470093 20:59221465-59221487 CAGCAGCCAGCAGTGGGGTGAGG - Intronic
1175550502 20:59814252-59814274 CAGGAGCCAGCACCATCCTGGGG + Intronic
1175619727 20:60433313-60433335 CCTGGGCCAGCACAGTGCTGAGG - Intergenic
1175713783 20:61242019-61242041 CAGGGGACAGCACAGTGATGAGG + Intergenic
1176019056 20:62953329-62953351 CACGTGCCAGCTGTGTGCTGAGG + Intronic
1176024716 20:62979933-62979955 AAGGAGCCTGAGCTGTGCTGAGG - Intergenic
1176091780 20:63321490-63321512 TGGGATCCAGAACTGTGCTGTGG + Intronic
1176679212 21:9810230-9810252 CAGGATACAGCACTGTGCCACGG + Intergenic
1178923541 21:36756525-36756547 GATGAGCCAGCACTGACCTGTGG + Exonic
1179145670 21:38765445-38765467 CTTGAGCCAGCACTGTGCCAAGG + Intergenic
1179174684 21:38999893-38999915 CAGTCTCCACCACTGTGCTGAGG + Intergenic
1179455943 21:41500065-41500087 CAGCAGGCAGCACTGGGCAGCGG + Intronic
1179969633 21:44827536-44827558 GAGGAGCCACCACTGTGGCGGGG + Intergenic
1180003150 21:45004198-45004220 GAGGGGCCACCTCTGTGCTGGGG - Intergenic
1180211122 21:46295915-46295937 TCTGGGCCAGCACTGTGCTGGGG - Intronic
1180469800 22:15643696-15643718 CAGGAACCAGCACTTGGGTGGGG + Intergenic
1180613924 22:17115350-17115372 CAGGAGCAATCACAGGGCTGTGG - Exonic
1180855093 22:19040607-19040629 CAGGAGGCAGCTCTGTGAGGTGG - Intronic
1180975466 22:19845554-19845576 CAGGCCCCAGCCCTGTGCTGGGG + Intronic
1181002087 22:19992591-19992613 CTGCAGCCAGGACTGGGCTGAGG - Intronic
1181136723 22:20772326-20772348 CAAGTGCCAGGGCTGTGCTGGGG + Intronic
1181694859 22:24587973-24587995 CAGGAGGCAGGACCGTCCTGTGG + Intronic
1182144367 22:27988195-27988217 AAGGAGCCAGCCTTGAGCTGAGG + Intronic
1183047591 22:35232526-35232548 CATGAGCCAGGGATGTGCTGGGG - Intergenic
1183167007 22:36155666-36155688 CAGGAGCCAGCACAGAGCAGAGG + Intronic
1183302447 22:37064979-37065001 CATGTGCCAGCACTATGCTGGGG - Intergenic
1183370574 22:37429462-37429484 GAGTGGCCGGCACTGTGCTGGGG - Intergenic
1183720575 22:39559405-39559427 CAGGATCCAGGGCTGGGCTGGGG + Intergenic
1183811793 22:40263851-40263873 CAGCAGCCAGCACAATGCTGCGG - Intronic
1184693331 22:46127287-46127309 CAGTGGCCAGGGCTGTGCTGGGG - Intergenic
1185086948 22:48746024-48746046 CAGGAGACAGCGATGGGCTGGGG + Intronic
1185320184 22:50197116-50197138 AAGGACACAGCACTGGGCTGGGG + Intronic
949354015 3:3158348-3158370 CACGAACCAGCACTGGTCTGTGG - Intronic
949867896 3:8561807-8561829 CTGCATCCAGCACTGTGCTCAGG - Intronic
951553073 3:23894856-23894878 CATGAGTCAGCTCTGTGATGAGG - Intronic
953796566 3:45990605-45990627 CATGTGCCAGAACTGTGCTAGGG - Intronic
953854879 3:46493666-46493688 CAGGTGCCAGCCCTGGCCTGGGG + Intergenic
954400154 3:50315253-50315275 GGAGAGCCAGCACTGTCCTGTGG - Intergenic
960277106 3:115741437-115741459 AAGGAGCCAGAACTGGGCTGAGG - Intergenic
960968872 3:123124990-123125012 CAGGAGCCAACAGGGTGGTGGGG - Intronic
961059484 3:123816394-123816416 AGGGAACCAGCACTGTGTTGAGG - Intronic
961210486 3:125121291-125121313 CACCATGCAGCACTGTGCTGTGG - Intronic
961243920 3:125435257-125435279 CAGGAACCAGCTCTGGCCTGGGG + Intergenic
961384874 3:126517738-126517760 CAGAGGCCAGCACTGTGGGGAGG + Exonic
961387229 3:126529607-126529629 AAGCACCCGGCACTGTGCTGGGG + Intronic
961912241 3:130330034-130330056 CTGCAGCCAGCATTGTTCTGGGG + Intergenic
962274567 3:134002282-134002304 CAGGAGGCAGGAGGGTGCTGAGG - Intronic
962309390 3:134314485-134314507 CAGGACTCAGCACGCTGCTGTGG + Intergenic
963009382 3:140754986-140755008 AGGGAGCCAGCACTGTGCTGGGG + Intergenic
964139539 3:153381255-153381277 CAGAATCAAGGACTGTGCTGGGG + Intergenic
966015957 3:175137671-175137693 CAGGAGGTAGCACTGAGCTGAGG - Intronic
967205947 3:187121483-187121505 CAGGAGCCAGCAGCGGTCTGAGG + Intronic
968287064 3:197514955-197514977 CAGGGCCCAGCTCTGTCCTGAGG - Intronic
968542241 4:1173408-1173430 CAGGACCCCGCACAGGGCTGGGG + Intronic
968655853 4:1778179-1778201 CAGGAGTCAGCGCTGCCCTGGGG - Intergenic
968703914 4:2069429-2069451 CAGGACCAAGCACAGAGCTGGGG - Intergenic
969691902 4:8708551-8708573 CAGGTGACGGCACTGTCCTGAGG + Intergenic
970604305 4:17665120-17665142 CATGAGCCAGCATTGTTCTCAGG - Intronic
971192077 4:24437388-24437410 CATGAGCCAGCTCAGTGCTGAGG + Intergenic
971312654 4:25538775-25538797 CAGAAGCCAGCAGTGTGCATGGG - Intergenic
971737477 4:30474377-30474399 CTGGACACAGCGCTGTGCTGTGG - Intergenic
978076160 4:104532841-104532863 CAGGAGCCAGCACAGGGCAAAGG + Intergenic
978723662 4:111945207-111945229 CAGCACCCAGGACAGTGCTGTGG + Intergenic
980739585 4:136931917-136931939 CAGGGGCCAAGAGTGTGCTGTGG + Intergenic
981494440 4:145375634-145375656 CAGGAGCCTGCCCTGCCCTGGGG + Intergenic
981614968 4:146637106-146637128 CAGGAGCCGCCAGAGTGCTGGGG - Intergenic
981757985 4:148162121-148162143 CAGAAGCCAGAACTGGGCAGAGG + Intronic
982255093 4:153443865-153443887 CAGGAGCCAGCCCAGCGCAGAGG + Intergenic
984144466 4:176044314-176044336 CAGGTGCCAGCAAAGTGATGTGG + Intergenic
984606172 4:181788284-181788306 AAGTACCTAGCACTGTGCTGGGG + Intergenic
985817170 5:2135617-2135639 CCAGGCCCAGCACTGTGCTGAGG + Intergenic
986006211 5:3671337-3671359 TGTGTGCCAGCACTGTGCTGAGG + Intergenic
986238369 5:5933831-5933853 AAGGAGGCAGCACTGAGCAGGGG - Intergenic
986977677 5:13411607-13411629 CTGGACCCAGCACAGTGCTGTGG - Intergenic
987078942 5:14409153-14409175 TAGGGGCCAGGGCTGTGCTGGGG - Intronic
989082242 5:37635298-37635320 GAGGATCCTGCACTGTGGTGTGG + Intronic
990987556 5:61654989-61655011 CAGGAGCCAGGGCTGTCCGGGGG - Intronic
995935093 5:117501423-117501445 CAGGAGCCAGGGGTGTGGTGGGG - Intergenic
997402783 5:133615357-133615379 GAAGAGCCAGCCCTGTGCTTAGG + Intergenic
997996012 5:138587070-138587092 CAGGAGCCAGCCCTGCGTGGTGG + Intergenic
998069599 5:139186764-139186786 TATGTGCCAGGACTGTGCTGGGG + Intronic
999203487 5:149832735-149832757 CTGCAGGCAGCACTGTGCCGAGG - Exonic
999523292 5:152375149-152375171 AAGGAGCCAGCTCTGTGCAGAGG - Intergenic
1000267536 5:159652090-159652112 CAGAAGCCAGCCCTGTGCTAAGG - Intergenic
1000695520 5:164376238-164376260 CAGGAGCCAGCACTATAGTCTGG - Intergenic
1000699470 5:164430382-164430404 GGGGAGCCAGCAATGTGCAGAGG - Intergenic
1002050247 5:176566538-176566560 CAGGAGCCCGGACGGAGCTGTGG + Intronic
1002092588 5:176813802-176813824 CAGGAGCCTGCCCTGAGCTTGGG + Intronic
1002182569 5:177438563-177438585 CAGGGGCCAGCCCTGTGAGGTGG + Intronic
1002194396 5:177494476-177494498 CAGGAGCCAGCCCTGTGGGCAGG - Intronic
1002437687 5:179242020-179242042 CTGGACCAATCACTGTGCTGAGG - Intronic
1003159777 6:3625022-3625044 CAGGAGCCATAACTGAGTTGAGG + Intergenic
1003260634 6:4512412-4512434 CAGGAGCCAGGAGACTGCTGAGG + Intergenic
1003466469 6:6384469-6384491 CAGGAACCAGCTCTGAGCTTGGG + Intergenic
1003668149 6:8130721-8130743 CGGCACCCAGCACAGTGCTGAGG + Intergenic
1003725688 6:8760374-8760396 CAGGACACAGGACTGGGCTGTGG + Intergenic
1004370634 6:15049300-15049322 CTGAAGCCTGCACTGTGATGAGG + Intergenic
1004409138 6:15364187-15364209 CAGGACCCAGGACACTGCTGGGG - Intronic
1004480011 6:16009960-16009982 CAGGAAGAAGCAATGTGCTGTGG + Intergenic
1005697523 6:28365162-28365184 GAGGATCCAGGACTATGCTGGGG - Intronic
1006104294 6:31707341-31707363 CACCAGCCAGGCCTGTGCTGGGG + Intronic
1006518210 6:34556171-34556193 CAGCAGGCAGCCCTGGGCTGGGG - Exonic
1006572500 6:35017495-35017517 CCGGAGCCAGGACTCTGCGGAGG + Exonic
1006819432 6:36879952-36879974 CAGTAGACTGCTCTGTGCTGTGG + Intronic
1007384613 6:41512246-41512268 CAGGAGCTAGCAACCTGCTGGGG + Intergenic
1008130038 6:47710769-47710791 CTGCAGCCAGCCCTGTGCTAAGG + Exonic
1008238994 6:49085058-49085080 CTGAAACCAGCACAGTGCTGGGG - Intergenic
1011557825 6:88588022-88588044 CAGCAGGCAGCACTGTGTTCTGG - Intergenic
1011868171 6:91858180-91858202 AAGCAGACAGCACTGTCCTGAGG + Intergenic
1011945151 6:92891037-92891059 CTGGTGCCAGCCCAGTGCTGGGG + Intergenic
1012311192 6:97725604-97725626 AAGGAGACAGCAGTGAGCTGCGG - Intergenic
1015688978 6:135899074-135899096 CAGGAGAGAGAACTGTGCAGGGG - Intronic
1016041575 6:139437110-139437132 CAGCAGCCAGCATTTTGCTTAGG + Intergenic
1017592537 6:155992906-155992928 CAGCAGCCAGCTCTGTGCACAGG - Intergenic
1017731100 6:157316800-157316822 CAGGAGGCTGCAGTGAGCTGAGG + Intronic
1017767145 6:157616192-157616214 CAAGAGCCGGCACAGTGCAGTGG + Intronic
1018199722 6:161383724-161383746 CAGGAACCATCACAGGGCTGAGG - Intronic
1018420605 6:163637620-163637642 AGGCAGACAGCACTGTGCTGGGG - Intergenic
1018683484 6:166283968-166283990 CAGTTGCCAGCACTGTCCTGTGG + Intergenic
1018992335 6:168683768-168683790 CAGCTGCCAGCACAGTGATGTGG + Intergenic
1019151139 6:170006758-170006780 AAGGAGCCAGCGCTGTCCAGAGG + Intergenic
1019597834 7:1866514-1866536 CACGAGGGTGCACTGTGCTGAGG + Intronic
1019644047 7:2119741-2119763 GTGCAGCCAGGACTGTGCTGAGG - Intronic
1020022454 7:4877365-4877387 CAGGAGGCTGCAGTGAGCTGTGG + Intronic
1024224198 7:47313269-47313291 CAGGTGCCAGCCCAGTGCTGGGG - Intronic
1026267424 7:68807588-68807610 CAGGTGCCTGTGCTGTGCTGGGG - Intergenic
1026457788 7:70587965-70587987 AAGGAGACAGCACTGTGCGGCGG - Intronic
1026513198 7:71044525-71044547 CAGCAGCCACCACTTTGCAGGGG - Intergenic
1026899379 7:74028427-74028449 CAGGAGCCAGCCCCGTGCCCAGG + Intronic
1029346649 7:99983562-99983584 AAGGGGACAACACTGTGCTGTGG - Intergenic
1030305398 7:108013207-108013229 CAGGTGCCAGCTCTGTGTTTAGG - Intergenic
1030361074 7:108596035-108596057 AAGGAGACAGGACTGTGCTGGGG + Intergenic
1032094143 7:128929257-128929279 CAGGAGCCAGCACTGGGATTGGG - Intergenic
1032196957 7:129795027-129795049 CAGCAGACAGCACTGCCCTGAGG + Intergenic
1032370227 7:131341924-131341946 CAGGAACCAGTACTGGTCTGTGG + Intronic
1032475783 7:132210749-132210771 CAGAACCCAGCACGCTGCTGGGG + Intronic
1033277974 7:139987064-139987086 CATGAGCCAGCACTCTGCCTGGG + Intronic
1033790046 7:144780423-144780445 CAGGAACCAGTACTGGGATGCGG - Intronic
1033813588 7:145046464-145046486 ACAGAACCAGCACTGTGCTGGGG + Intergenic
1034052219 7:147995593-147995615 CAGGAGCTTGCAGTGAGCTGAGG - Intronic
1034838985 7:154378124-154378146 CAGGACCCAGCACAATGGTGGGG + Intronic
1035329448 7:158086553-158086575 CAGCACTCAGCACTGTGCTGGGG + Intronic
1035335032 7:158122422-158122444 GAAGACCCAGCACTGTGCCGGGG - Intronic
1035463157 7:159058646-159058668 CAGGATCCAGCCCTGTGCTCTGG + Intronic
1035945087 8:3953883-3953905 CAGGCCCCAGGACTGTGCTCTGG + Intronic
1036061951 8:5332413-5332435 CAGGTGCCAGCATGGTGCTTGGG + Intergenic
1036412229 8:8512820-8512842 TATGTGCCAGCACTGTGCTGTGG - Intergenic
1037997856 8:23366702-23366724 CAGTAGCCAGACTTGTGCTGAGG + Intronic
1038581802 8:28754276-28754298 CAGGAGAGGGCACTGAGCTGTGG + Intronic
1038685892 8:29718353-29718375 CAGCTCCCAGCACTCTGCTGTGG - Intergenic
1039680482 8:39730235-39730257 CAGCAGCCATCACTGTGGCGAGG + Intergenic
1040029885 8:42814569-42814591 CAAGGGCCAGTGCTGTGCTGTGG - Intergenic
1040685380 8:49865479-49865501 CAGGAGCCAGGAAGGAGCTGAGG - Intergenic
1041512873 8:58670974-58670996 CAGGAGGCAGGCCTGGGCTGGGG - Intergenic
1042648331 8:71012097-71012119 CCGTACTCAGCACTGTGCTGGGG + Intergenic
1045356353 8:101392551-101392573 TAAGAGCCAGCATTGTTCTGAGG - Intergenic
1045510384 8:102808388-102808410 CAGGAGGCTGCACTCTTCTGTGG - Intergenic
1045710395 8:104976312-104976334 CAGGAGCCTTCAGTGGGCTGAGG - Intronic
1046453488 8:114425379-114425401 CACCAGTGAGCACTGTGCTGTGG + Intergenic
1046951383 8:120023061-120023083 CAGGAGCCAGCATGGTGAGGTGG + Intronic
1047102114 8:121688618-121688640 CTGCAGCCAGAACTGTGGTGTGG + Intergenic
1047515935 8:125554861-125554883 CAGGAGCCACATCTGGGCTGGGG + Intergenic
1047636595 8:126769778-126769800 TAGGTGCCAGCACTGTGCTAAGG - Intergenic
1048202355 8:132385254-132385276 AAGGAAGCAGCACTGAGCTGAGG - Intronic
1048354072 8:133639252-133639274 CAGGATCCAGCCCTCTGCTTAGG - Intergenic
1048870199 8:138790935-138790957 GAGGACCCAGCATGGTGCTGGGG - Intronic
1049595896 8:143483250-143483272 CCCGAGCCAGCACGGTGATGGGG - Intronic
1049989968 9:981555-981577 CAAGAGCCAGCCCTGGGGTGGGG - Intronic
1051369222 9:16344054-16344076 CTGGCCCCAGCACTTTGCTGGGG + Intergenic
1051694466 9:19753160-19753182 GAGGAGCCAGCAGTGGTCTGGGG - Intronic
1052955699 9:34251731-34251753 AAGGAGCCAGGACAGTTCTGGGG - Exonic
1053610977 9:39712688-39712710 CAGGTGGCAGTACTGAGCTGGGG + Intergenic
1053869019 9:42470710-42470732 CAGGTGGCAGTACTGAGCTGGGG + Intergenic
1054087277 9:60758470-60758492 CAGGTGGCAGTACTGAGCTGGGG - Intergenic
1054242544 9:62629707-62629729 CAGGTGGCAGTACTGAGCTGGGG - Intergenic
1054556667 9:66664225-66664247 CAGGTGGCAGTACTGAGCTGGGG - Intergenic
1054906989 9:70420539-70420561 CAGGATCCAGCACTGGGCCTGGG - Intergenic
1056273312 9:84968264-84968286 GAGGAGCCAGGGGTGTGCTGAGG - Intronic
1056383267 9:86074816-86074838 CAAGAGCAAGCAGTGTGGTGGGG - Intronic
1056723244 9:89089497-89089519 CAGAAGCCAGCACTGCCCTTAGG + Intronic
1057294923 9:93829375-93829397 GAGGTGGCAGCACAGTGCTGAGG + Intergenic
1057440149 9:95077215-95077237 CACGGGACAGCACAGTGCTGTGG + Intronic
1057457394 9:95227018-95227040 AAGGAGACAGGACTGTGCAGAGG - Intronic
1057576347 9:96245630-96245652 CAGGTGGCATCACTGTGCGGCGG - Intronic
1058503596 9:105647336-105647358 CAGGAGGCCCCACTGTGCTTAGG - Intergenic
1059422158 9:114198932-114198954 CGTGTGCCAGCCCTGTGCTGAGG - Intronic
1059893033 9:118826408-118826430 GAGAAGCCACCTCTGTGCTGAGG + Intergenic
1060886855 9:127160600-127160622 CAGCTGCCAGCAGTGTCCTGGGG + Intronic
1061008566 9:127942279-127942301 CAGGACCCAGCCCTGGGCAGAGG + Exonic
1061546987 9:131310054-131310076 CAGGAGGCAGCACAGTGAGGTGG + Intergenic
1062462994 9:136669630-136669652 CAGGGGCCAGCCCAGGGCTGCGG - Exonic
1062599506 9:137313580-137313602 CAGGAGACAGGCCTGGGCTGAGG - Intronic
1062699738 9:137892655-137892677 CGGGAGGCTGCCCTGTGCTGGGG - Intronic
1203664384 Un_KI270754v1:12766-12788 CAGGATACAGCACTGTGCCACGG + Intergenic
1186096480 X:6108018-6108040 GAGGAACCAGCACTGTGTTGTGG - Intronic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1189335193 X:40166817-40166839 CAGCAGCCAGCTCTGCCCTGAGG - Intronic
1189980549 X:46506120-46506142 CAGGAGCCAGCCCTGTGAGCAGG - Intronic
1190524080 X:51310920-51310942 CAGGTGCCAGCAAAGTGATGTGG + Intergenic
1192143805 X:68667000-68667022 GAGGTGCCAGCACTGAGCTCTGG + Intronic
1192446208 X:71213458-71213480 AAGGAGGCAGGACTGTGTTGAGG - Intergenic
1192847960 X:74925272-74925294 CTGGAGCCCGCTCTGTGCGGTGG + Exonic
1193724169 X:85020692-85020714 CAAGAGCCAGCCTGGTGCTGGGG - Intronic
1197487604 X:127073790-127073812 TTGAAGCCAGCACTGTACTGGGG + Intergenic
1198159632 X:133994737-133994759 CAAGAGCCAGCACAGTGTTGTGG + Intergenic
1200068480 X:153516550-153516572 GAGGAGGCACCACTGTGCTAGGG - Intergenic
1200103465 X:153699956-153699978 CTGGAGCCAGCACAGCGCTCTGG + Intergenic
1201417371 Y:13760875-13760897 CAGGAGCCAATGCTGTGATGTGG - Intergenic