ID: 1129206185

View in Genome Browser
Species Human (GRCh38)
Location 15:74038268-74038290
Sequence GAGGGACCCCAGCAATATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129206178_1129206185 3 Left 1129206178 15:74038242-74038264 CCCCAGATGTCATGGAGAATCAA 0: 1
1: 0
2: 2
3: 15
4: 171
Right 1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG 0: 1
1: 0
2: 1
3: 16
4: 106
1129206176_1129206185 13 Left 1129206176 15:74038232-74038254 CCAACAGTGTCCCCAGATGTCAT 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG 0: 1
1: 0
2: 1
3: 16
4: 106
1129206180_1129206185 1 Left 1129206180 15:74038244-74038266 CCAGATGTCATGGAGAATCAAGT 0: 1
1: 0
2: 1
3: 9
4: 156
Right 1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG 0: 1
1: 0
2: 1
3: 16
4: 106
1129206179_1129206185 2 Left 1129206179 15:74038243-74038265 CCCAGATGTCATGGAGAATCAAG 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG 0: 1
1: 0
2: 1
3: 16
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129206185 Original CRISPR GAGGGACCCCAGCAATATTG GGG Intronic
903860803 1:26363344-26363366 GAGGTACCCCAGGTATATTGTGG + Intronic
906953659 1:50354760-50354782 GAGAGCCCCCAGCTAAATTGAGG + Intergenic
907400732 1:54223344-54223366 GAGGGACCCCAGGTATGTTCTGG + Intronic
907603761 1:55795083-55795105 GAGTGACACCAGCAAAATGGTGG + Intergenic
908223289 1:62030646-62030668 AAGGGACACCAGCAATCTTTTGG - Intronic
909992412 1:82239705-82239727 GAGGGACAGCTGCAGTATTGTGG - Intergenic
912413714 1:109494372-109494394 GAGGGACCCCAGCAGTAAAGGGG + Intronic
912883292 1:113441062-113441084 GAGGGACTCCAGCAATGTTAAGG - Intronic
917522592 1:175760528-175760550 GAGGGACACCAGCAGTCATGTGG - Intergenic
919210498 1:194476529-194476551 GGGGGTCCCCAGCTAAATTGAGG - Intergenic
1064391016 10:14942227-14942249 GCGGGAGACCAGCACTATTGAGG + Intronic
1064401379 10:15024236-15024258 GCGGGAGACCAGCACTATTGAGG + Intergenic
1067208607 10:44240361-44240383 GAGGGACCCCAGAAAAGTAGGGG + Intergenic
1074276933 10:112012278-112012300 GAGAGCCCCCAGCTAAATTGGGG + Intergenic
1075775336 10:124980786-124980808 GTGAGACCCCGGCTATATTGCGG - Intronic
1076479619 10:130776346-130776368 CAAGGACCCCAGCAACAATGAGG - Intergenic
1077750386 11:4961358-4961380 GATGGTGCCCAGCAACATTGAGG + Intronic
1079271194 11:18987437-18987459 GAGGGATGCCAGTAAAATTGGGG - Intergenic
1080943176 11:36942134-36942156 GAGGGAGCACAGCCATATTGTGG - Intergenic
1087750595 11:102002732-102002754 GAGAGCCCCCAGCTAAATTGGGG - Intergenic
1091795810 12:3296960-3296982 GAGGGGCCCCAGGAAAAGTGAGG + Intergenic
1094042305 12:26130976-26130998 GAGGCTCCACAGCAATATAGGGG + Intronic
1107143215 13:37027437-37027459 GAGCAACCCCACCAATATTTAGG - Intronic
1114141444 14:19915932-19915954 GAGAGTCCCCAGCTAAATTGGGG + Intergenic
1116195751 14:41723133-41723155 GAGGCACCCCACCATTCTTGTGG - Intronic
1118276263 14:64388381-64388403 GATGGACACCACCAATATCGAGG - Exonic
1119385142 14:74253325-74253347 GAGGGATCAAAGGAATATTGTGG + Intronic
1124035404 15:26049430-26049452 GAGGGAACCCAGCAAAATTGGGG - Intergenic
1128744251 15:70102569-70102591 GAGGGACCACAGGAATCTGGAGG + Intergenic
1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG + Intronic
1136546372 16:30957296-30957318 GAGGGACCCGAGGAATTCTGAGG - Exonic
1142580263 17:937594-937616 GGGGGACCCCAGGAACTTTGGGG - Intronic
1144462579 17:15469725-15469747 GAGGGACCCCAGAAGCACTGAGG - Intronic
1144707209 17:17377631-17377653 GAGGCAGCCGAGCACTATTGAGG + Intergenic
1145046929 17:19626151-19626173 GAGGCACCCAATAAATATTGGGG - Intergenic
1147495433 17:40911107-40911129 GAGGCACCCAAACAAAATTGAGG + Intergenic
1149981598 17:61315590-61315612 GAGGCACCCCAGCATCATTGGGG - Intronic
1151212765 17:72557121-72557143 GACAGACCCCAGCAATATCCAGG + Intergenic
1157130292 18:45000942-45000964 GTGGGACCCCAACAAAATAGAGG + Intronic
1158626253 18:59074096-59074118 GAGGGGCCCCAGGAATTTTCAGG - Intergenic
1160362792 18:78297843-78297865 AAGGCACCCCAGCTGTATTGTGG - Intergenic
1162218532 19:9156869-9156891 GAGAGAGCCAAGGAATATTGGGG + Intronic
925180709 2:1815338-1815360 GAGGGACCCCAGCGACAGAGAGG - Intronic
926727372 2:16009057-16009079 GAGTGACCACAGCAATGTGGAGG + Intergenic
929610893 2:43269960-43269982 GAGGAACTCCAGCAACACTGGGG - Intronic
930032326 2:47066014-47066036 CAGGCACCCCAGCAGTAGTGGGG + Exonic
935306853 2:101745338-101745360 GAGGGAGGACAGCAGTATTGGGG - Intronic
935455210 2:103259449-103259471 CAGAGTCCCCAGCCATATTGTGG - Intergenic
938230599 2:129655323-129655345 GAGTGACCCCAGAGACATTGTGG + Intergenic
938308577 2:130270122-130270144 AAGGGAACCCTGCAATTTTGGGG + Intergenic
941417984 2:165245557-165245579 GAGGGAGCCCAGCAATTGTCAGG + Intronic
946147021 2:217738646-217738668 GAGGGCCCCTAGAAATATTGTGG - Intronic
946506237 2:220304056-220304078 ATGGGAGCCCAGCAATCTTGTGG - Intergenic
947442678 2:230136821-230136843 CAGGGAGACCAGCACTATTGTGG + Intergenic
947479223 2:230482346-230482368 GAGAGTCCCCAGCAAGAGTGAGG + Intronic
1169506743 20:6219796-6219818 GAGAGGCCCCAGCTAAATTGGGG + Intergenic
1169819238 20:9690553-9690575 GAAGGTCCCCAGCAGGATTGAGG - Intronic
1173426245 20:42946039-42946061 TAGTGATCCCAGCTATATTGTGG - Intronic
1173896589 20:46555595-46555617 GGGGGACCACAGGAAAATTGTGG - Intergenic
1175778542 20:61667892-61667914 GAGGGACCCCACCAAGTCTGAGG + Intronic
1179576002 21:42308855-42308877 GAGGGAGCCCAGCCATGTTCTGG + Intergenic
1180024301 21:45150611-45150633 GAGGGCCTCCAGCTACATTGGGG + Intronic
1180154153 21:45970091-45970113 GAGGGCCCCCAGCACTACTGTGG + Intergenic
1180784527 22:18539426-18539448 AAGGAACCCCAGCAATCTTGGGG + Intergenic
1181128104 22:20713479-20713501 AAGGAACCCCAGCAATCTTGGGG + Intronic
1181241430 22:21478783-21478805 AAGGAACCCCAGCAATCTTGGGG + Intergenic
1181315497 22:21968447-21968469 GAGGGACCCCAGCCTTCATGGGG - Intronic
1183438007 22:37806488-37806510 GAGGGAACCCAGGAATTGTGAGG + Exonic
1184710538 22:46246987-46247009 GAGGGGCCCCATCTATAATGGGG + Intronic
952766084 3:36955504-36955526 CAGGGACCACAGCAATTTTCTGG + Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
962840988 3:139232371-139232393 GAATAACCCCAGCAATATTTTGG - Intronic
965029118 3:163340890-163340912 GAGGGTGCCCACCCATATTGAGG + Intergenic
965599517 3:170441469-170441491 CAGGGAGCCCAACAATGTTGAGG + Intronic
966460647 3:180172641-180172663 GAGGGACACCAGCATCATTAAGG - Intergenic
966718567 3:183038319-183038341 GAGGGAGCCCTGCAATCATGTGG + Intronic
971371605 4:26023875-26023897 GAGGGTCCCCAGCAGGATTGAGG - Intergenic
972954034 4:44367070-44367092 GAGGGAGCCCAGCAAGTGTGAGG - Intronic
973197179 4:47458894-47458916 AAGGCAGCACAGCAATATTGTGG + Intronic
974086729 4:57269285-57269307 GAGGCACCCAGGCAATGTTGCGG - Intergenic
974645038 4:64678388-64678410 GATGGACCCCACCCATATTAAGG + Intergenic
976610337 4:87024497-87024519 GGGGAACTCCAGCAATATTTGGG + Intronic
977581963 4:98735524-98735546 GAGGAACACCAGCAAGATGGTGG + Intergenic
979847796 4:125538381-125538403 GAGGGACTTCAGCAAAATGGTGG + Intergenic
986944921 5:13005394-13005416 AAGGGAACCCAGCATTTTTGTGG - Intergenic
990759014 5:59108002-59108024 GAGTGACTGCAGCCATATTGGGG + Intronic
994453057 5:99968139-99968161 CAGGAACCCCACCAAGATTGGGG - Intergenic
996154327 5:120079601-120079623 GAGAGACCCCAGCTAAATTGGGG + Intergenic
998564155 5:143201248-143201270 GCAGGACCCCAGGAATATTTAGG + Intronic
998874093 5:146582056-146582078 GAGCTTCCCCTGCAATATTGTGG + Intronic
1010642381 6:78344361-78344383 GAAAGACAACAGCAATATTGGGG - Intergenic
1011881983 6:92040271-92040293 GAGTGACCCAAGAAATACTGTGG + Intergenic
1013253664 6:108360965-108360987 GAGAGCCCCCAGCTAAATTGGGG + Intronic
1014638516 6:123879656-123879678 GAGAGCCCCCAGCTAAATTGGGG + Intronic
1016013506 6:139162180-139162202 GAGGGACTCAAGTAAGATTGGGG + Intronic
1017430070 6:154362099-154362121 GATGGACCCCAGCAAAATAAGGG + Intronic
1019601986 7:1889406-1889428 GAGGGACCCTAGCAGTACAGAGG - Intronic
1022601868 7:31768423-31768445 GACGGACCGCTGCAACATTGGGG + Intronic
1024207749 7:47178278-47178300 GATGATACCCAGCAATATTGAGG + Intergenic
1024377348 7:48654768-48654790 GAAGAACCCCAGCAATATCCAGG + Intergenic
1025094293 7:56085595-56085617 AAGGGAGGCCAGCAGTATTGAGG - Intronic
1027996235 7:85428027-85428049 GAAAAACCACAGCAATATTGAGG + Intergenic
1029620468 7:101687507-101687529 GAGGTGCCCCTGCAGTATTGGGG + Intergenic
1034434626 7:151057462-151057484 GAGGGGCTGCAGAAATATTGAGG + Intronic
1036251391 8:7165802-7165824 GAGGGATCCCAGTGATTTTGAGG + Intergenic
1036366097 8:8121658-8121680 GAGGGATCCCAGTGATTTTGAGG - Intergenic
1037254709 8:16940872-16940894 GAGGGAACACAGCAAGATGGTGG + Intergenic
1038096694 8:24320028-24320050 AAGGGACACCAGCAATATTCTGG - Intronic
1046424153 8:114024435-114024457 GAGGAACCCCAGCAATACTTGGG + Intergenic
1048642256 8:136376887-136376909 GAGGGACCAAAGCAATTTAGGGG + Intergenic
1049576785 8:143393366-143393388 GAGGGTCCCCAGCAACAGAGAGG - Intergenic
1059109480 9:111541719-111541741 GAAGAATCCCAGCAATATTGTGG + Exonic
1060670659 9:125466633-125466655 GAGGGAATCCAGCAACCTTGAGG + Intronic
1062130117 9:134888049-134888071 GAGGGACCCGAGCACTCCTGAGG + Intergenic
1191724534 X:64265628-64265650 GTAGGAGCCCAGCAATAGTGAGG - Intergenic
1193152546 X:78139922-78139944 GAGGGACCCCCGCAAAGGTGAGG - Intergenic
1193255004 X:79337644-79337666 GAGTGACATCAGCAATATAGCGG - Intergenic
1194372611 X:93092033-93092055 GAGAGAACACAGCAATTTTGAGG - Intergenic
1196747171 X:119081536-119081558 AAGGAACCCCAGCGATATTGGGG + Intronic
1198524241 X:137484360-137484382 AAGGGACCACAGCAAAATGGTGG + Intergenic
1198531378 X:137551732-137551754 GAGGCACCCCAGCCACATGGTGG - Intergenic
1199979825 X:152914852-152914874 GAGGGACCGCAGCAACGTGGGGG + Intronic
1201324062 Y:12734529-12734551 GAGTGACATCAGCAAGATTGTGG - Intronic
1202030086 Y:20562429-20562451 GGGTGACCTCAGCAATATGGTGG + Intergenic