ID: 1129207370

View in Genome Browser
Species Human (GRCh38)
Location 15:74045067-74045089
Sequence ATGCTGTGATGGGTGGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129207370_1129207382 15 Left 1129207370 15:74045067-74045089 CCAGGCCCCACCCATCACAGCAT 0: 1
1: 1
2: 1
3: 35
4: 340
Right 1129207382 15:74045105-74045127 CCCAGCCCTCAGTTGTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 154
1129207370_1129207377 -10 Left 1129207370 15:74045067-74045089 CCAGGCCCCACCCATCACAGCAT 0: 1
1: 1
2: 1
3: 35
4: 340
Right 1129207377 15:74045080-74045102 ATCACAGCATTCCCAGGTCCTGG 0: 1
1: 0
2: 0
3: 26
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129207370 Original CRISPR ATGCTGTGATGGGTGGGGCC TGG (reversed) Exonic
900151334 1:1180463-1180485 ATGCTGCGAGGGGTGGGGGCGGG - Exonic
900391337 1:2435268-2435290 GGGCTGTGGGGGGTGGGGCCCGG + Intronic
900592867 1:3467674-3467696 CAGCTGGGATGGGAGGGGCCGGG + Intronic
900674610 1:3877008-3877030 GGGCTGTGGCGGGTGGGGCCTGG + Intronic
900756217 1:4436897-4436919 ATGCTGTGATGTGGGGCACCAGG - Intergenic
901064721 1:6489316-6489338 AAGGGGTGATGGGTGAGGCCTGG - Intronic
901446812 1:9313572-9313594 ATTCTGGGAGGGGTGGGCCCGGG + Intronic
904160785 1:28520694-28520716 AAGCTGTGTTGTGTGGGGCGGGG + Intronic
904730517 1:32587488-32587510 ATGCTGTGATTGGCTGGGCGTGG + Intronic
904762455 1:32815812-32815834 ATAGTGTGATGGTTGTGGCCGGG + Intronic
904799083 1:33080429-33080451 ATGCTGTGTTCCTTGGGGCCAGG + Intronic
904997461 1:34642147-34642169 ATGATGGGATGGGTAGGGCTTGG - Intergenic
906641646 1:47444481-47444503 ATGTTGTGTAGGCTGGGGCCTGG + Intergenic
906748425 1:48237784-48237806 GAGCGGTGATGGGTGGGGCCAGG - Exonic
908074629 1:60502625-60502647 ATGATGTGATGGGTGGAGATGGG - Intergenic
909049905 1:70754310-70754332 ATGCTCTCATGGGAGTGGCCAGG + Intergenic
909135048 1:71787439-71787461 ATATTGTGATTGATGGGGCCAGG + Intronic
910637743 1:89428256-89428278 AGGCTATGGTGAGTGGGGCCAGG + Intergenic
912511923 1:110195490-110195512 GGGATGTGATGGGAGGGGCCTGG + Intronic
912739244 1:112178209-112178231 ATGCTGTGAAAGGTGGGGGCAGG - Intergenic
913295187 1:117312375-117312397 ATGCTGTGGTGGGTGGAGTGGGG - Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
915166950 1:153953286-153953308 ATGCTGGGAGGTGTGGGGCCTGG + Exonic
915509299 1:156377883-156377905 ATGATGTGGTGGGTGGGGTGGGG - Intronic
918015814 1:180631930-180631952 GTGCTGTAAGGGGTGGGGCTTGG - Intergenic
919215237 1:194544913-194544935 AGGCTGTCAGGGGTGGGGCAGGG - Intergenic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
919743801 1:200996163-200996185 AGGGTGTGAGGAGTGGGGCCTGG - Intronic
920078072 1:203351446-203351468 ATGCAGGGATGGGGAGGGCCAGG + Exonic
920162220 1:204007757-204007779 AGGCTGTGATGTGTGGAGGCAGG + Intergenic
920268087 1:204741787-204741809 ATGCAGGGATGAGTGGGGACTGG - Intergenic
920402065 1:205682055-205682077 ACCCTGTATTGGGTGGGGCCTGG - Intergenic
920719559 1:208374595-208374617 ATGCTGAGATGTGTGGGGTTGGG + Intergenic
921361605 1:214334999-214335021 ATGATGTGAGGGTCGGGGCCTGG - Intronic
922097859 1:222457968-222457990 ATGCTTTTATGGGTTAGGCCCGG + Intergenic
922408360 1:225342840-225342862 AGGCTGTGAGGGGTGGGGGTGGG - Intronic
922553196 1:226512470-226512492 ATGCTGTGCTGGGAGGGCACTGG + Intergenic
923154912 1:231269602-231269624 GTGCTGTGATGGGCTGGGTCTGG + Intronic
923335544 1:232966780-232966802 AGCCTGTGAGGGGTGTGGCCAGG + Intronic
924245794 1:242083261-242083283 GGGCCGTGATTGGTGGGGCCAGG + Exonic
1063379468 10:5575313-5575335 CTGCTGTGCTGGGTGAGACCAGG - Intergenic
1065029157 10:21567682-21567704 TTGCTGGTATGGGTGGGGCTAGG + Intronic
1067224510 10:44366917-44366939 TTGCTGTGAATGGAGGGGCCTGG - Intergenic
1067347316 10:45445906-45445928 ATGCTGAGCTGGGTGTGGACAGG - Exonic
1068030174 10:51697001-51697023 ATGCTCAGATGCTTGGGGCCTGG + Exonic
1068713021 10:60155218-60155240 ATGCTGTGCTGCCTGGGGCTGGG - Intronic
1069719350 10:70539706-70539728 ATGCGGTGGTAGGTGAGGCCAGG - Exonic
1069750103 10:70739687-70739709 GTGCTGTGAGGGGTCAGGCCAGG - Intronic
1069910739 10:71757673-71757695 AGGGTGGGATGGGAGGGGCCTGG + Intronic
1070159218 10:73855552-73855574 TTGCTGTGCTGGGCGGGGGCAGG - Intronic
1070612585 10:77943792-77943814 ATGATGTCATGGAGGGGGCCAGG - Intergenic
1071455968 10:85851941-85851963 GGGCTGTGAAGGGTGGGGCTGGG - Intronic
1072618163 10:97063311-97063333 AGGAGGTGATGGGTGGGGCCAGG + Intronic
1073253297 10:102134814-102134836 ATTCAGTGATGGGTGAGGTCAGG - Intronic
1073440301 10:103548740-103548762 TTGCTGTTATGGATGGAGCCAGG + Intronic
1075694254 10:124421756-124421778 AGGCTGAGATGGGTGGATCCAGG - Intergenic
1075695619 10:124432876-124432898 ATGCTGGGAAGGGTGGGGAGGGG + Intergenic
1075949718 10:126466545-126466567 AGGCTGTGTGGGGTGGGGCCAGG + Intronic
1076675932 10:132147743-132147765 ATCCGGTGGTGGGTGGGGCTGGG - Intronic
1076698067 10:132256681-132256703 AGGCAGGGGTGGGTGGGGCCGGG - Intronic
1077092910 11:787750-787772 GTGCCGGGATGGGTTGGGCCTGG - Exonic
1077185278 11:1232993-1233015 TGGCTGTGGTCGGTGGGGCCAGG - Exonic
1077441592 11:2571546-2571568 GTGCTGGGATGGGTGGAGCAGGG + Intronic
1077677183 11:4205520-4205542 GTGCTGAGAAGGGTGAGGCCAGG - Intergenic
1080655138 11:34252588-34252610 ATGGGGGGAAGGGTGGGGCCAGG + Intronic
1080848308 11:36045619-36045641 ATGTGGTCATGGGTGGGACCTGG + Intronic
1080896134 11:36450071-36450093 ACACTGAGATGGGTGCGGCCAGG - Intronic
1081860544 11:46331234-46331256 AGGCAGTGAGTGGTGGGGCCAGG - Intergenic
1082281961 11:50279886-50279908 ATGGTGTAATTGGTGGGGGCTGG + Intergenic
1083295139 11:61711264-61711286 CCTCTGTGATGGGTGCGGCCGGG - Intronic
1083749833 11:64754887-64754909 AAGCTGCGGTGGGTGTGGCCAGG + Intronic
1083893188 11:65607127-65607149 AGGCTGGGAGGGGTGGAGCCAGG - Intronic
1084168253 11:67387164-67387186 ATGATGTGATGGTGGGGGCTGGG - Intronic
1085321417 11:75576399-75576421 AGGCAGAGATGGGAGGGGCCTGG - Intergenic
1085528207 11:77176139-77176161 CTGGTGTGGGGGGTGGGGCCTGG + Intronic
1085650852 11:78267263-78267285 ATGCTGGGATGCAGGGGGCCTGG + Intronic
1087327930 11:96746477-96746499 ATGCTGATATGGGAGGGGTCAGG + Intergenic
1088548443 11:110985756-110985778 TTGCTGTCCAGGGTGGGGCCTGG - Intergenic
1089311331 11:117560038-117560060 CTGCTGGGAGGGGTGGGGGCAGG + Intronic
1089721316 11:120425531-120425553 AGGCTGAGATGGGTGAGCCCAGG - Intronic
1090485979 11:127112429-127112451 ATGCTGTGGTGGAAGGGGTCTGG + Intergenic
1090642202 11:128739430-128739452 AGACTGAGATGGGTGGGGCAGGG - Intronic
1090911411 11:131122772-131122794 GTCCTGTGAGGGGAGGGGCCTGG + Intergenic
1091122232 11:133065871-133065893 GTAGTGTGATGGGTGGAGCCGGG - Intronic
1092139241 12:6171558-6171580 ATGGCGTGATGTGTGGGACCTGG - Intergenic
1092732848 12:11550625-11550647 ATGGTGTGATGGGTGGCACTGGG + Intergenic
1094147281 12:27244047-27244069 AGGCGGAGATGGGTGGGGCCGGG + Intronic
1096495176 12:52035904-52035926 ATTCTTTGCTGCGTGGGGCCTGG + Intronic
1096699345 12:53371829-53371851 ATGCTGAGCTGGGCCGGGCCGGG + Intergenic
1099429899 12:82571152-82571174 AAGCTGTCATAGTTGGGGCCGGG + Intergenic
1101167757 12:102055631-102055653 AAGCTTTGATGGGTGGGGCACGG - Intronic
1101730530 12:107423556-107423578 GTGGTGTGGTGTGTGGGGCCGGG + Intronic
1102156269 12:110731201-110731223 ATGCATTGATGGGTGGGGGGTGG - Intronic
1103025756 12:117572432-117572454 ATCCCGAGATAGGTGGGGCCAGG + Intronic
1103560772 12:121792386-121792408 GTGTTGTGAGGGGTGGGGACAGG - Intronic
1103576280 12:121879852-121879874 AAGCTATACTGGGTGGGGCCAGG + Intergenic
1106175223 13:27324520-27324542 AGGCTGTGATGCCTGGGGCCTGG + Intergenic
1107223223 13:38012294-38012316 ATGCTGGGCTGTGTGTGGCCAGG - Intergenic
1109959184 13:69608345-69608367 ATGCAGTGAAGGGTGGAGACTGG - Intergenic
1110462256 13:75757953-75757975 TTTGTGTGATGGGTTGGGCCAGG + Intronic
1113618079 13:111695135-111695157 ACGGTGTGAGGGGTGGGGACGGG - Intergenic
1113623612 13:111780396-111780418 ACGGTGTGAGGGGTGGGGACGGG - Intergenic
1117648028 14:57872948-57872970 ATGCTGTGATTGGTGGAGCAGGG - Intronic
1118763507 14:68895014-68895036 ATGCTGGGGTGTGTGGGGCAGGG + Intronic
1119342518 14:73891642-73891664 ATGCTGTGAAGGGTTGGGTGTGG - Intronic
1119481267 14:74959777-74959799 AAGCTGGGATGGGTTGGGGCAGG - Intergenic
1119756683 14:77124835-77124857 ACGCGGTGATGCGCGGGGCCCGG + Intronic
1119773774 14:77236423-77236445 AGACTGTGATGGGTGGGGGTGGG + Intronic
1120951496 14:90046032-90046054 CTGCTGTCAGGGGTTGGGCCTGG - Intergenic
1121049993 14:90814168-90814190 ATGCAGTCATGAGTGGGGCTTGG - Intronic
1121089073 14:91168794-91168816 ATGCTGGGATGGGATGGGCGCGG + Intronic
1121529451 14:94641967-94641989 ATGCTGTGATGGGTGGGGCTAGG - Intergenic
1121570099 14:94940856-94940878 GTGCTGTGATGAGTGGGGGATGG - Intergenic
1122386458 14:101351481-101351503 GTAGTGTGATGGGTGGGGGCGGG + Intergenic
1122439320 14:101719161-101719183 ATGCTGTGAGGGGAGGGGAGGGG + Intergenic
1122644954 14:103188084-103188106 AGGCTGGGATGGGGGAGGCCAGG + Intergenic
1122836508 14:104433434-104433456 ATGCCGTGATTGGAGGGGGCGGG - Intergenic
1123962195 15:25415358-25415380 GTGCTGGGATGGCTGGGGTCAGG - Intronic
1124044647 15:26137728-26137750 TTGCTGTGATGGCTGGGCCATGG - Intergenic
1125831580 15:42720539-42720561 ATCCTAGGATAGGTGGGGCCAGG - Exonic
1126544781 15:49861526-49861548 CTGCTGTGGTGAGTGGGACCAGG - Intronic
1127566195 15:60190860-60190882 ATGCTGGGAGGGGTGGGGGTAGG + Intergenic
1128261958 15:66238799-66238821 AGGCAGTGATGGGTGGGGGTGGG - Intronic
1128462841 15:67884444-67884466 ATGCTGTGATGGTTATAGCCGGG - Intergenic
1128537619 15:68502736-68502758 GTGCTGGGATGAGTGAGGCCGGG - Intergenic
1128740708 15:70082080-70082102 CTGCTGGGAAGGTTGGGGCCAGG - Intronic
1129207370 15:74045067-74045089 ATGCTGTGATGGGTGGGGCCTGG - Exonic
1130645948 15:85727260-85727282 GGGCTGGGAAGGGTGGGGCCTGG - Intronic
1130871736 15:87977483-87977505 ATGCTGGGATGGATGGAGCCTGG + Intronic
1131049912 15:89340783-89340805 GTGCTGTGCTGGGCTGGGCCTGG - Intergenic
1131192690 15:90329825-90329847 AGGCTGTGATGGGACGTGCCTGG - Intergenic
1132153836 15:99481268-99481290 ATGCTGGGAGGGGTGGGAGCTGG + Intergenic
1132318805 15:100910047-100910069 ATGCTGTGAAGGGATGGGCCTGG + Intronic
1132587403 16:711602-711624 GTGCTTTCCTGGGTGGGGCCGGG + Intronic
1132589379 16:720024-720046 ACGCTGAGCTGGGTGGGGCTGGG + Intronic
1132896195 16:2230473-2230495 ATGCTGTGGGAGGTGGGGCGGGG + Intronic
1133140839 16:3742873-3742895 ATGCTGCGGTGGGAGGGGGCTGG + Intronic
1133963363 16:10513477-10513499 ATGCTGTGATCACTGGGGCAAGG + Intergenic
1135155616 16:20050391-20050413 TTGCAGGGATGGGTGGGGCTAGG + Intronic
1135563715 16:23495932-23495954 ATGCTGTGCTGGGTGGTGGTAGG - Intronic
1136272227 16:29155165-29155187 ATGCTCTGAAGGGTGTGGCTGGG + Intergenic
1136347528 16:29685707-29685729 ATTCTGTGATGGGTCAGGCATGG + Intronic
1136409150 16:30066233-30066255 AGGCAGTGAGGGGTGGGGGCCGG + Intronic
1137801235 16:51263881-51263903 ATGGGGAGATGGGTGGGGTCAGG + Intergenic
1138005920 16:53337501-53337523 AAGCTGGGCAGGGTGGGGCCTGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138347568 16:56329445-56329467 CTGCTGTGATGGGAAGAGCCGGG - Intronic
1138987528 16:62348850-62348872 ATCCTGTCTTGGGTGGGGCTGGG + Intergenic
1139432564 16:66918881-66918903 AGGCTGGGCTGGGTGGGGCAAGG + Exonic
1139806112 16:69566382-69566404 AGGCTGTGGGGGGTGGGGCGTGG + Intronic
1141375909 16:83530602-83530624 CTGCTGTGATGGTTGGTGCGTGG - Intronic
1142075804 16:88117081-88117103 ATGCTCTGAAGGGTGTGGCTGGG + Intronic
1142760132 17:2037159-2037181 AGGCTGTGCAGGGTGGGGGCAGG + Intronic
1142773410 17:2116485-2116507 AGGCTGAGGTGGGTGGGGTCAGG + Intronic
1142807301 17:2378082-2378104 AGTCTGGGCTGGGTGGGGCCAGG - Intronic
1143729400 17:8872434-8872456 TTGCTGTGGAGGGCGGGGCCTGG + Intergenic
1144625351 17:16841630-16841652 CTGCTCTGATGGGGTGGGCCAGG - Intergenic
1145108438 17:20140001-20140023 ATGCTGTGTTGGGTGAAGTCAGG - Intronic
1145180219 17:20743403-20743425 ATGCTGTAATGGGCTGGGCGCGG + Intergenic
1145253076 17:21307109-21307131 ATGCTGAGAGGAGGGGGGCCTGG - Intronic
1147331117 17:39700150-39700172 GTGCTGCGAGGGGTGGGGGCCGG - Exonic
1147947243 17:44086967-44086989 AGGCTGGGAGGGGTGGGGGCGGG + Intronic
1150290200 17:63976744-63976766 ATGCAGGGAGGTGTGGGGCCAGG - Intergenic
1150625305 17:66837425-66837447 AGGCTGTGTGGGGTGGGCCCAGG - Intronic
1151961793 17:77409502-77409524 CTGCGGGGAAGGGTGGGGCCAGG + Intronic
1151972403 17:77465609-77465631 ACGCAGGGATGGGTGGGGCTGGG + Intronic
1152222111 17:79074734-79074756 GGGCTGTGAGGGGCGGGGCCTGG - Intergenic
1152323226 17:79620796-79620818 CTGCTGTGGAGGGTGGAGCCAGG - Intergenic
1152574076 17:81132568-81132590 AAGCCCAGATGGGTGGGGCCAGG - Intronic
1152754227 17:82080416-82080438 AGGCTGTTGTGGGTGGGGGCTGG + Exonic
1153407553 18:4758026-4758048 AGTCTGTGATGGGAGGGCCCAGG + Intergenic
1153610202 18:6877260-6877282 ATGCTGAGATGGGTGAGGAGCGG + Intronic
1153744868 18:8167372-8167394 ATGCTGAGAAGTGTGGAGCCTGG - Intronic
1154356619 18:13626711-13626733 CAGCTGTGCTGGGTGGGGCCTGG - Intronic
1154981337 18:21504826-21504848 ACGCTGTAAGGGGTAGGGCCAGG + Intronic
1155033326 18:22002881-22002903 GTGGTGTGATGGGTGGGTACAGG + Intergenic
1156506604 18:37599796-37599818 AGGCTGTGATGGCTGGAGCTGGG - Intergenic
1157229727 18:45903962-45903984 ATCCTTTGCTGGGTGGGTCCTGG - Exonic
1158017174 18:52797799-52797821 TGGCTGTGATGGATGGGGCCAGG + Intronic
1158744891 18:60188485-60188507 CAGGTGTGATGGGTGGGGCCAGG + Intergenic
1160258073 18:77264516-77264538 ATGCTGTGATGGGAAGGCCAGGG + Intronic
1160390618 18:78528656-78528678 ATTCTGAGAAGGGTGGAGCCGGG - Intergenic
1161347699 19:3776422-3776444 ATGCATGGATGGGTGGGGACAGG + Intergenic
1161594409 19:5143879-5143901 AGGCTGTGCCGGGAGGGGCCGGG + Intronic
1161859690 19:6788761-6788783 ATGCTCTGATGGGCCAGGCCAGG + Intronic
1161958368 19:7508483-7508505 ATGCTTGGGTGGGTGGGGGCTGG + Intronic
1161963791 19:7536550-7536572 AGGCTGTGCTGGGTGTGACCTGG + Intronic
1161979504 19:7623357-7623379 TGGCTCTGAGGGGTGGGGCCTGG + Intronic
1163717292 19:18879734-18879756 TTGGTGAGGTGGGTGGGGCCTGG - Intronic
1163829622 19:19541424-19541446 GGGCTGTGAAGGGCGGGGCCTGG + Intronic
1164830186 19:31314238-31314260 AGGCTGGCATGGCTGGGGCCTGG - Intronic
1165248007 19:34508763-34508785 ATGGGGTGATGGGTGTGTCCTGG - Exonic
1165793829 19:38507288-38507310 AGGCTGAAAAGGGTGGGGCCCGG + Intronic
1166548462 19:43648948-43648970 AGGCTGAGATGGGCAGGGCCAGG + Exonic
1166749716 19:45159077-45159099 ATGCTGTCATCAGTGGCGCCAGG - Exonic
1166895222 19:46018435-46018457 ATGGTGTGGGGGGTGGGGCCAGG + Exonic
1167846857 19:52171664-52171686 ATGCGGTAGTGGGCGGGGCCAGG + Intergenic
1168247313 19:55118906-55118928 ATGCTGGGATTGGTGGTCCCGGG + Intergenic
925402644 2:3586588-3586610 ATGATGTGATGGGCCTGGCCTGG + Intergenic
925941267 2:8821949-8821971 TTGCTGGGATGTGTGGGGTCAGG - Intronic
927029324 2:19104199-19104221 ATGGTATGATGGGTGAGGCCAGG - Intergenic
927091985 2:19719289-19719311 ATGCTGGGCTGGCTGGTGCCTGG - Intergenic
927249074 2:20981895-20981917 AGGCTGAGATGAGTGGGGCATGG + Intergenic
927981377 2:27377150-27377172 ATGCTGTGATGGGGGAAGCAGGG - Intronic
928013089 2:27629030-27629052 ATGGTCGGGTGGGTGGGGCCAGG + Exonic
928120138 2:28578062-28578084 GTGCTGTGAGGAGTGGGGACTGG - Intronic
929520354 2:42644493-42644515 ATGCTATTATAGGTGTGGCCTGG + Intronic
931812569 2:65868845-65868867 AGCATGTAATGGGTGGGGCCAGG - Intergenic
934718469 2:96556713-96556735 CTGCTGTGCTGGGTGACGCCAGG + Intergenic
935163606 2:100550218-100550240 CTGCAGTGATGGGTGGGGTCAGG + Intergenic
935814892 2:106838323-106838345 ATGATGTGGTGAATGGGGCCTGG - Intronic
937268721 2:120633537-120633559 ATGCTGTGTGGGGAGGGGCCCGG + Intergenic
938339664 2:130527059-130527081 CTGCTGTGAGGGGTGGGGAGGGG + Intronic
938350172 2:130593691-130593713 CTGCTGTGAGGGGTGGGGAGGGG - Intronic
941087959 2:161140909-161140931 ATGCTGTGAGTGGTGGGGGTAGG - Intronic
941621510 2:167784203-167784225 ATGCAGTGATGGGGGTGGCTGGG - Intergenic
944229407 2:197377783-197377805 ATGCCATAATGGGTGGGGCAAGG + Intergenic
946125049 2:217555393-217555415 ATGCTGGGTGGGGTGGGGACAGG + Intronic
946239598 2:218345514-218345536 TTGCAGGGATGGGTGGGGCAGGG - Exonic
946398187 2:219453923-219453945 AGGCAGTGAGGGGTGGGGCCAGG + Intronic
946497883 2:220214312-220214334 AAGCTATGATGGGTGGTGGCGGG - Intergenic
946943798 2:224798394-224798416 ATGGCGAGTTGGGTGGGGCCGGG + Intronic
948058881 2:235029281-235029303 TGGCTGAGATGGGTGAGGCCAGG + Intronic
948284627 2:236773999-236774021 ATGCTGTGGGGGCTGGGGCCTGG + Intergenic
948947445 2:241228285-241228307 ATGCTGTGAGGGCTGAGGACGGG - Exonic
1170537018 20:17350452-17350474 GTGCTGGGGTGGGAGGGGCCAGG - Intronic
1171190010 20:23152056-23152078 ATGCTGTGGTGGAAGGGACCTGG - Intergenic
1171279681 20:23885124-23885146 ACGCTGCAATGGCTGGGGCCAGG - Intergenic
1172029481 20:31971580-31971602 ATGTTCTGAGTGGTGGGGCCTGG + Intronic
1175980804 20:62737723-62737745 TTGCTCTCAGGGGTGGGGCCAGG - Intronic
1176033877 20:63026985-63027007 CTGGTGTCTTGGGTGGGGCCTGG + Intergenic
1176173064 20:63704913-63704935 ATGCTGTGCCATGTGGGGCCAGG - Intronic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1177163137 21:17571005-17571027 ATGCTGTGGTGGCGGGGACCAGG - Intronic
1178247164 21:30964492-30964514 TTGCTGTGTTGGGATGGGCCAGG - Intergenic
1179884338 21:44307063-44307085 GGGGTGTGGTGGGTGGGGCCTGG - Intronic
1180002200 21:45000284-45000306 AGGTGGGGATGGGTGGGGCCAGG - Intergenic
1180737351 22:18027250-18027272 AGGCTTTGATGGGTGGGGTAGGG + Intergenic
1180968177 22:19801281-19801303 ATGAGGTGCTGGGTGTGGCCTGG - Intronic
1181119296 22:20654857-20654879 ATGCTGGGCTGGGAGGGGCCTGG - Intergenic
1181466719 22:23114388-23114410 TTGCTGGGAAGGGTGGGGCCGGG - Intronic
1181602471 22:23960565-23960587 GGGCTTTGGTGGGTGGGGCCAGG + Intronic
1181689175 22:24548902-24548924 GTGCTGCGGTGAGTGGGGCCAGG - Exonic
1181977768 22:26743305-26743327 ATGCTGTGATTGGTCAGCCCTGG - Intergenic
1184168242 22:42743303-42743325 AAGCTGTGAGGGCTGGGGCAGGG + Intergenic
1184393005 22:44216214-44216236 TTCCTTTGATGGGTGGGCCCTGG + Intronic
1184644056 22:45886552-45886574 GTGCTGGGGTGGGTGGGGCAGGG - Intergenic
1184840639 22:47050675-47050697 AGCCAGGGATGGGTGGGGCCCGG + Intronic
1185365963 22:50436869-50436891 GTGATGTGCTGGGTGGGGTCTGG + Intronic
950406931 3:12810479-12810501 CTGATGTGGTGGGTGGGGCCTGG + Intronic
950541134 3:13613986-13614008 ATGCTGTGACTGCTGTGGCCTGG + Exonic
950841207 3:15969918-15969940 ATGCTGGGGTGGGTGGGGGTGGG + Intergenic
950904549 3:16525856-16525878 ATGCTCTGATGGGCCAGGCCTGG + Intergenic
952207830 3:31198198-31198220 ATACAGTGATAGGTGGGGCATGG - Intergenic
953746119 3:45575370-45575392 ATGCTGAGCTGGGTAGGGGCTGG - Intronic
953906134 3:46869112-46869134 ATGCTGTGGGGGGAGGGGCCGGG - Intronic
954391262 3:50269233-50269255 CTGCTGAGATGGGGCGGGCCGGG + Exonic
955063479 3:55514581-55514603 GTGCTGTGATGGAGGGAGCCAGG + Intronic
959128932 3:102327504-102327526 AAACTGTCATGGGTGGGGGCAGG - Intronic
959620837 3:108397232-108397254 ATGCTGAGATAGGTGGGGCCAGG - Intronic
959719459 3:109470479-109470501 ATGCTGAAATGGGAAGGGCCAGG + Intergenic
960741615 3:120840241-120840263 ATTCTGTGATGGGTAGGCCAAGG - Intergenic
960951978 3:123005199-123005221 ATGCTGTCAGGGGTGGGGACAGG - Intronic
961348305 3:126279090-126279112 ATCCTGTGATGGGGCGGGCGTGG + Intergenic
961386519 3:126526101-126526123 AAGCTGTGATGGCTGGAGACAGG - Intronic
961485298 3:127211763-127211785 ATGCTGTGCTGGGGAGGGGCAGG + Intergenic
962609381 3:137061168-137061190 ATGCTCTGGAGGGTGGGGGCTGG + Intergenic
962926182 3:139995298-139995320 ATGCTGTGAGGTGTGGAGGCTGG - Intronic
963247776 3:143078422-143078444 ATGCTGTGATTGGTGGTTGCAGG + Intergenic
968730566 4:2267518-2267540 CTGCGGTGGGGGGTGGGGCCGGG + Intergenic
969573659 4:8024404-8024426 ATTCGGTGGGGGGTGGGGCCAGG + Intronic
969835033 4:9833612-9833634 ATGCTGGGGTGGCTGGGGCTTGG + Intronic
972637816 4:40899845-40899867 ATGCAGTGAGGGGTGAGACCAGG + Intronic
973734863 4:53861593-53861615 ATGCTGTGTTGGGTGGTTCAAGG - Intronic
974016211 4:56651606-56651628 ACACTGTGATGGGTAGGGGCTGG + Intronic
976243398 4:82983301-82983323 ATGCAGTGATCGGCGGGGCGTGG - Intronic
976613694 4:87054652-87054674 CTGCTGCCATGGGTGGTGCCTGG + Intronic
977250068 4:94679671-94679693 ATTCTCTGCTGGGTGGGGCATGG - Intergenic
979551471 4:121996012-121996034 ATGCTATGATGGGTAAGGCAGGG - Intergenic
981108693 4:140910892-140910914 ATGCTGTGATGTGTGAGCCCTGG + Intronic
983520791 4:168706651-168706673 AGGCTTTGGTGGGTGGGGCAGGG + Intronic
984291730 4:177804213-177804235 ATGCTCTGATGGTAGGGGCTTGG + Intronic
985021883 4:185700345-185700367 AGGCTGTGCTGGGTGGGGGGAGG + Intronic
985511290 5:315637-315659 GTGCTGTGGGGGGTGGGGACTGG + Intronic
986304430 5:6504909-6504931 TTCCTGTGCTGGGTGGGGGCAGG + Intergenic
990258778 5:53999061-53999083 ATGCTGTCAAGAGTGGGGCCAGG + Intronic
990381296 5:55223737-55223759 AAGCTGTGATTCGAGGGGCCAGG + Intronic
990701429 5:58478957-58478979 ATGCTCTGATGGGTTGAGCCAGG - Intergenic
990982384 5:61614000-61614022 GTGCTATGATGGGGGAGGCCAGG + Intergenic
991950418 5:71941999-71942021 TTGCTGTGAAAAGTGGGGCCAGG - Intergenic
993094671 5:83467858-83467880 ATGGAGTGATGGGAGAGGCCGGG - Intergenic
993464722 5:88230938-88230960 CTCCAGTGATGGGAGGGGCCTGG + Intronic
994204492 5:97018850-97018872 GTGTTGTGATGGGTAGGGTCTGG + Intronic
999303863 5:150507602-150507624 CAGCTGAGCTGGGTGGGGCCAGG + Intronic
999330432 5:150670411-150670433 ATGCTTCGAGAGGTGGGGCCTGG + Intronic
1000014758 5:157266692-157266714 AACGTGTGATGGGTGGGGCGAGG + Intronic
1000186019 5:158858875-158858897 ATGAGGTCAGGGGTGGGGCCGGG + Intronic
1001513259 5:172338167-172338189 ATGCTGTGATAGGAGGGATCAGG + Exonic
1001950351 5:175812254-175812276 ATTCTGTGGTGGGCAGGGCCTGG - Intronic
1002189584 5:177471785-177471807 CTGCTGGGGTGGGTGGGGGCAGG + Intronic
1002883570 6:1274130-1274152 ATGCTGAGATGGGGGTGGCTGGG - Intergenic
1003643486 6:7895337-7895359 CTGCTGTGCTGAGTGAGGCCAGG + Intronic
1005680021 6:28197322-28197344 TTGCTGTTATGGGTAGGGCTTGG + Intergenic
1006474771 6:34246772-34246794 AGGCTCTGAAGGGTGGGGCAAGG + Exonic
1007460759 6:42017122-42017144 ATGCTGTGTGGGGGAGGGCCAGG - Intronic
1007712139 6:43831219-43831241 TTGCTCTGAAGGGTGGGGACAGG + Intergenic
1007761884 6:44138172-44138194 AGGGTGGGATGGGTGGGGCTTGG - Intronic
1016833225 6:148453204-148453226 TTGCTGGGATGGCTGGGGACAGG + Intronic
1016884844 6:148949773-148949795 ATTCTGTGAGGGTTGGGGGCAGG - Intronic
1016953943 6:149608525-149608547 TTGCTGCCCTGGGTGGGGCCGGG - Intronic
1017141186 6:151191459-151191481 ATGCTGGGATGGGTGGTGGAGGG + Intergenic
1017168568 6:151433945-151433967 AGGCTGAGGTGGGTGGGGCGGGG - Intronic
1017186381 6:151605045-151605067 AGGCTGGGAAGGGTGGGGGCAGG - Intronic
1017506535 6:155073639-155073661 CTGCTCTGGTGGGTGTGGCCTGG - Intronic
1017806621 6:157952072-157952094 ATGCTGTGGGGGGTGGGGTCAGG - Intergenic
1018860853 6:167709756-167709778 GGGCTGTGATGGGTGATGCCAGG - Intergenic
1019518271 7:1449045-1449067 AGTCTGGGTTGGGTGGGGCCTGG - Intronic
1019639440 7:2095630-2095652 ATGCTGGGCAGGGTGGGGCGAGG + Intronic
1019684514 7:2373526-2373548 ATGCTGCGAAAGGTGCGGCCAGG - Intronic
1019803339 7:3104747-3104769 ATGCTTTGATGGGTCAGGCTAGG + Intergenic
1020370651 7:7428628-7428650 AGGCTGTGATGAGTGGGGCTTGG + Intronic
1021845208 7:24757151-24757173 ACGCGGTGATGGGAGGGGACCGG + Intronic
1026325678 7:69307178-69307200 ATGCTGTGCAGGAAGGGGCCAGG - Intergenic
1028567366 7:92246924-92246946 GGGCTGTGATGGGTGGGGATAGG + Intronic
1029525115 7:101089289-101089311 AATCTGTGATGGGCTGGGCCAGG + Exonic
1029706554 7:102279602-102279624 CGGCTCTGATGGGTGGGGACAGG - Intronic
1029853349 7:103487851-103487873 ATTCAGTAATGGGTGGGGCGTGG + Intronic
1030132974 7:106218854-106218876 ATGCGGTGGTGTGTGGGGTCAGG + Intergenic
1033335416 7:140448044-140448066 CTGGTGTGATGGGTGGCGTCAGG - Intergenic
1033946228 7:146722308-146722330 GTCCTGTGATGGGTAGGGCTTGG + Intronic
1035667081 8:1387427-1387449 ATGCTGTGATGTGTGTCTCCAGG - Intergenic
1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG + Intergenic
1035805502 8:2449850-2449872 ATTCTGTTATGGGCGGGGCAGGG - Intergenic
1036593130 8:10186719-10186741 TGGCTGTGATGGGTGGGGCGGGG + Intronic
1036621373 8:10426237-10426259 ATGCTGTGTGAGCTGGGGCCCGG + Intronic
1037011971 8:13854986-13855008 ATGATGTTAAGGCTGGGGCCAGG - Intergenic
1037804847 8:22053515-22053537 TTGGTGTGTAGGGTGGGGCCGGG + Intronic
1037913689 8:22759190-22759212 TTGCTGTCAGGGGTGGGGGCTGG + Intronic
1039587347 8:38718362-38718384 ATGGTGAAGTGGGTGGGGCCAGG + Intergenic
1041374007 8:57193717-57193739 GTGCTGGGCTGGGTGGGGTCTGG + Intergenic
1043457298 8:80425204-80425226 ATTATGTGATGGGCGGGGCATGG - Intergenic
1044780270 8:95736166-95736188 ATGCAGTCAGGTGTGGGGCCTGG + Intergenic
1044889086 8:96813269-96813291 AGGCTGGGAGGGGTGAGGCCTGG + Intronic
1045483803 8:102614351-102614373 AAGCTGTGGTGGGTGGGACTAGG - Intergenic
1046882849 8:119329364-119329386 AGGCTGGGAAGGGTGGGGCAGGG + Intergenic
1047418379 8:124684973-124684995 AAGCTGGGAAGGGTGGGGACAGG + Intronic
1049130325 8:140834127-140834149 AAGCTGCAATGGGTGGGGCTGGG + Intronic
1049224055 8:141441305-141441327 CTGATGAGATGGGTGGGGGCAGG - Intergenic
1049611757 8:143559146-143559168 ATTCTGTGTTGGGGAGGGCCGGG + Intronic
1056718300 9:89052125-89052147 ATGCTGTGATGGGCTGGCCCAGG - Exonic
1056810120 9:89757591-89757613 ATGCTGTGATGTATTGGTCCAGG + Intergenic
1057371525 9:94478980-94479002 TTGCTGTGGTGGGTGGAGGCTGG - Intergenic
1058133346 9:101278532-101278554 ATGTTGTGATGGTTGGGGGAGGG - Intronic
1059098547 9:111445824-111445846 CTGTTGTGGGGGGTGGGGCCTGG - Intronic
1059677160 9:116550465-116550487 ATCCTGTGCTGGGTCTGGCCTGG + Intronic
1060980179 9:127786952-127786974 AGGCAGTTATGGGTGAGGCCAGG + Intronic
1062153579 9:135033885-135033907 ATGGTGTGGTGGGTGGGGTCAGG - Intergenic
1062465657 9:136679883-136679905 ATTCTGAGAGGGGAGGGGCCAGG - Intronic
1062540254 9:137038908-137038930 GGGGTGTGATGGGAGGGGCCTGG - Intergenic
1185648857 X:1634086-1634108 CTGCAGTGAAGGGTGTGGCCAGG + Intronic
1185719901 X:2373228-2373250 CACCTGTGAAGGGTGGGGCCAGG - Intronic
1188385421 X:29551778-29551800 ATGCTGGGAGGGGTGGGGTGGGG - Intronic
1188854294 X:35173547-35173569 AAGCTGTGATGGGAGCAGCCAGG - Intergenic
1188861261 X:35259311-35259333 ATACTGTGTTGGGTGGGACTTGG + Intergenic
1189672101 X:43422395-43422417 AATCTGTGATGGCTGGGGGCAGG - Intergenic
1190131756 X:47754338-47754360 TTGCTGAAATGGGTGGGGTCGGG + Intergenic
1191222353 X:58003041-58003063 ATGCTGAGCTTGGTGGGGCAAGG + Intergenic
1193898687 X:87148073-87148095 ATGCAGTGATGGGATGGGCACGG + Intergenic
1194387853 X:93278703-93278725 ATTCTTTGAGGGGTGGGGGCGGG + Intergenic
1196853812 X:119963900-119963922 ATATTGTGATGTGTGGGGCAGGG - Intergenic
1197570778 X:128147752-128147774 ATACTGTAATGGGTGGTGCCAGG - Intergenic
1198112740 X:133516010-133516032 TTACTGTGTTGGGTGGGGCTTGG + Intergenic
1198546877 X:137701725-137701747 ATTCTGTGATTCCTGGGGCCAGG + Intergenic
1198642385 X:138770673-138770695 ATGCAGAGATGGATGGGGCATGG - Intronic
1199601944 X:149546301-149546323 GTGCTGTGAGTGGTGGGGCTGGG - Intronic
1199648442 X:149933183-149933205 GTGCTGTGAGTGGTGGGGCTGGG + Intronic
1201508665 Y:14733661-14733683 ATGCTTTCATGGGTGGGAACTGG + Intronic
1202099762 Y:21294917-21294939 ATGGTTTTATGGGTGGGTCCAGG - Intergenic