ID: 1129210413

View in Genome Browser
Species Human (GRCh38)
Location 15:74064890-74064912
Sequence CTGCCTGGGTGCCGTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129210405_1129210413 28 Left 1129210405 15:74064839-74064861 CCAGTGGGTTGGAAGGGAGGGGG No data
Right 1129210413 15:74064890-74064912 CTGCCTGGGTGCCGTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129210413 Original CRISPR CTGCCTGGGTGCCGTGGGAG AGG Intergenic
No off target data available for this crispr