ID: 1129217756

View in Genome Browser
Species Human (GRCh38)
Location 15:74110063-74110085
Sequence CTTTTTAAATACATGTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1134
Summary {0: 1, 1: 4, 2: 9, 3: 145, 4: 975}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129217751_1129217756 2 Left 1129217751 15:74110038-74110060 CCTGCCTTGGCCTCCTAAAAGTT 0: 1
1: 23
2: 303
3: 2311
4: 18748
Right 1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG 0: 1
1: 4
2: 9
3: 145
4: 975
1129217752_1129217756 -2 Left 1129217752 15:74110042-74110064 CCTTGGCCTCCTAAAAGTTTCCT 0: 1
1: 0
2: 0
3: 39
4: 330
Right 1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG 0: 1
1: 4
2: 9
3: 145
4: 975
1129217753_1129217756 -8 Left 1129217753 15:74110048-74110070 CCTCCTAAAAGTTTCCTTTTTAA 0: 1
1: 0
2: 11
3: 56
4: 601
Right 1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG 0: 1
1: 4
2: 9
3: 145
4: 975
1129217749_1129217756 21 Left 1129217749 15:74110019-74110041 CCTTGGCTCGAGCAATTCACCTG 0: 1
1: 1
2: 245
3: 6883
4: 74701
Right 1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG 0: 1
1: 4
2: 9
3: 145
4: 975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129217756 Original CRISPR CTTTTTAAATACATGTATTT AGG Intronic
901299239 1:8187017-8187039 ATTTTTTTATACATGAATTTGGG - Intergenic
902913828 1:19623389-19623411 CCTCTTAAATACATTTACTTAGG - Intronic
903106050 1:21081130-21081152 CCTTTTAAAAATATGTACTTGGG + Intronic
903197979 1:21707794-21707816 CTTTCTAAATTCATTTATTATGG - Intronic
903396763 1:23007532-23007554 TTTTTTCAACACATGTATTTTGG - Intergenic
903443315 1:23404487-23404509 CTTTCTAAAAACATGCATTTTGG + Intronic
903803700 1:25989173-25989195 CTGTCTAAATACATGTCTTTGGG - Intronic
904098379 1:28000610-28000632 CTTTTTAAAAACATATTTTCTGG - Intronic
905190583 1:36230707-36230729 CACTGAAAATACATGTATTTAGG + Intronic
905638244 1:39570399-39570421 CTTTTTAAATTTATTTATTTTGG + Intronic
905750745 1:40461424-40461446 CTTTTAAAATACTTTTTTTTTGG + Intronic
905847427 1:41244008-41244030 CTTTTAAAAGACTTGTAATTAGG + Intergenic
906352000 1:45069124-45069146 CTTTAGAAATTCATGTTTTTGGG + Intronic
906398303 1:45485820-45485842 CTTTTTTAATATATAAATTTAGG - Intronic
906421509 1:45672060-45672082 CTTTTTAAAAAGATTTATTCAGG + Intronic
907024523 1:51102833-51102855 CTTTTCTAATATATGCATTTAGG + Intronic
907083058 1:51642696-51642718 CTTTTTACATACAAATATCTAGG + Intronic
907565178 1:55427665-55427687 CTTTTTAAATAAATCTTTTCTGG - Intergenic
907837549 1:58125608-58125630 CTTTTTAAAAAAATGTTTTGCGG + Intronic
908107871 1:60864425-60864447 CTTTTTAAATACATTAATTTTGG - Intergenic
908928024 1:69280313-69280335 ATTTTAAAATAAATATATTTTGG + Intergenic
909255806 1:73419950-73419972 CTTTTTAAATAATTGGATTCAGG + Intergenic
909282490 1:73772187-73772209 CTTTTTGTAAACATATATTTTGG + Intergenic
909453848 1:75828796-75828818 CTTTTTAAAAAAAATTATTTTGG - Intronic
909516463 1:76512957-76512979 CTTTTGAAAAATATCTATTTAGG + Intronic
909768251 1:79385925-79385947 CTTTATAATTACAGGTACTTAGG - Intergenic
909880631 1:80872804-80872826 CTTTTTACAAACATGTATACCGG + Intergenic
910129421 1:83885942-83885964 CCTTTTGAATTCATGGATTTTGG - Intronic
910154021 1:84192862-84192884 ATTTTTAACTAAATGTATTTAGG + Intronic
910187046 1:84555309-84555331 CTTTTTGAATAATTGGATTTAGG - Intronic
910382924 1:86649002-86649024 CGTTTTAAGTACATGAATTCTGG - Intergenic
910454337 1:87380270-87380292 CTTTTTAAATATTTCTTTTTAGG + Intergenic
910704675 1:90115812-90115834 GTTTTTATATAAATTTATTTTGG + Intergenic
910892797 1:92034976-92034998 CTTTATGAATAAATGTATTGAGG + Intronic
910970087 1:92847349-92847371 TTTTTTACATAGATGTATTTAGG - Exonic
911244804 1:95505104-95505126 CTTTTAAAATACCTTTATTTTGG + Intergenic
911355479 1:96813203-96813225 CTTATTAAATACTTGAATTTTGG - Intronic
911667793 1:100573685-100573707 CTTTTTAAAAATATGTTTGTAGG - Intergenic
912114324 1:106386224-106386246 TTATTTAAATACATTTATTCAGG - Intergenic
912329839 1:108808988-108809010 CTTTTCAAATACATTTCTTAAGG + Exonic
912331360 1:108822878-108822900 CTTTTTAAATATGTGTTTGTAGG + Intronic
912686304 1:111769104-111769126 CTTTATAAATTCAAGTAATTTGG + Intergenic
913389802 1:118297964-118297986 CTTATTAAATGCATGGACTTTGG + Intergenic
913402442 1:118450981-118451003 CTTTTCAAATAAATAGATTTTGG - Intergenic
915233614 1:154464465-154464487 TTTTTTAAGTAAATGGATTTGGG + Intronic
915606303 1:156953833-156953855 TGTTTTAAATACATGGATTCTGG + Intronic
915779878 1:158535580-158535602 CTTTTTAAAAATATGTTTTTAGG - Intergenic
916398596 1:164420367-164420389 TTTTTTAAATATGTGTATTGAGG + Intergenic
916671342 1:167023903-167023925 GTTTTTAATTACAGCTATTTTGG + Intergenic
917730830 1:177872918-177872940 ATTTATAAGTATATGTATTTGGG - Intergenic
917808402 1:178634727-178634749 ATTTTTAAATATATCTATCTTGG - Intergenic
918036310 1:180875872-180875894 CTCTTTAAATAAATGTCTTTAGG - Intronic
918207416 1:182321832-182321854 ATTTTTGAATATATGTATTTTGG - Intergenic
918265954 1:182841316-182841338 AAGTTTAAATATATGTATTTGGG + Intronic
918429923 1:184448950-184448972 ATTTAAAAATACATATATTTAGG - Intronic
918484807 1:185017780-185017802 CTTATTAAATATATCTATTTGGG + Intergenic
919100551 1:193092448-193092470 CTTTTCAATTACAGATATTTTGG + Intergenic
919463603 1:197907322-197907344 TTCTTTTAATATATGTATTTAGG - Exonic
919483131 1:198113772-198113794 CTTTTTAAAGTCATATGTTTGGG - Intergenic
919589532 1:199483295-199483317 TTTTTTATATACATGTGCTTTGG + Intergenic
920308611 1:205034708-205034730 CTTGTTAAATGGATGTATGTAGG + Intergenic
920309015 1:205037463-205037485 CTTGTTAAATGAATGTATGTAGG + Intergenic
920327016 1:205173484-205173506 CTTTTAAAAAATATGTCTTTAGG - Intronic
920604008 1:207362195-207362217 CTTTTTAAAGAGATGTGTGTGGG - Intergenic
921111236 1:212039278-212039300 CTTTTTAAAGAGATGAATTTGGG + Intronic
921563102 1:216682076-216682098 CTTGTTAAGAACTTGTATTTCGG - Intronic
921609467 1:217194184-217194206 CTTTTTGAATACATCTATCATGG - Intergenic
921629834 1:217420024-217420046 CTTTTAAAATAAATGTCTTTTGG + Intergenic
921642372 1:217570411-217570433 CCTTTTAAATACATATTTTGGGG - Intronic
921946443 1:220889044-220889066 GATTTTAACTACAGGTATTTGGG + Intergenic
922407173 1:225326879-225326901 TTTTTTAAATCCATGATTTTTGG - Intronic
922479299 1:225927909-225927931 TTTTATATATACATATATTTGGG - Intergenic
922526962 1:226311250-226311272 CTGTTTAAATCAATGTTTTTAGG + Intergenic
922656768 1:227391637-227391659 ATTTTTATATACACGTTTTTGGG - Intergenic
923154005 1:231259717-231259739 CTTCTTCACTACATGTAATTGGG + Intronic
923329141 1:232906556-232906578 CTTATTAAATACGTATATTTGGG + Intergenic
923352528 1:233123273-233123295 GTTTTTTAAAAGATGTATTTTGG - Intronic
923802459 1:237223408-237223430 ATTGTAAAATACATGAATTTTGG + Intronic
924001651 1:239560134-239560156 ATTTTTAAATACCACTATTTAGG + Intronic
924259878 1:242218692-242218714 CTTTTAAAATAAATACATTTAGG - Intronic
1062772152 10:110754-110776 TTATTTAAATAAATGTATTTTGG - Intergenic
1064875151 10:19985505-19985527 CTTATTAAATACATGAAATGGGG + Intronic
1064889492 10:20154070-20154092 TTTCTTAAATACATGGAGTTTGG + Intronic
1064915472 10:20451977-20451999 CTTTTAAAATACAAGGACTTGGG - Intergenic
1065040815 10:21693960-21693982 CTTTTAAAATGAATGTAGTTTGG + Intronic
1065090554 10:22229078-22229100 CTGTTGAAATACATGCATTTCGG + Intergenic
1065769369 10:29063029-29063051 CTTTTTAAAAACAATTTTTTGGG - Intergenic
1066007566 10:31159549-31159571 TTTTTTAAAACCATGAATTTTGG - Intergenic
1066079340 10:31914488-31914510 CTTTTGAAGAACATTTATTTGGG - Intronic
1066593040 10:37016660-37016682 CTTTTTAAAGAAATGAACTTTGG - Intergenic
1067324478 10:45253861-45253883 CTTTTTTAATATATGTACTTAGG + Intergenic
1067520689 10:47000654-47000676 TTTTTTATATATATGTATATAGG + Exonic
1067958535 10:50820998-50821020 CATTTTACAAACATATATTTAGG + Intronic
1068153217 10:53161633-53161655 CTTAATAAATACAGATATTTAGG - Intergenic
1068382718 10:56278421-56278443 CTTCTTTAATATATGAATTTTGG - Intergenic
1069260632 10:66390671-66390693 CTTTTTAGTTTCATGTATGTTGG - Intronic
1069298976 10:66883155-66883177 CTTTTCTCATACATATATTTAGG - Intronic
1070052697 10:72904645-72904667 TTCTTTAAATACTTGTATTATGG + Intronic
1070179678 10:74001317-74001339 CTTTTTAAAAAATTTTATTTTGG + Intronic
1070194713 10:74146631-74146653 TTTTTTGAATATATTTATTTGGG - Intronic
1071058585 10:81541932-81541954 AATTTTATATACTTGTATTTTGG - Intergenic
1071240111 10:83696032-83696054 GTTGTAAAAGACATGTATTTAGG - Intergenic
1071264031 10:83947971-83947993 CTTTTTAAATAGGGTTATTTGGG + Intergenic
1071536546 10:86437274-86437296 GTATTTAAATACATTTACTTTGG - Exonic
1071779529 10:88827523-88827545 GCATTTAAATACATGTATTTTGG - Intronic
1071901730 10:90127827-90127849 CTTTTAAAGTAAATATATTTGGG - Intergenic
1072145245 10:92630154-92630176 TTTTTTAAATTCTTATATTTAGG + Exonic
1072549249 10:96464744-96464766 CTATTTGAAAACATGTATTATGG - Intronic
1072905786 10:99451987-99452009 TTTATTAAATACCTGCATTTAGG - Intergenic
1072988905 10:100170640-100170662 TTTTATTAATACATGGATTTTGG + Intronic
1073655224 10:105407319-105407341 CTTTTTAAAAATATGTTTGTTGG - Intergenic
1073742862 10:106430055-106430077 TTTTTTAAATAATTGTTTTTAGG - Intergenic
1073768976 10:106714556-106714578 CTTTTTAAAAACTTTTATTTTGG - Intronic
1074213331 10:111359376-111359398 CTCTCTATATATATGTATTTTGG - Intergenic
1074278626 10:112029059-112029081 CTTTTTAAAAACACAAATTTGGG - Intergenic
1074579296 10:114702993-114703015 CCTTTTAAATACATAAACTTTGG + Intergenic
1074628591 10:115222633-115222655 CTATTTGAAAACATGTATTCTGG - Intronic
1074641607 10:115389995-115390017 CTTTTAAAAAAAATTTATTTAGG + Intronic
1074664233 10:115700362-115700384 CTTTTTAAAAATATGCATTCTGG + Intronic
1075101752 10:119511016-119511038 TTCTTTAAAAACATGTATTACGG - Intronic
1075368040 10:121910669-121910691 CTTTGAAAATATCTGTATTTAGG + Intronic
1075756554 10:124816718-124816740 CTCAATAAATACATGGATTTGGG - Intronic
1075839952 10:125493122-125493144 ATTGTTAAATACAAATATTTAGG - Intergenic
1076637961 10:131894969-131894991 ATTTTAAAATAAAGGTATTTGGG + Intergenic
1076939954 10:133597724-133597746 TTTTTTAAAAAAGTGTATTTTGG + Intergenic
1077331584 11:1986346-1986368 CTTTTTAAATTGTTTTATTTGGG - Intergenic
1078307005 11:10199366-10199388 CTTTTCCATTATATGTATTTTGG - Intronic
1078875566 11:15391808-15391830 ATTTTTAAATATATTTTTTTGGG + Intergenic
1078995133 11:16689646-16689668 CTTTTTAAATATTTAAATTTAGG - Intronic
1079228478 11:18628870-18628892 TTTTTTAAATACATGGAGCTTGG + Intronic
1079420499 11:20282686-20282708 CTTTTTAAAAATATGTAATATGG - Intergenic
1079667534 11:23125552-23125574 CTTTTTTTATTCATTTATTTAGG - Intergenic
1079670593 11:23165463-23165485 AATTTTCAATACATGAATTTTGG + Intergenic
1079688116 11:23387543-23387565 CTTTTTTTATATATATATTTAGG - Intergenic
1079710312 11:23675242-23675264 CTTATTAAATAAATGTAGCTGGG + Intergenic
1079746217 11:24134010-24134032 ATTTTGAAATACATTTATTTTGG - Intergenic
1079871367 11:25802211-25802233 CTATTTGAATACATTAATTTGGG - Intergenic
1079917475 11:26387710-26387732 CTTTTTATGCACATGTATTTTGG + Intronic
1079961917 11:26934995-26935017 TTTTTTAAATACACTTATATTGG + Intergenic
1080058205 11:27929382-27929404 CTTTTTAATTTCATTTACTTGGG - Intergenic
1080533132 11:33196205-33196227 GTTTTTAAATTTATCTATTTAGG + Intergenic
1080536373 11:33225915-33225937 TTTTTAAAAAACTTGTATTTAGG + Intergenic
1080607296 11:33874279-33874301 ATTTTTTAAAAGATGTATTTTGG - Intronic
1080706432 11:34699461-34699483 CTTTTTATATACATTTTTGTGGG + Intergenic
1080731881 11:34964944-34964966 TTTTTTAAATAGATGTATTCGGG + Intronic
1080908444 11:36571071-36571093 GTATTTAAATAAATGTAGTTTGG + Intronic
1081004973 11:37725206-37725228 CTTTGTAAATATGTCTATTTAGG - Intergenic
1081102342 11:39020554-39020576 CTTTTAAAAGACTTGTAATTAGG - Intergenic
1081123421 11:39293309-39293331 GTTTTTAAATAAATATCTTTTGG + Intergenic
1081137816 11:39460836-39460858 ATTTTTAAATCCCTGTATTCTGG - Intergenic
1081350047 11:42040607-42040629 GTGTTTAAATGCATGCATTTTGG + Intergenic
1082675144 11:56089638-56089660 TTTTTTCTATACATCTATTTTGG - Intergenic
1082677592 11:56126576-56126598 GTCTTTAAATACATTTATTAAGG - Intergenic
1082701246 11:56433780-56433802 CTTTCTAAAAAAATGTATTAGGG - Intergenic
1083100051 11:60293749-60293771 AAATTTAAATGCATGTATTTAGG - Intronic
1083645428 11:64169672-64169694 TTTTTTAAATACATATTTGTTGG - Intergenic
1084137176 11:67193558-67193580 CCTTTTAAATACGTATATATTGG + Intronic
1086455080 11:86953304-86953326 ATTTTTAATTACATGTATCCTGG - Intronic
1086793516 11:91071195-91071217 ATTTTTGAATACATATAGTTAGG - Intergenic
1086825597 11:91491125-91491147 CATTTTAAAGAAATATATTTTGG - Intergenic
1086968027 11:93050459-93050481 CATTTGTAACACATGTATTTTGG - Intergenic
1087337076 11:96857847-96857869 TTTTTAAAATACATGTATACTGG + Intergenic
1087416958 11:97869192-97869214 CATTTCAAATTCATTTATTTTGG + Intergenic
1087445009 11:98239988-98240010 CTTTTTAAAGAGTTGTAATTCGG - Intergenic
1087556994 11:99733617-99733639 ATCTTTAAAAACAAGTATTTTGG - Intronic
1087641490 11:100759785-100759807 TTTTTTAAATGCATATATTGAGG - Intronic
1087720523 11:101660208-101660230 CATTTCAAATTCATTTATTTTGG + Intronic
1087733599 11:101806609-101806631 CTGTTTAGATACAGGGATTTAGG - Intronic
1087851308 11:103033284-103033306 CTTGGTAAAGACATGTTTTTTGG - Intergenic
1088028990 11:105223099-105223121 CTTTTTCAGTACAAGTACTTAGG - Intergenic
1088094966 11:106088378-106088400 CTTTTTAAATGCAGATTTTTTGG + Intronic
1088137219 11:106571207-106571229 CTTTTCTAATATATGTATTGAGG + Intergenic
1088150691 11:106741232-106741254 CTTTTTAAATATTCTTATTTTGG + Intronic
1088205709 11:107389920-107389942 CTTATTAGAAACATGCATTTTGG - Intronic
1088398624 11:109397863-109397885 TTTTTTAAATAGATTTATTGTGG - Intergenic
1088807026 11:113361737-113361759 CTTTTTTCATACATGTGATTGGG + Intronic
1088849265 11:113691837-113691859 TCTTTTAAATACACTTATTTCGG + Intronic
1091271549 11:134315895-134315917 CTTTTTAATTATATGAATTTAGG + Intronic
1202814565 11_KI270721v1_random:41522-41544 CTTTTTAAATTGTTTTATTTGGG - Intergenic
1091662172 12:2392640-2392662 CTTTTTAAACCCAGGTATCTTGG - Intronic
1092296250 12:7201383-7201405 CTTTTAAAATATATGTATATAGG + Intronic
1092652440 12:10648898-10648920 ATTTTTAAATAAAACTATTTAGG - Intronic
1092936511 12:13368833-13368855 CTTATTAACTACATGACTTTGGG - Intergenic
1093063724 12:14634045-14634067 TTTTTTAATTATATGTATTTGGG - Intronic
1093163328 12:15775466-15775488 ATTGTAAAATACATGTAATTTGG + Intronic
1093178577 12:15942124-15942146 CTTTTTAAAAATATGTTTGTTGG + Intronic
1093399804 12:18731993-18732015 TTTTTTAAATCCATTTATTGAGG + Intronic
1093738831 12:22657277-22657299 CTTTTTATATATGTGTACTTTGG - Intronic
1093740729 12:22683431-22683453 CTTTTTAAATAGAGATCTTTAGG + Intronic
1093770816 12:23015652-23015674 TTTTTTAAAAAAATTTATTTTGG + Intergenic
1093820781 12:23615130-23615152 CTTTTTAATTATAACTATTTTGG + Intronic
1093830758 12:23754561-23754583 ATTTGGAATTACATGTATTTAGG - Intronic
1093880324 12:24396709-24396731 CTTTTTTAACACATCCATTTTGG - Intergenic
1094032271 12:26025962-26025984 ATTTTTATATACGTGTATATAGG - Intronic
1095337479 12:41046329-41046351 ATTTTAAAATATATGAATTTAGG + Intronic
1095585153 12:43841643-43841665 TTTTTTAAATACACGCATTTTGG - Intronic
1095684367 12:45015798-45015820 ATTTTTAAAAACATGTTTTTGGG + Exonic
1095840616 12:46687764-46687786 CTTTTTAAAAAAATGTACCTAGG + Intergenic
1096711643 12:53461461-53461483 CTTTTTGAATTACTGTATTTTGG + Intronic
1097293466 12:57940029-57940051 CTTTTTTAATACATAGATTCAGG - Intergenic
1097477014 12:60070468-60070490 ATTTTAAAATAAATGAATTTTGG - Intergenic
1097724846 12:63063710-63063732 CTTTTTAAAGATATGTTTTAGGG + Intergenic
1097791971 12:63824683-63824705 CTTTTAAAATACATATATTAAGG + Intergenic
1098074293 12:66711246-66711268 CTTTTTAAATGGATGCTTTTAGG - Intronic
1098110447 12:67116024-67116046 CTTTTTAAATACATATTATAGGG - Intergenic
1098417480 12:70252113-70252135 CTCTTTAAAAACATTAATTTAGG - Intronic
1098522100 12:71443920-71443942 TTTTTTAATTATATGTAGTTTGG + Intronic
1098734419 12:74081244-74081266 TATATTAAATAAATGTATTTAGG + Intergenic
1099131440 12:78837621-78837643 CATTTTAAAAACTTGTCTTTTGG - Intergenic
1099323003 12:81175356-81175378 CTTTTTTAATATATTTAATTTGG - Intronic
1099547554 12:84004490-84004512 CATTTTAATTTCATTTATTTTGG + Intergenic
1099692334 12:85973297-85973319 CTTTATATATGCATTTATTTTGG + Exonic
1099810374 12:87574135-87574157 ATATTTAAGTACATGTGTTTAGG - Intergenic
1099968774 12:89479024-89479046 CATTTGAAATACATGTATGTAGG - Intronic
1099980239 12:89591845-89591867 CATTTTATAGACATTTATTTGGG - Intronic
1100103535 12:91140355-91140377 TTTTTTAAATCCCTGTGTTTTGG - Intergenic
1100246824 12:92766539-92766561 CTTTTTAAAAACATGCTTCTGGG + Intronic
1100252957 12:92849195-92849217 ATTTTAAAATAAATGTATTATGG - Intronic
1100320891 12:93491189-93491211 CTTTTTAAAAATGTGTGTTTTGG - Intronic
1100447199 12:94671904-94671926 CTCTTTAAATATATTTATTTAGG - Intergenic
1100733490 12:97499989-97500011 CTTTTTAAAAACATGCATGAGGG - Intergenic
1100803716 12:98259564-98259586 CTTTTTAGAAACTTGTGTTTGGG - Intergenic
1101122750 12:101600035-101600057 CTTTTTAAAGTGATATATTTAGG - Intronic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1102223219 12:111208948-111208970 CTTTTTAAATACACTTATTTAGG + Intronic
1102589171 12:113944396-113944418 CTTTTAAAATGCATGCATCTGGG - Intronic
1103068482 12:117920027-117920049 GATTTTAATTTCATGTATTTTGG - Intronic
1103669846 12:122604490-122604512 CTTTTCAAGAAAATGTATTTTGG - Intronic
1104140159 12:125979997-125980019 TTTGTTTAATACATGTATATTGG - Intergenic
1104318467 12:127726507-127726529 CATTTTACCTACATGAATTTTGG - Intergenic
1104418376 12:128614679-128614701 CATTTGAGATATATGTATTTTGG - Intronic
1105270732 13:18873005-18873027 CTTTTTAAATCCATTTTTATTGG + Intergenic
1106011067 13:25823859-25823881 TTTTTAAAATACATCTTTTTGGG + Intronic
1106156674 13:27164596-27164618 CAGTTTATATACATTTATTTAGG - Intronic
1106292551 13:28378388-28378410 TGTTTTAAATACATGTTTATTGG + Intronic
1106374059 13:29166873-29166895 TTTTTAAAGTAAATGTATTTCGG + Intronic
1106634722 13:31515877-31515899 TATTTTAAATTCATGTATGTTGG + Intergenic
1106829079 13:33558996-33559018 CTTTTCAATTTCATGTTTTTAGG + Intergenic
1106982762 13:35308675-35308697 ATATTTAAATATATATATTTGGG - Intronic
1106985489 13:35343206-35343228 TATTTGAAATACATGAATTTAGG - Intronic
1107084274 13:36408831-36408853 CTGATAAAACACATGTATTTGGG - Intergenic
1107167016 13:37294369-37294391 CTTTCCAAATAAATGTATTGAGG - Intergenic
1107320307 13:39179273-39179295 GTTTTTAAATCCATAGATTTAGG + Intergenic
1107406516 13:40119296-40119318 CTTTTTCATTGCATGTATATAGG - Intergenic
1108045434 13:46379383-46379405 CTTTTTAAAATAACGTATTTTGG + Intronic
1108101041 13:46956109-46956131 ATTTTTAAAATCATGTTTTTTGG + Intergenic
1108195129 13:47985995-47986017 CTTTTTAATCACATGTGTGTTGG + Intronic
1108387055 13:49908763-49908785 CTTTTTATATATATGTAAGTAGG - Intergenic
1108886463 13:55190255-55190277 TTTTTGTAATACATGTACTTGGG - Intergenic
1109045940 13:57410471-57410493 CTTTTTAAAAACAGCTATTTTGG - Intergenic
1109294939 13:60518597-60518619 CTTTGTAAATACATGTAAAAAGG + Intronic
1109330851 13:60927851-60927873 CTTATCACATTCATGTATTTAGG - Intergenic
1109407151 13:61917215-61917237 CTTTTTAAAAACAGGTTTTCAGG + Intergenic
1109416685 13:62049911-62049933 TTTTATAAATAAATGTATTTGGG - Intergenic
1110033071 13:70642779-70642801 CTTTTTAAATACCAGATTTTGGG - Intergenic
1110084113 13:71355500-71355522 ATTTTAAAATACATGTAATACGG - Intergenic
1110099056 13:71572811-71572833 CTTTTTTTATACAATTATTTTGG - Intronic
1110232852 13:73184606-73184628 CTTTTAAAATATATGTATTTTGG + Intergenic
1110240070 13:73257051-73257073 GTATTTAAATTCATGTAATTTGG - Intergenic
1110309296 13:74029193-74029215 CTTTTTAAAGACTGGTATTTGGG - Intronic
1110447323 13:75600686-75600708 CTTTGTAAATATATCTATATCGG - Intronic
1110495907 13:76167705-76167727 CATTTGAAATACAATTATTTTGG - Intergenic
1110532022 13:76609019-76609041 TTTTTGAAATCCATGTATTAGGG + Intergenic
1110764942 13:79272200-79272222 ATTTTAACATAAATGTATTTAGG - Intergenic
1110821012 13:79916301-79916323 CATTTTAAATTCATATATTAGGG - Intergenic
1110877807 13:80532044-80532066 CATTTTAAATACATTTATATGGG - Intergenic
1110923687 13:81122579-81122601 ATTTTTACAAACATGCATTTTGG + Intergenic
1110948630 13:81456459-81456481 CTTATCAAATATATGTTTTTAGG - Intergenic
1111316309 13:86565268-86565290 CTGTTTATATACATATATTTGGG + Intergenic
1111550128 13:89798278-89798300 GTTTTTTAATATATGTTTTTTGG + Intergenic
1111719379 13:91922231-91922253 CTTTAAAAATATAAGTATTTTGG + Intronic
1111992775 13:95133414-95133436 TTTTTTAAAAAAATGTTTTTAGG - Intronic
1112248932 13:97760651-97760673 CTTTAGAAACACATCTATTTAGG + Intergenic
1112542359 13:100327920-100327942 CTTGTTCAATATATGTATTGTGG + Intronic
1112597669 13:100823389-100823411 CTTTTTAAATGAATCTTTTTTGG + Intergenic
1112751047 13:102583541-102583563 ATTTTTAAAAATATGTATTGAGG - Intergenic
1112752173 13:102594641-102594663 TTTTTTAAAAACATGTTTATGGG + Intergenic
1112785493 13:102947037-102947059 CTTATTAACCACATGCATTTGGG + Intergenic
1112963629 13:105159727-105159749 GTTTTAAAATATTTGTATTTAGG - Intergenic
1113196730 13:107816951-107816973 CTTTTTATACATATGGATTTTGG + Intronic
1113199780 13:107854569-107854591 CTTTTTAAAAAGACCTATTTGGG + Intronic
1113281007 13:108787734-108787756 CTTGTTAAATACATGTTTGCTGG + Intronic
1113448676 13:110390072-110390094 CTTTTTGAATAAATGAATTGAGG - Intronic
1113506431 13:110820190-110820212 GTTTATAAATACAAGTATATAGG - Intergenic
1113986722 13:114322953-114322975 TTTTTTAAATTCATGTTTTCCGG + Intronic
1114039796 14:18667051-18667073 CTTTTCTAATAAATGTATTTTGG - Intergenic
1114044837 14:18865601-18865623 GTTTTCTAATAAATGTATTTTGG - Intergenic
1114119386 14:19653921-19653943 GTTTTCTAATAAATGTATTTTGG + Intergenic
1114171327 14:20274814-20274836 GTTTTTTAATAAAAGTATTTAGG - Intronic
1114975855 14:28098495-28098517 ATTTTTAAATACTTTTAATTTGG + Intergenic
1115484694 14:33898961-33898983 ATCTCTAGATACATGTATTTTGG - Intergenic
1115730785 14:36267281-36267303 CATTTTAGACACTTGTATTTGGG + Intergenic
1115954407 14:38762053-38762075 CTTTTGAAAGACATAAATTTGGG - Intergenic
1116341444 14:43728227-43728249 CATTTTAAATATATATATATAGG + Intergenic
1116532094 14:45984910-45984932 CTTTTTAAATGGAGGTGTTTTGG + Intergenic
1116779938 14:49225833-49225855 ATTTTTAATTACATATCTTTTGG - Intergenic
1117128448 14:52658192-52658214 CTTTTGAAAAACTTGTATTTTGG - Intronic
1117603237 14:57397465-57397487 TGGTTTAAAAACATGTATTTGGG + Intronic
1118008761 14:61589140-61589162 TTTTTTAAAAACAGGGATTTGGG - Intronic
1118014172 14:61641593-61641615 TTTGTTAAATAAGTGTATTTTGG - Intronic
1118083098 14:62384890-62384912 GTTTTTAAAAAAATATATTTTGG + Intergenic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1119035218 14:71224233-71224255 CTTTGTGAATATATGTATTTTGG + Intergenic
1119215626 14:72867024-72867046 CTGTTGAAATACCAGTATTTGGG - Intronic
1119335287 14:73828328-73828350 TTTTTTATATATATGTATTTAGG + Intergenic
1119373488 14:74168158-74168180 CTTTTCAACTACATGAATTAAGG + Intronic
1120593263 14:86401823-86401845 ATTTTTAAATAAATGAATATTGG + Intergenic
1121082416 14:91119076-91119098 CTTTTTGAGCAAATGTATTTTGG - Intronic
1121182234 14:91937909-91937931 CTTTAAATATACATTTATTTGGG - Intronic
1121268074 14:92617311-92617333 ATTTTTAAATTTATTTATTTTGG - Intronic
1121292483 14:92787703-92787725 CCTTGTAAATAAATGTCTTTGGG + Intergenic
1121352808 14:93186783-93186805 CTTTTTAAAAACATGTGATTAGG + Exonic
1121382520 14:93485894-93485916 CTTTTTACATAAAGGAATTTGGG - Intronic
1121475209 14:94194179-94194201 CTAGTTAAATAAATGAATTTAGG - Intronic
1121810007 14:96877029-96877051 CTTTTTAAAAAAATGTATTGTGG - Intronic
1202871029 14_GL000225v1_random:164124-164146 GTTTTCAAATACATGTGTTTAGG - Intergenic
1123640176 15:22396831-22396853 CCTTTTAAATAGATATAGTTTGG + Intergenic
1123856590 15:24417926-24417948 TTTTTTAAATAAATGGATTCTGG - Intergenic
1123912455 15:24981577-24981599 GTTTTTAAATGCATGTTTTCCGG + Intergenic
1123957736 15:25356994-25357016 CATTTAAAATATATGTAATTAGG + Intronic
1124082895 15:26517716-26517738 CTTTTTAAACGCACGTTTTTGGG + Intergenic
1124111799 15:26796739-26796761 CTTTTAGAAAACATTTATTTGGG + Intronic
1124648498 15:31457555-31457577 CTTTATAAAAACATCTCTTTGGG + Intergenic
1125202179 15:37109904-37109926 CTTTTTAAAAAAATGCCTTTAGG + Intergenic
1125251514 15:37710488-37710510 ATGTTTAAATACTTGTAATTAGG + Intergenic
1125995598 15:44156899-44156921 ATTTTTATATATATATATTTTGG - Intronic
1126188060 15:45849890-45849912 CTTTTTAAAGAGAGGTTTTTGGG - Intergenic
1126323502 15:47449841-47449863 CTTATTATAAATATGTATTTAGG - Intronic
1126667138 15:51085632-51085654 TTTTTTAATTACATGTTTTGGGG + Intronic
1127428477 15:58879096-58879118 TTTTGTAAATACTTGTATGTGGG - Exonic
1127660699 15:61097703-61097725 TTTTTAAAATACATCTATCTGGG + Intronic
1128102672 15:65016355-65016377 CTTTCTAAATATTTTTATTTAGG - Intronic
1128365560 15:66998985-66999007 GTTTTTAAAAAAATGTATTCTGG - Intergenic
1129032142 15:72627171-72627193 CTTTTTAAATACATTTATTTAGG - Intergenic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1129406910 15:75325911-75325933 CTTTTTAAATACATTTATTTAGG - Intergenic
1129447370 15:75628046-75628068 CCTTTTAAATAAATGTAGTCAGG - Intergenic
1129470111 15:75748775-75748797 CTTTTTAAATACATTTATTTAGG - Intergenic
1129484358 15:75855137-75855159 CTATTTAAACACATGTATAAAGG - Intronic
1129734913 15:77954361-77954383 CTTTTTAAATACATTTATTTAGG + Intergenic
1129840678 15:78741635-78741657 CTTTTTAAGTACATTTATTTAGG - Intergenic
1129864506 15:78894706-78894728 CCTTTAAAATACATGATTTTAGG - Intronic
1130410771 15:83646442-83646464 TTATTTTAAAACATGTATTTGGG + Intergenic
1131267904 15:90929241-90929263 CTTTTTAAATCAATTTAATTTGG - Intergenic
1131464016 15:92640199-92640221 TTTTTTAAAAAAATGGATTTTGG - Intronic
1132125054 15:99215912-99215934 CTTTTAAAAAATATTTATTTGGG - Intronic
1132459632 16:45035-45057 CTTTGTAAATATTTGTCTTTTGG - Intergenic
1132819093 16:1853267-1853289 CTTTTTAAACAAATGCAGTTGGG - Exonic
1133988557 16:10687443-10687465 CTGTTTAAATAAGAGTATTTAGG + Intronic
1134133180 16:11663517-11663539 CTTTTTAAATCAGTGTGTTTGGG - Intergenic
1135193188 16:20371844-20371866 CTTGTTAAATATATGTCTTGGGG - Intronic
1135246200 16:20859389-20859411 CTGTTTACATAGATGAATTTAGG - Exonic
1135354302 16:21756897-21756919 ATTTTTAAATGCATTTACTTTGG + Intronic
1135452793 16:22573037-22573059 ATTTTTAAATGCATTTACTTTGG + Intergenic
1136145819 16:28316063-28316085 CTTTTTCAAAAATTGTATTTAGG - Intronic
1136925454 16:34368638-34368660 CCTTTTAAAAACATGTATTCAGG - Intergenic
1136932862 16:34434961-34434983 CTTTTTAAATACTGGTTTGTGGG + Intergenic
1136971710 16:34976853-34976875 CTTTTTAAATACTGGTTTGTGGG - Intergenic
1136979120 16:35043168-35043190 CCTTTTAAAAACATGTATTCAGG + Intergenic
1137355038 16:47754045-47754067 CTTTTGAAATGCATGTAGTCAGG - Intergenic
1137946166 16:52735076-52735098 CTTTTTAAATGCTTGTCTGTAGG + Intergenic
1139214962 16:65118883-65118905 CATTCTCAATACATGTATGTAGG - Intronic
1139719044 16:68838125-68838147 AGTTTTAAAAACATGTATTCTGG + Intergenic
1139799347 16:69508917-69508939 CTATTTAAAAACATTTTTTTTGG + Intergenic
1139971665 16:70780238-70780260 CTTTTTAAAGGCACTTATTTGGG + Intronic
1140609638 16:76582581-76582603 GTTATTAAATATATGCATTTTGG + Intronic
1140646985 16:77042646-77042668 CTTTTTCAATGGATGTAGTTAGG - Intergenic
1140668634 16:77251641-77251663 TTTTCTAAATACAAGTATCTGGG - Intronic
1140710141 16:77670171-77670193 AGTTTCAAATATATGTATTTGGG - Intergenic
1140784809 16:78330357-78330379 CTCTTTAAACACATTAATTTAGG - Intronic
1141101340 16:81199640-81199662 TTTTTTAATTACAAATATTTAGG - Intergenic
1141420009 16:83908384-83908406 TTTTTTAAATAAATGGTTTTGGG + Intronic
1141681605 16:85547490-85547512 CTTTTAAAAAACATGTTTTTGGG + Intergenic
1141925136 16:87163369-87163391 ATTTTTAAAAAAATCTATTTAGG + Intronic
1143075694 17:4340878-4340900 TTTTTTAAATACGTGAATTAAGG - Intronic
1143735364 17:8908502-8908524 TATTTTAAATACATGTGATTTGG - Intronic
1143739096 17:8939824-8939846 CTTTTGATATTCATGTATTCTGG + Intronic
1144934890 17:18889504-18889526 CTTTGAAATTACATGTAATTAGG + Intronic
1145368190 17:22282758-22282780 CTTCATAAATGCATGAATTTGGG - Intergenic
1146384996 17:32363124-32363146 CTTTTTTAAAAAATGTATTTTGG + Intronic
1146431933 17:32805405-32805427 CTCAGAAAATACATGTATTTTGG - Intronic
1146549491 17:33768304-33768326 CTTTTTAAAAAAATGTATATGGG - Intronic
1147010959 17:37447454-37447476 CTTTTTAAAAGCATTCATTTAGG - Intronic
1147219766 17:38921485-38921507 CTTTTTAAATACAGGTTTGTAGG - Exonic
1147509840 17:41058584-41058606 TTTGTTAAATACTTGTATGTTGG - Intergenic
1148033474 17:44639440-44639462 CTTTTTTTATGCAGGTATTTTGG - Intergenic
1148262500 17:46195402-46195424 ATTTTTAAAACCATGTATTTGGG + Intronic
1149458115 17:56805919-56805941 TTTTTTAAATGCCTGTCTTTGGG + Intronic
1149876964 17:60244540-60244562 CTTTTTAAATAAAACTATTTTGG + Intronic
1150121337 17:62605702-62605724 CTGTTAAAATTCATATATTTTGG + Intronic
1150197084 17:63310663-63310685 TTTTTTAAAAACATGTGTATTGG - Intronic
1151103512 17:71584516-71584538 CTTTTTAGAAATATTTATTTAGG + Intergenic
1153084358 18:1266937-1266959 CTTTTTAATAACATTTCTTTTGG - Intergenic
1153390301 18:4550165-4550187 CTTTTGAAAAACAAATATTTTGG + Intergenic
1153455459 18:5276755-5276777 TTTTTTAAATAAATGTATTGTGG + Intergenic
1153802965 18:8687417-8687439 CATTTTAATTGCATGTTTTTCGG + Intergenic
1153813007 18:8768288-8768310 CTAGTTAACAACATGTATTTTGG - Intronic
1154417314 18:14186948-14186970 CTTTTTAAATCCATTTTTATTGG - Intergenic
1154972544 18:21425130-21425152 TTTTTTAAATATATATATTTGGG + Intronic
1155086221 18:22460922-22460944 CTGCTCAAATACATGTCTTTGGG + Intergenic
1155330389 18:24709897-24709919 CTTCCTCAATACATGTATGTTGG - Intergenic
1155409665 18:25529840-25529862 ATATGTAAATACAAGTATTTTGG + Intergenic
1155619205 18:27756919-27756941 CTTTTAAAATGCTTGTAGTTTGG + Intergenic
1155682523 18:28506230-28506252 CTTTTAAATTACAAGTATGTTGG - Intergenic
1155744770 18:29340808-29340830 CTTTTTAAAATAATATATTTGGG - Intergenic
1155912073 18:31515566-31515588 CTTTGAAAATACATAAATTTGGG + Intronic
1156636229 18:39032695-39032717 CTTTTTACTTACCTGTGTTTTGG - Intergenic
1156936847 18:42719648-42719670 CTTTTAAAACAGATGTATTGAGG + Intergenic
1157093586 18:44664792-44664814 ATTTTTAATTATATATATTTGGG - Intergenic
1157341985 18:46787137-46787159 CTTTCTAAATTCAGGTAATTTGG + Intergenic
1158838861 18:61361477-61361499 CTTTTGAAATACATGTATAAGGG + Intronic
1159153315 18:64549037-64549059 TTTTTTAATTAAATTTATTTGGG + Intergenic
1159246945 18:65818813-65818835 CATTTAAAATACATGTAGTTTGG - Intronic
1159272878 18:66175591-66175613 CTGTTTCAATATATGAATTTTGG + Intergenic
1159443507 18:68511058-68511080 GTTTTTAAATACATGAACTTTGG - Intergenic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1159652343 18:70992401-70992423 ATTTTAAAATACATGTGTATAGG + Intergenic
1159825937 18:73210379-73210401 CTTTTTAAAAATATGTTTGTGGG - Intronic
1160055868 18:75479834-75479856 CTTTTTGAATGCATATTTTTTGG + Intergenic
1160217766 18:76948120-76948142 TTCTTAAAATACATGTTTTTGGG + Intronic
1160358951 18:78254004-78254026 CTTCATAAATAAATGTATATAGG - Intergenic
1160370253 18:78366117-78366139 CTTTATAAAAACATATATTAAGG - Intergenic
1161514028 19:4686712-4686734 TTCTTTAAATAAATGTATGTAGG + Intronic
1161726398 19:5931697-5931719 TTTTTTAAATCCAAGAATTTTGG - Intronic
1161991715 19:7688060-7688082 CTTTTTAAATTTATTTAGTTGGG + Intergenic
1162137653 19:8565651-8565673 CTTTTTCTAAACAGGTATTTGGG + Intronic
1162581513 19:11533996-11534018 CTTTTTAAAAAAGTGCATTTTGG - Intergenic
1163872574 19:19834686-19834708 ATTTTTTTACACATGTATTTTGG + Intergenic
1164778136 19:30870644-30870666 CTTCTTAAGTATATGTAGTTAGG + Intergenic
1165561616 19:36685316-36685338 CTAGTTAAATAAATGTATGTAGG + Intergenic
1165897186 19:39149554-39149576 CTTTTAAAATATATGTATATAGG + Intronic
1166080407 19:40440850-40440872 TTTTTTAAATAAAAGTATTTTGG - Exonic
1166330817 19:42077005-42077027 TTTTTTAAGTACAGGTAATTAGG + Intronic
1167734444 19:51283491-51283513 CTTTTTCAGTATTTGTATTTAGG + Intergenic
1168552089 19:57304735-57304757 ATCTTTGTATACATGTATTTTGG - Intergenic
1168676507 19:58281809-58281831 CTTTTAAAATTGAAGTATTTGGG + Intronic
925019835 2:559626-559648 ATTCTTACATCCATGTATTTTGG + Intergenic
925083378 2:1088156-1088178 CTATTAAATTACTTGTATTTTGG - Intronic
925111081 2:1338216-1338238 CTATTTAAAAAAATGTCTTTGGG + Intronic
925558380 2:5158457-5158479 CTCTTTAAATATAAATATTTAGG + Intergenic
925774224 2:7317460-7317482 ATTTTTAAAATCATGAATTTTGG - Intergenic
925860120 2:8166667-8166689 CTCTTTAATAAAATGTATTTGGG - Intergenic
925970616 2:9104150-9104172 CTTGTGACATACCTGTATTTAGG - Intergenic
926493990 2:13561332-13561354 TATTTTAAATACATGTTTTGAGG + Intergenic
926517134 2:13861601-13861623 TTTCTTAAATACCTGTTTTTGGG - Intergenic
926611027 2:14947300-14947322 ATTTTTAATTTTATGTATTTGGG - Intergenic
926788378 2:16543454-16543476 CTTTTTAAACAGATTTATTGAGG - Intergenic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
928283258 2:29966842-29966864 GTTCTTAAATAGATGTAGTTGGG - Intergenic
928638574 2:33274076-33274098 TTTGCTAAATACATGTTTTTAGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929104634 2:38352232-38352254 TTTTTAAAACACAGGTATTTGGG + Intronic
929170190 2:38924643-38924665 TTTTCTAAATCCATGAATTTAGG + Intronic
929422038 2:41801544-41801566 TTTTTTGTATACAAGTATTTTGG + Intergenic
929477547 2:42267019-42267041 ATGTTTAAACACATGGATTTTGG + Intronic
929985058 2:46721688-46721710 ATTTGTAACTACATATATTTTGG - Intronic
930284230 2:49408079-49408101 CTTTTTAAATTCATTTTGTTGGG + Intergenic
930468313 2:51781058-51781080 ATTTTTAAACACACGCATTTTGG + Intergenic
930787503 2:55284898-55284920 CTTTTTAAAAAGATGTATGGAGG + Intergenic
930974136 2:57433884-57433906 ATTTATAAATACAAGTTTTTTGG - Intergenic
931087814 2:58852915-58852937 TTTTTTAATTTCATGTATTTAGG - Intergenic
931397547 2:61901245-61901267 TTTTTTAAAAAAATGTGTTTTGG - Intronic
931544352 2:63365000-63365022 CTTTGTAAATACAGTTCTTTTGG - Intronic
931594010 2:63920884-63920906 TTGTTTAACTACATATATTTAGG + Intronic
931621810 2:64218080-64218102 CTTTTTAAAAACGGGTATCTGGG + Intergenic
931955233 2:67416950-67416972 CTTTTTAAATAAATGACTTTTGG - Intergenic
932037091 2:68256459-68256481 CTTTTTGAATTAATGCATTTGGG + Intronic
932545959 2:72709968-72709990 ATTTTTAAATAAACTTATTTTGG - Intronic
933001344 2:76927551-76927573 TTTTTTACATACATGACTTTTGG - Intronic
933399837 2:81781544-81781566 TTTTTTAAATACTTTTTTTTTGG + Intergenic
933807105 2:86007285-86007307 CTTTTGAAAAACATCTATTCAGG - Intergenic
934927877 2:98394326-98394348 CTTTTAAAATATATGAAGTTCGG - Intronic
935049373 2:99511310-99511332 CTTCTTAAAAAGATGTATGTTGG + Intergenic
935343932 2:102086552-102086574 GATTTTAATTACATATATTTTGG + Intronic
935440511 2:103089784-103089806 CTTTTTAAAAATATGCTTTTTGG + Intergenic
935467762 2:103419235-103419257 ATTTTTTAATATATATATTTTGG + Intergenic
935680234 2:105629548-105629570 CTTTTCAAATAAAAATATTTGGG + Intergenic
935864547 2:107372134-107372156 CTTTTTCAATTAATATATTTTGG + Intergenic
936229332 2:110686229-110686251 CATTTTAAATATATCCATTTTGG - Intergenic
936777500 2:115992142-115992164 ATTTTTAAAGACATGTTTTGTGG + Intergenic
936780467 2:116026905-116026927 CTTGATAAACTCATGTATTTTGG - Intergenic
936815208 2:116452198-116452220 TTTTTTAAATATATGTTTGTTGG - Intergenic
936841492 2:116774566-116774588 CTTTTAAAACTCTTGTATTTAGG + Intergenic
937072060 2:119072017-119072039 ATTTATAAATACATGTATTGGGG - Intergenic
937175799 2:119933287-119933309 CTTATAAAATACTTGAATTTTGG + Intronic
937532876 2:122851635-122851657 TTTTTTAAAAATATGTATTTGGG - Intergenic
937878140 2:126841285-126841307 CTATATAACTACATGTTTTTTGG - Intergenic
938270757 2:129968556-129968578 GTTTTCTAATAAATGTATTTTGG + Intergenic
938700706 2:133876584-133876606 CCTTTTAAATACATATAGTTTGG + Intergenic
939014903 2:136891521-136891543 CTTTTTAAACCACTGTATTTGGG - Intronic
939029373 2:137052950-137052972 CTTGTTATTTACATGTTTTTTGG + Intronic
939177869 2:138770983-138771005 TTTTTTAAATACCAGTATTCAGG + Intronic
939297383 2:140285762-140285784 CTTTCTAAATAAAAGTATCTGGG - Intronic
939370539 2:141293703-141293725 CTTTTTACTTAAATGTATTCTGG - Intronic
939466597 2:142563776-142563798 ATTTTTAAATAAATCTTTTTGGG + Intergenic
939538255 2:143460713-143460735 CTTTTAAACAACATGTATGTGGG + Intronic
939664892 2:144939104-144939126 CCTTTTAAATAAAACTATTTGGG - Intergenic
939676924 2:145084193-145084215 CTTTTTAAAAAAATTTATGTTGG + Intergenic
939764909 2:146235613-146235635 GTTTTCAAATACAGGTATTTAGG + Intergenic
939849858 2:147291489-147291511 CTTTCTAAATATATGTTTTCTGG - Intergenic
939859518 2:147401192-147401214 TTATTTATATGCATGTATTTAGG - Intergenic
940038497 2:149334138-149334160 CTTTTTCATTACATGTATCCAGG - Intronic
940201806 2:151159727-151159749 CTTTATAAAGACATTTAGTTTGG - Intergenic
940269824 2:151878094-151878116 GTTTATAAATATATATATTTTGG - Intronic
940461147 2:153964818-153964840 CTTTTTAAATTAATATATTATGG + Intronic
940596395 2:155798715-155798737 TTTTTTAAATTCTTCTATTTAGG + Intergenic
940928647 2:159398278-159398300 TATTTTAACTTCATGTATTTGGG - Intronic
940934748 2:159478821-159478843 ATTTCTAAATACATGTTCTTTGG + Intronic
940963182 2:159808703-159808725 GTTTTTAAAAACTGGTATTTAGG + Intronic
941101815 2:161305096-161305118 CTTTGTATATACATACATTTTGG + Intergenic
941592319 2:167435478-167435500 CTTTTTAAATACTGGGAGTTAGG + Intergenic
941764913 2:169286079-169286101 CTCTTTAAATACATGACGTTAGG - Intronic
942240629 2:173961662-173961684 GTTTTTAAATAATTGTATTTTGG - Intronic
942746266 2:179236840-179236862 CTATTTACATACATTTATTTTGG - Intronic
942752790 2:179306908-179306930 CTATTTAAATACATACATTATGG + Intergenic
943058698 2:183015226-183015248 GTTTTAAAATAGATGTGTTTTGG + Intronic
943094754 2:183416031-183416053 CTTCAGAAATACATGTATTATGG - Intergenic
943138950 2:183953908-183953930 CTTTTTAAAAAAAATTATTTTGG + Intergenic
943361661 2:186926117-186926139 ACTTTTAAATACATGTAATGAGG + Intergenic
943575051 2:189621956-189621978 GTTTTTTAATACATGTATTTTGG + Intergenic
943750890 2:191508349-191508371 ATTATTTAAAACATGTATTTTGG - Intergenic
943862320 2:192883312-192883334 CTGGTTAAATACATGTCCTTTGG + Intergenic
943879217 2:193117618-193117640 CTTTTTAATTACATATAGTTGGG + Intergenic
943908967 2:193538775-193538797 CTTTTTTAATATTTGAATTTTGG + Intergenic
943924496 2:193755580-193755602 TTTTTTAAATAAATGTCATTTGG + Intergenic
943993322 2:194726481-194726503 GTTTTTAAAAACATATAATTGGG + Intergenic
944519611 2:200551548-200551570 CCTTTTAAAAAAATGTATTGAGG - Intronic
944765484 2:202860437-202860459 CTTTTAAATTACATGCATTTGGG - Intronic
945411195 2:209510120-209510142 CTTTTTAAAAAAATGTGTATTGG + Intronic
945439150 2:209858405-209858427 CTTATTAAAAGCATGTATTTGGG + Intronic
945905238 2:215585864-215585886 CTTTTAAAATCCAGTTATTTTGG - Intergenic
945918770 2:215732944-215732966 CCTATTAAATAGATGTATCTTGG - Intergenic
946254537 2:218433133-218433155 CTTTAGAAATACGTGTAATTGGG + Intronic
946524697 2:220505873-220505895 CTTTGTAACCACATGAATTTGGG + Intergenic
946801594 2:223423162-223423184 GATTTTAAACTCATGTATTTTGG + Intergenic
946976607 2:225159929-225159951 CTCATTAGATAAATGTATTTGGG + Intergenic
947071769 2:226295761-226295783 TTTTTTAAGTCCCTGTATTTGGG + Intergenic
947224592 2:227827603-227827625 TTTTCTAAATACATGTTTTCAGG + Intergenic
947569713 2:231223216-231223238 CTTTTTAAATAACTTTATTGAGG + Intronic
947834893 2:233168206-233168228 CTATTGAAATAATTGTATTTTGG - Intronic
948312747 2:237001132-237001154 CATTTTAAATACATATGTTTTGG - Intergenic
1169556176 20:6752607-6752629 TTTTTTAAATAAATATATCTTGG - Intergenic
1169930017 20:10822491-10822513 CATATTAACTACATGTATTCAGG - Intergenic
1170679247 20:18510267-18510289 GTGTTTAACTACATGTAGTTTGG + Intronic
1170691490 20:18619852-18619874 CTTTTTAAATAAATAGTTTTGGG - Intronic
1171058654 20:21933850-21933872 TTTTTTAAATAGATGTTATTGGG - Intergenic
1172658696 20:36551879-36551901 CTTATTAAGTGTATGTATTTTGG - Intergenic
1173334181 20:42099610-42099632 CTTTTCAAATACATGACTTCAGG - Intronic
1174016389 20:47491870-47491892 CTTTTTTAAAAAATGAATTTGGG + Intergenic
1174454114 20:50637559-50637581 CTTTTTAAAAAAAAGTTTTTGGG + Intronic
1174832069 20:53822341-53822363 CTTTTAAATTAAAAGTATTTAGG + Intergenic
1175459814 20:59144087-59144109 TTTTTTAAAATCATGTAATTTGG + Intergenic
1175675716 20:60945171-60945193 CTCTTTCAATACATAGATTTTGG + Intergenic
1176137983 20:63533375-63533397 CTTTTATAATAAATGTATTTAGG + Intronic
1176856008 21:13972312-13972334 CTTTTTAAATCCATTTTTATTGG + Intergenic
1176961127 21:15160199-15160221 CTTTTATAATCCATGTATTTTGG + Intergenic
1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG + Intergenic
1176985257 21:15428640-15428662 CTTGTCATATACATGCATTTAGG - Intergenic
1177404910 21:20653878-20653900 ATTTTTAAATATCTGTATGTAGG + Intergenic
1177533333 21:22392652-22392674 TATTTTAAATCCATATATTTTGG - Intergenic
1178066183 21:28907048-28907070 AGTTTTCAATACATGAATTTGGG - Intergenic
1178181908 21:30171179-30171201 ATTTTTAATAATATGTATTTTGG - Intergenic
1178569820 21:33725802-33725824 CTTTTCAAAGACATTTCTTTTGG - Intronic
1178835011 21:36089553-36089575 CTTCATAAAGACTTGTATTTGGG - Intergenic
1179209148 21:39311453-39311475 CTTTTAAAATACATTTATAGGGG - Intronic
1180121859 21:45757397-45757419 TTTTTTAAATATATATATTCTGG + Intronic
1180463360 22:15588161-15588183 GTTTTCTAATAAATGTATTTTGG - Intergenic
1180577851 22:16797078-16797100 CCTTTTAAATAAATGAATCTAGG + Intronic
1181381903 22:22511916-22511938 ATTTCTAAATGCATATATTTGGG - Intergenic
1182593812 22:31402476-31402498 CATTTTTCATACATATATTTGGG + Intronic
1183154968 22:36067688-36067710 CTCCATATATACATGTATTTGGG - Intergenic
1183840829 22:40499858-40499880 CTTCTTAAATACTTGTTTTTGGG - Intronic
1184933748 22:47702552-47702574 CTTTATAGATACATTTATTTAGG + Intergenic
1184934281 22:47707597-47707619 CTTTTTTAATACATGGCTTTGGG - Intergenic
949130103 3:489704-489726 ATTTTAAAATACATGTTTTCAGG - Intergenic
949375737 3:3388531-3388553 GTTTTTAAAATCATTTATTTTGG - Intergenic
949438905 3:4059136-4059158 TTTTTTAAACACAAGTATATTGG - Intronic
949632865 3:5947938-5947960 CTTATTAAATACACTTATTAGGG - Intergenic
949794331 3:7830743-7830765 CCTTTTTAATTTATGTATTTAGG - Intergenic
949913504 3:8936690-8936712 CTTTGTAAAAACTTGTTTTTTGG - Intronic
950380999 3:12614746-12614768 CTTTTAAAATAAACTTATTTTGG - Intronic
950444841 3:13030982-13031004 CTTTTAAAATAAATGTATTCAGG - Intronic
951268522 3:20598140-20598162 CTTCTTCCATCCATGTATTTTGG + Intergenic
951511820 3:23510770-23510792 TTTTTTAAATACCTGTTTTAAGG + Intronic
952068143 3:29597179-29597201 CTTTAAAAAAACATGTATTTTGG - Intronic
952640583 3:35589757-35589779 GTTGTTCAATACATGTTTTTGGG - Intergenic
952731857 3:36645692-36645714 CTTCTTGAATAAATTTATTTTGG + Intergenic
952830118 3:37557605-37557627 CTTTTAAAAAAAATGTATTAAGG + Intronic
953087221 3:39681370-39681392 CTTTTAAAATTTGTGTATTTCGG + Intergenic
953108005 3:39904552-39904574 CATTCTAAATACATGCTTTTGGG - Intronic
953559011 3:43970678-43970700 CTTTTTAAATACAGGTTTGTGGG + Intergenic
953780385 3:45863996-45864018 TTTTTTTAAGAAATGTATTTTGG + Intronic
954761047 3:52874263-52874285 CTTTTTAAATAGTTTTATTGAGG - Intronic
955017628 3:55087580-55087602 CTTTTAAAATAAAAGTATTAAGG - Intergenic
955277611 3:57562063-57562085 CATTTTAAAAATATGTTTTTGGG + Exonic
955337299 3:58097393-58097415 ATTCTTAGATACATGGATTTGGG - Intronic
955359141 3:58257940-58257962 CTTTTTAAATACTTGATTTAAGG - Intronic
955431556 3:58850833-58850855 CATTTTAAAAACAAATATTTGGG + Intronic
955522189 3:59785628-59785650 CTTTTTCAGTGCATGTATTCAGG + Intronic
955641051 3:61084650-61084672 CTTTTTAAATACATTTATTGAGG + Intronic
955880081 3:63534039-63534061 CTATTTAAATACAAGTTTCTAGG - Intronic
956607228 3:71084987-71085009 TTGTTTAAATATATGGATTTGGG + Intronic
957404168 3:79755570-79755592 TTTTTTAAATAGATGTAATTTGG - Intronic
957409590 3:79821546-79821568 TTTTTCAAATACAAATATTTTGG + Intergenic
957499029 3:81029045-81029067 GAATTTAAATACATGAATTTTGG + Intergenic
957773601 3:84726692-84726714 CTTTTTAAATGCATTTAAGTAGG + Intergenic
957899954 3:86476353-86476375 ACATTTAAATACATATATTTTGG - Intergenic
957908777 3:86593331-86593353 CTTTTTAAAAAAATTTGTTTTGG - Intergenic
958002596 3:87770083-87770105 ATTTCTGAATACGTGTATTTTGG + Intergenic
959190202 3:103101886-103101908 CTTTTTAATTGTATCTATTTTGG + Intergenic
959242327 3:103812742-103812764 TTTTTTAAACATATTTATTTTGG + Intergenic
959401444 3:105906948-105906970 CTGTCTAAAAATATGTATTTGGG - Intergenic
959429391 3:106234213-106234235 CTTTTTAATTACATACATTTTGG + Intergenic
959836990 3:110930526-110930548 TTTTTAAAATACTTGTGTTTAGG - Intergenic
959868281 3:111297034-111297056 ATTTTTAAAGACTTGTTTTTTGG + Intronic
960171342 3:114465059-114465081 TTTTTTAAGTACAAGAATTTAGG - Intronic
960178913 3:114551049-114551071 CTCTTTAAAAAAATTTATTTTGG - Intronic
960181325 3:114583584-114583606 CATTTAAAAAACATGTTTTTAGG + Intronic
960421098 3:117446599-117446621 GTTTTTAAATATGTTTATTTGGG + Intergenic
960660725 3:120055200-120055222 CTTTTTATCTAACTGTATTTTGG + Intronic
960827423 3:121805065-121805087 CTTTTTAAATATATGGAGTATGG + Intronic
960922354 3:122760230-122760252 CTGTTTAATCACATGGATTTGGG - Intronic
961126501 3:124423310-124423332 CTTTATCAATAAATATATTTAGG + Intronic
961174682 3:124824695-124824717 CTTTTTAAATTCAGTTGTTTGGG - Intronic
961931776 3:130541191-130541213 CTTTTTAAAAATATGTTTGTTGG - Intergenic
962412652 3:135154667-135154689 ATTTATAAATAAATTTATTTTGG - Intronic
963401459 3:144804164-144804186 CTTTTTAAATATATGTTTGGTGG + Intergenic
963548201 3:146687221-146687243 CTTTTTAAAAACGTGTTTATTGG + Intergenic
963574136 3:147038608-147038630 ATTTTTAAAAACATGTTTGTTGG - Intergenic
963885860 3:150581822-150581844 CTTCTTAGATACCTGTCTTTAGG - Intronic
964096166 3:152934323-152934345 CTTTTAAAATAAATGTATTATGG + Intergenic
964341221 3:155710301-155710323 AGTTTTAAAAAAATGTATTTTGG + Intronic
964372535 3:156016003-156016025 CAATTTAAATACATGTAACTAGG + Intergenic
965145549 3:164897425-164897447 CTTTTTAAATAATTCTTTTTGGG - Intergenic
965409756 3:168315549-168315571 CTTTATAAATTCATTTGTTTTGG + Intergenic
965529791 3:169760014-169760036 CCTCTCAAATACATTTATTTTGG + Intergenic
965925007 3:173967404-173967426 CTTTTGAAATAGATGTAGCTAGG + Intronic
965945552 3:174236258-174236280 CATTTGAATTACATGTTTTTTGG - Intronic
965981801 3:174701436-174701458 CTTTTTGAATAGTTTTATTTAGG + Intronic
966070965 3:175877499-175877521 CTGTATAAATACATTTCTTTAGG - Intergenic
966115949 3:176460888-176460910 GTTTCTCAATACATATATTTGGG - Intergenic
966170804 3:177078114-177078136 CTTTTTAAATGCTTATAATTTGG - Intronic
966173726 3:177112626-177112648 CGTTTTAAAAACAAGTAATTAGG + Intronic
966241015 3:177755496-177755518 CTTTTTAAAGACAAGTCATTTGG + Intergenic
966406072 3:179599809-179599831 TTTTCTGAATACATCTATTTGGG + Intronic
966455925 3:180116237-180116259 CTTTTTATTTACATATTTTTTGG + Intergenic
966528808 3:180950436-180950458 CTTTTTAAAAAAATTTATGTGGG + Intronic
966666263 3:182474583-182474605 CTTTATAAATAGATGTTTTCTGG - Intergenic
967518382 3:190399201-190399223 CTTTTTAAAAAAATGTTTTTAGG + Intronic
967773826 3:193363747-193363769 TTTTTCAAAAATATGTATTTTGG - Intronic
967923282 3:194628557-194628579 CTTTTTAGATACATGCGTTTGGG - Intronic
968352709 3:198073847-198073869 CTTTTTAAATCCATTTGTATTGG + Intergenic
969974086 4:11080393-11080415 TTTTTTAAATACATTGAATTAGG + Intergenic
970025182 4:11616398-11616420 CTTTTCACTTAGATGTATTTTGG + Intergenic
970521980 4:16894229-16894251 CCATTCAAATACATGAATTTTGG + Intronic
970595363 4:17595341-17595363 CTTTTTAAATAAAGTGATTTTGG + Intronic
970868770 4:20789302-20789324 AATTTTAAATACATGAATTCTGG - Intronic
970920848 4:21392992-21393014 CTTTTTAAACACATTGATTTGGG + Intronic
971236842 4:24849980-24850002 CTTCTCAAATACATGTATCTGGG + Intronic
971336650 4:25729411-25729433 CCTGTTAAATACATATATTTAGG + Intergenic
971675848 4:29628241-29628263 CTTTTTAAAAATATGTTTGTTGG - Intergenic
971698358 4:29935222-29935244 CTTTTTAAAAATATGTTTGTTGG - Intergenic
971704202 4:30018129-30018151 CTATTTAAATAATTGCATTTTGG + Intergenic
972470826 4:39402567-39402589 ATTTTTAAATTCATGTTGTTTGG + Intergenic
973059750 4:45707247-45707269 CTTTTTAAAAATATGTTTGTTGG + Intergenic
973138480 4:46735848-46735870 CTTTTTAAATAGAAATATTTTGG + Intronic
973188251 4:47356345-47356367 ACTTTCAAGTACATGTATTTAGG + Intronic
973733955 4:53851554-53851576 CTTTCAAATTAAATGTATTTGGG + Intronic
973997097 4:56469382-56469404 CTTTTTTGGTACATGTATATTGG + Intronic
974221554 4:58979613-58979635 CTTTTGAGAAACATCTATTTAGG - Intergenic
974561648 4:63530341-63530363 ATTTTAAAATAAATATATTTTGG + Intergenic
974978981 4:68929459-68929481 CTCTTTATATCCATGTGTTTGGG + Exonic
975123303 4:70753429-70753451 CTACTTATATACATGTATGTTGG + Intronic
975262274 4:72317719-72317741 CTTTTTAAATATATAAACTTGGG - Intronic
975636327 4:76453016-76453038 CTTATTAAAAACATATATCTAGG - Intronic
975773178 4:77752257-77752279 CTTTTCAATTACATATACTTAGG - Intronic
975962184 4:79924200-79924222 CATTTTAAAAATATGTATTTGGG - Intronic
976542732 4:86296541-86296563 GTTTTTAAAAATATGTATATAGG + Intronic
976694209 4:87901246-87901268 CTTGTTAAATTCATGCATTTTGG - Intergenic
976818987 4:89183477-89183499 CTTTTTAGAAATATGTATTCAGG + Intergenic
976889359 4:90027471-90027493 ATTTTTAAAAATATGTATGTTGG + Intergenic
977470337 4:97435324-97435346 ATTTTAAAATACATTTATATTGG - Intronic
977665159 4:99638299-99638321 CTTTTTAAAAACATACATTCTGG + Exonic
977806921 4:101310859-101310881 CATTTTAAGTACATTCATTTAGG - Intronic
977895206 4:102356901-102356923 CTTTTTAAAAAGAAATATTTAGG - Intronic
978102238 4:104856050-104856072 ATTTTTAAAAGTATGTATTTTGG + Intergenic
978217521 4:106223230-106223252 CTTTCTAAATACATAACTTTTGG + Intronic
978963862 4:114717872-114717894 CTTTTTAAAAAGGTGTGTTTGGG - Intergenic
978995539 4:115146725-115146747 ATTTTTAAATACAAGCATTATGG - Intergenic
979049764 4:115915828-115915850 ATTTTAAAATACATTTAATTGGG - Intergenic
979368264 4:119851261-119851283 AGTTTTAGATACATGAATTTTGG - Intergenic
979515043 4:121598049-121598071 CTTTGTAAATACATATATGAGGG - Intergenic
979515080 4:121598419-121598441 CTTTGTAAATAAATGGACTTGGG + Intergenic
979823483 4:125203294-125203316 ATATTTGAATACATGTATGTTGG + Intergenic
979951893 4:126903128-126903150 CATTTTGAATAGATATATTTTGG + Intergenic
980541106 4:134197245-134197267 ATTTTTAATAACATGTATTTTGG - Exonic
980631450 4:135440581-135440603 CTATTTTATTACATGTTTTTTGG - Intergenic
980665051 4:135922510-135922532 GTTTTTAAATGCATTTATATGGG - Intergenic
980703874 4:136466360-136466382 CTTATTAAATAAACATATTTTGG - Intergenic
980708135 4:136525997-136526019 ATTTTTAAATGTTTGTATTTTGG - Intergenic
980748141 4:137048595-137048617 TTTATTAATTCCATGTATTTGGG - Intergenic
980786812 4:137566715-137566737 CTTTTAAAATTCATCTATCTAGG + Intergenic
980922332 4:139099474-139099496 CTTCCTAAATACATGAATTCAGG + Intronic
980968426 4:139546236-139546258 TTTTTTAAATGCCTGTCTTTGGG - Intronic
981054720 4:140349008-140349030 CTTTTGAGAAACATCTATTTAGG + Intronic
981060565 4:140419518-140419540 ATTTATATATAAATGTATTTTGG - Intronic
981140504 4:141262478-141262500 ATTTTTAAATACTTGTTTTTTGG - Intergenic
981279214 4:142937791-142937813 TTTTTTAAATATATCAATTTTGG + Intergenic
981317128 4:143350762-143350784 ATATTTAAAAATATGTATTTAGG + Intronic
981343765 4:143652093-143652115 ATTTTTAAATTTATATATTTAGG - Intronic
981528581 4:145731902-145731924 ATTTTTAAATATATATAGTTTGG + Intronic
981563358 4:146071536-146071558 TTTTTGAAATACAAGTTTTTGGG + Intergenic
981879356 4:149591073-149591095 AGTTTTCAATACATCTATTTAGG - Intergenic
981915563 4:150029427-150029449 CTTTTTCAATAAATTGATTTTGG + Intergenic
981946798 4:150355904-150355926 CATTTTAAATCCATGTAATACGG + Intronic
981993294 4:150950440-150950462 ATTTTAAAATACAGGTAGTTTGG - Intronic
982078208 4:151760589-151760611 GTTTTCAAATAGATGTAGTTGGG - Intronic
982312930 4:154004417-154004439 CTTTCTATGTACAGGTATTTGGG + Intergenic
982418788 4:155168971-155168993 TTATATAGATACATGTATTTTGG + Intergenic
982589840 4:157294000-157294022 CTTTGAAAATAAATGTATGTGGG + Intronic
982628963 4:157807419-157807441 CTTTTTCAATATATGAATCTAGG + Intergenic
982954846 4:161751329-161751351 CTTTTTGAATACATGTTTATAGG + Intronic
983005127 4:162475311-162475333 CTTTTTAATTACATATAGTAGGG - Intergenic
983082097 4:163399207-163399229 CTTTTTTAAAATATGTTTTTTGG - Intergenic
983082247 4:163400764-163400786 CTTTTAATTTACATTTATTTTGG + Intergenic
983566953 4:169163465-169163487 CTTAGTAAATACCTATATTTAGG + Intronic
983893829 4:173059926-173059948 CAGTTTGAATACATGTATCTTGG - Intergenic
984178116 4:176444902-176444924 CTTTTTAAATAAATGTCTGCTGG - Intergenic
984273143 4:177573066-177573088 CAATTTAAATATTTGTATTTTGG - Intergenic
984343957 4:178496489-178496511 CTTTTGAGAAACATCTATTTAGG - Intergenic
984427277 4:179603492-179603514 CATTATAAATACAACTATTTGGG + Intergenic
984683819 4:182643447-182643469 ATTTTAAAATACAAATATTTAGG - Intronic
985196034 4:187430695-187430717 CTTTTTATCTACTTGTATTGTGG + Intergenic
985222507 4:187722933-187722955 CATTTTCAATACATGTTTTTTGG + Intergenic
985222520 4:187723082-187723104 CATTTTCAATACATGTTTTTTGG + Intergenic
985229286 4:187797996-187798018 ATTTTTAAATAGAATTATTTTGG - Intergenic
985328738 4:188802986-188803008 TTTTTAAGATACGTGTATTTTGG - Intergenic
985362111 4:189186500-189186522 CTTTATCAATAAATTTATTTTGG - Intergenic
985917644 5:2936111-2936133 GTTTTTAGCTCCATGTATTTTGG - Intergenic
985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG + Intergenic
986116017 5:4775534-4775556 ATTTTAAAATAAATTTATTTAGG - Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
986231246 5:5866542-5866564 GTTTTTAAATAAAAGTAATTGGG - Intergenic
986816091 5:11413599-11413621 TTTCTTAAGTATATGTATTTTGG + Intronic
986867127 5:12002536-12002558 ATATTTAAATACATTTATTATGG - Intergenic
986914974 5:12608424-12608446 CTTTTTAAAAATATGTTTGTTGG + Intergenic
986951852 5:13097716-13097738 CATTTTAAATATACATATTTAGG - Intergenic
987169164 5:15235539-15235561 TTTGTTAAATACATATTTTTTGG + Intergenic
987451512 5:18089571-18089593 ATTTCCAATTACATGTATTTTGG - Intergenic
987500519 5:18703285-18703307 TCTTTTAAATAAAAGTATTTTGG + Intergenic
987517242 5:18926943-18926965 CTTTGTACATATATGTATATAGG - Intergenic
987782157 5:22452927-22452949 CTTTTAAAATATATATATTAAGG - Intronic
988031255 5:25766136-25766158 GTTTTGAAATACATACATTTTGG - Intergenic
988194555 5:27986325-27986347 TTTTTAAAATACACATATTTAGG - Intergenic
988221857 5:28356668-28356690 ATTTTTAAACTCTTGTATTTGGG + Intergenic
988253420 5:28790898-28790920 CTTTTTAAATTCAATCATTTTGG + Intergenic
988978400 5:36538637-36538659 CTTCTTCAATATATGCATTTTGG - Intergenic
989622294 5:43396662-43396684 TGTTTTAAATAAATGCATTTAGG - Intronic
989628672 5:43458400-43458422 CTTTTTAAAAACATATTTCTAGG - Intronic
989723320 5:44555100-44555122 CCTTTTTAAAGCATGTATTTCGG + Intergenic
989750507 5:44887384-44887406 CCTTAGAAATACATGTATTTAGG + Intergenic
990001095 5:50893903-50893925 CTTTTTAAATAAATATAGTATGG + Intergenic
990050679 5:51495536-51495558 CTTGTTAAACACAAGGATTTTGG - Intergenic
990144090 5:52739325-52739347 CATTTGAAATATATGTTTTTGGG + Intergenic
990287395 5:54313253-54313275 CTTTTAAAAAGCATGTATTGAGG - Intergenic
990845990 5:60140226-60140248 CTTTTTAAATAATTATATATTGG - Intronic
991051980 5:62282699-62282721 CTTTTTTGTTTCATGTATTTTGG - Intergenic
991246379 5:64512657-64512679 CTTTTTATATAAATGTATCTCGG - Intronic
991573917 5:68083000-68083022 TGTATTAAATACATGTAGTTTGG - Intergenic
991952930 5:71964318-71964340 TTTTTAAAATACTTTTATTTTGG - Intergenic
992042045 5:72845038-72845060 TTTTTCAAATAACTGTATTTTGG + Intronic
992163769 5:74028222-74028244 CTTTTTAAATGCATGATCTTGGG + Intergenic
992376402 5:76192096-76192118 TTTTTTAAATACATGTTTGAGGG - Intronic
992478321 5:77125617-77125639 CTTTTTAAAGACAAGAAATTTGG + Intergenic
993129966 5:83883904-83883926 CATTTGAATTACATATATTTGGG + Intergenic
993248725 5:85486953-85486975 CATTTTCAATGCATGTTTTTTGG + Intergenic
993284350 5:85971984-85972006 ATTTTTATATACATGTATAGGGG - Intergenic
993289560 5:86048277-86048299 CATTTTAAAAACAAATATTTAGG + Intergenic
993404774 5:87497971-87497993 CTTTTTTAAAAAATATATTTGGG - Intergenic
993693378 5:91030851-91030873 CTTTTCAAAAACATGTAATTAGG - Intronic
994260188 5:97649145-97649167 CTTTTTAAAGAAATGCATTTTGG + Intergenic
994284176 5:97943430-97943452 CTATAGAAATACATATATTTTGG + Intergenic
994404256 5:99324099-99324121 CTTTTTTAATATATGTTTGTTGG - Intergenic
994777489 5:104052584-104052606 CTTTATAAAGACATGTCTTTGGG + Intergenic
994867959 5:105302492-105302514 TTTGTTAAAAACATCTATTTGGG + Intergenic
994924570 5:106098199-106098221 ACTTTTAAAAACATGTTTTTGGG + Intergenic
995227973 5:109724807-109724829 CTCTTAAAATATAAGTATTTTGG + Intronic
995259279 5:110082914-110082936 ATTTTTAGATACATGAATGTTGG - Intergenic
995629279 5:114115868-114115890 CTTGTTACATACATATATGTTGG + Intergenic
995925081 5:117362727-117362749 TTATTTAAATTCATGTATTTTGG + Intergenic
996110264 5:119557157-119557179 CTTTTTAAATTTATTTATGTTGG - Intronic
996187619 5:120497986-120498008 CTCTTTTAATTGATGTATTTAGG + Intronic
996241051 5:121202482-121202504 ATGTTAAAATACATGAATTTTGG - Intergenic
996445997 5:123551374-123551396 ATTTTTAAAAATATGTATATAGG + Intronic
997058764 5:130476771-130476793 CTTTTTAAATTACTGTATGTTGG + Intergenic
997059569 5:130485305-130485327 AATTTTAAATACATTTATCTTGG + Intergenic
997170425 5:131713696-131713718 CTGTTTAATTGCATGTATATTGG - Intronic
997448660 5:133963683-133963705 GTTTTTTAATTGATGTATTTAGG - Intronic
997688847 5:135811779-135811801 CTGTTTAAATATGAGTATTTAGG + Intergenic
998187172 5:139989542-139989564 CTTTAAAAATATGTGTATTTAGG - Intronic
998414196 5:141933776-141933798 CTGGTTAATTACATCTATTTGGG + Intronic
998477659 5:142435172-142435194 TTGTTTAAAAACATGTATTTGGG - Intergenic
998659518 5:144220597-144220619 CTTACTATATACATGTATGTAGG + Intronic
998670801 5:144350942-144350964 GTTTTTACATACCTGGATTTGGG - Intronic
998784375 5:145692694-145692716 TTTTTTAAATACTTGTCTTTTGG - Intronic
999346424 5:150824515-150824537 CTTTTGAGAAACATCTATTTGGG - Intergenic
999913787 5:156235382-156235404 CTTTTTTAAAAAATGTGTTTTGG + Intronic
999943616 5:156571358-156571380 CTTTTTAAACATATTTTTTTTGG + Intronic
1000311253 5:160047082-160047104 ATTTTAAAATTCATGAATTTTGG - Intronic
1000671032 5:164063504-164063526 TATTTTTAATATATGTATTTTGG + Intergenic
1000681770 5:164194109-164194131 CTTTTTGAATATATGATTTTGGG - Intergenic
1000783800 5:165517579-165517601 CTTTTTAAATAAACACATTTTGG + Intergenic
1000786071 5:165545232-165545254 CTCCTTAAATACCTGCATTTTGG - Intergenic
1000988862 5:167891101-167891123 TTTTTTAAATACATGTGAATAGG - Intronic
1001976913 5:176007616-176007638 TTGTTTAAATAGATGTAATTGGG - Intronic
1002240515 5:177836164-177836186 TTGTTTAAATAGATGTAATTGGG + Intergenic
1002580377 5:180206202-180206224 CCTTTTAAATAAATGGCTTTGGG + Intronic
1002785179 6:394464-394486 CTTATAAAATATCTGTATTTTGG + Intronic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1003327261 6:5101259-5101281 CTATTTACATACATGTCTTAAGG + Intergenic
1003686308 6:8306393-8306415 CTTTGGAGATACATCTATTTAGG + Intergenic
1003992824 6:11503881-11503903 TTTTTAAAAAACATGTATTTTGG + Intergenic
1004378627 6:15113235-15113257 ATTTTAAAATATATCTATTTTGG + Intergenic
1004674199 6:17825299-17825321 CTTATTAAATAAATATCTTTGGG + Intronic
1004676744 6:17850125-17850147 CTTTTTAAAAAATTGGATTTTGG - Intronic
1004784859 6:18956870-18956892 GTTGTTAATTATATGTATTTGGG + Intergenic
1004859175 6:19783479-19783501 GTTTTTAAATACATTCTTTTTGG + Intergenic
1005151866 6:22760785-22760807 CTTTTTAAAGATATGTTTGTGGG + Intergenic
1005378769 6:25212575-25212597 CTTTTTAAAAATATGTTTGTTGG - Intergenic
1005405223 6:25479769-25479791 CTTTCTTAAAATATGTATTTAGG + Intronic
1005777173 6:29146787-29146809 CTTTTGAATTAGATGTTTTTAGG + Intergenic
1005823849 6:29620286-29620308 CTTTTTAAATCAAGCTATTTTGG + Intronic
1006261120 6:32871909-32871931 CTCTTAAAATTGATGTATTTAGG - Intergenic
1007006305 6:38366600-38366622 CGTTTTAAATATGTGTCTTTTGG - Intronic
1007192172 6:40028802-40028824 CTTTTAATAGACTTGTATTTTGG + Intergenic
1007796688 6:44354519-44354541 CTTTTTAAAAAGATTTATTAAGG + Intronic
1007856108 6:44859657-44859679 TTTTTTAAATCCTTGAATTTCGG - Intronic
1008401822 6:51072186-51072208 TCTTTTAAAAAAATGTATTTCGG + Intergenic
1008710700 6:54223108-54223130 TTTTTCAAATACATATATTTTGG + Intronic
1008750050 6:54722027-54722049 CTTATAAAATACATGTTTTGAGG - Intergenic
1008759265 6:54834415-54834437 CTTTTTAAAGACAGGGATGTTGG + Intergenic
1009342952 6:62580426-62580448 TTTTTTAAATACATATATTATGG - Intergenic
1009462996 6:63936281-63936303 ATTTTTAAATACATGTAAATTGG - Intronic
1009542662 6:64982485-64982507 TTTATAAATTACATGTATTTTGG + Intronic
1009724271 6:67516212-67516234 CCTTTTAAATAAATATATGTGGG + Intergenic
1009773143 6:68170412-68170434 TTTTATAAATTTATGTATTTGGG + Intergenic
1009789480 6:68383742-68383764 CTTTTTAAATACTTGATCTTTGG + Intergenic
1009843159 6:69102501-69102523 CTGTTTAAATACATGGCATTAGG + Intronic
1009893246 6:69714890-69714912 TTTGTTAAATACATATATCTAGG + Intronic
1009960957 6:70520650-70520672 CTTTGTATATGTATGTATTTTGG - Intronic
1010117680 6:72334440-72334462 CTTTTTAAATATATACCTTTAGG - Intronic
1010314559 6:74431805-74431827 TTTGTTAAATAAATGTATTCAGG + Intergenic
1010522556 6:76857338-76857360 CTTATTAAATAAAGCTATTTTGG + Intergenic
1010537843 6:77052953-77052975 GTTATTCAATAAATGTATTTTGG + Intergenic
1010776860 6:79896798-79896820 CTTGTTAAACACATGTACATTGG - Intergenic
1010976237 6:82317114-82317136 GTTTTTAATTCCATGTATTGTGG - Intergenic
1011071219 6:83386703-83386725 ATTTCAAAATACATGAATTTTGG - Intronic
1011589134 6:88954070-88954092 TTTTTTAAAAAAAGGTATTTAGG + Intronic
1011877821 6:91983614-91983636 TTTTTTAAATATTTGTATTAGGG + Intergenic
1012055717 6:94407350-94407372 TTTTATAAATACTAGTATTTTGG + Intergenic
1012201036 6:96406254-96406276 CCTCTTAAATACATGTAGCTTGG - Intergenic
1012219298 6:96629005-96629027 CTTGTTAAATCACTGTATTTCGG - Intergenic
1012307232 6:97674114-97674136 CATTTTAAATACATATAAATTGG - Intergenic
1012470419 6:99567747-99567769 CTGCTTAAACAAATGTATTTAGG + Intronic
1012699691 6:102438880-102438902 ATTGTGAAATTCATGTATTTTGG + Intergenic
1012878861 6:104761456-104761478 CTTTTTAAATAAATGGTTTTGGG + Intronic
1012935245 6:105360788-105360810 TTTTGTAAAAACATTTATTTGGG - Intronic
1013159942 6:107533236-107533258 GTTTTTAAGTAAATGTCTTTTGG + Intronic
1013588647 6:111601842-111601864 TTTTTTAAATCCATGACTTTTGG - Intronic
1013687763 6:112605168-112605190 CTTTTGAAAAATATCTATTTAGG - Intergenic
1013696869 6:112713284-112713306 CTTGTTATATTCATGTAATTAGG - Intergenic
1013923087 6:115433422-115433444 CTTTTAAATTATATATATTTTGG + Intergenic
1014055585 6:117011561-117011583 CTTTATTAAAACATGTATGTAGG - Intergenic
1014141295 6:117946244-117946266 ATTTTTAAATCCATATTTTTGGG - Intronic
1014285869 6:119496896-119496918 TTTTCTATATACATGTATATGGG - Intergenic
1014493384 6:122090120-122090142 ATTTATAAATACAAATATTTAGG + Intergenic
1014497896 6:122150024-122150046 CTTTTAAACTGCACGTATTTGGG + Intergenic
1014506334 6:122263395-122263417 CTTTTGAAAAATATCTATTTAGG - Intergenic
1014613649 6:123576179-123576201 TTATTTACATGCATGTATTTTGG - Intronic
1014925426 6:127265221-127265243 CTTTTTAAGTAGATTTATTTAGG + Intergenic
1015051463 6:128845775-128845797 CTTTTTAAATACATGAGATTAGG - Intergenic
1015111639 6:129598622-129598644 GTTTATAAATACAGATATTTAGG + Intronic
1015257951 6:131200972-131200994 TTTTTTAAATAAATGTCCTTGGG - Intronic
1015461001 6:133490958-133490980 ATTTTTAAAGACTTGTATTGTGG - Intronic
1015516686 6:134089440-134089462 TTTTTTAAAAACATGAATTTGGG + Intergenic
1015881094 6:137870595-137870617 CTTTATAAATACTTCTCTTTGGG + Intronic
1015997558 6:139010134-139010156 GTTTTTCAATACATGTCATTTGG + Intergenic
1016362422 6:143282139-143282161 ATTTTTAAATAAATATATATTGG - Intronic
1016452251 6:144195304-144195326 CTCTTTGAAAACATGGATTTGGG + Intergenic
1016473132 6:144396701-144396723 CTTTTTAAAAACCTGTTTTATGG - Intronic
1016527052 6:145013491-145013513 TTTTTGAAATACATGTATTCTGG + Intergenic
1016545346 6:145216456-145216478 CTTTTTCAATATATGTTTTAAGG - Intergenic
1016986984 6:149902916-149902938 CTTTTAAACTACTTGTATCTTGG + Intergenic
1017014610 6:150089901-150089923 CAGTTTCAATACATGAATTTGGG + Intergenic
1017346377 6:153386801-153386823 GTTTTTAAAAACATATATTTAGG - Intergenic
1017639799 6:156481776-156481798 AAGTTTTAATACATGTATTTTGG - Intergenic
1018003266 6:159598139-159598161 CTTTTTAAAAACAAGCCTTTAGG + Intergenic
1018413129 6:163576088-163576110 CATTTTAAATAAAGGTATTAAGG - Exonic
1018778879 6:167044613-167044635 ATTTTTAAAAACATGTATCAGGG - Exonic
1018999742 6:168739818-168739840 CTTTTCAAGTAGATGTAATTAGG - Intergenic
1019063638 6:169276622-169276644 CATTTTAAATATATGTTTTCTGG + Intergenic
1020415737 7:7943702-7943724 GTGTTTAAATAAATGTAATTAGG - Intronic
1020576174 7:9931692-9931714 CTTTTAAAATATTTTTATTTCGG + Intergenic
1020591468 7:10144068-10144090 CTTATAAAATACATGTTTGTTGG - Intergenic
1020602343 7:10291985-10292007 TTTTTTAAATTCAATTATTTAGG - Intergenic
1020737779 7:11973087-11973109 CTTTTTAAAGAAATTTCTTTAGG - Intergenic
1020769103 7:12365410-12365432 ATTTTTAAAAACTTTTATTTTGG - Intronic
1020859986 7:13479854-13479876 CTGTTTAAATGCATATATTTTGG - Intergenic
1020892173 7:13892180-13892202 ATTTTTTAATACATTTCTTTTGG - Exonic
1020903438 7:14034719-14034741 CTATTTAAAAACATCCATTTAGG - Intergenic
1020972663 7:14965227-14965249 CATTTTAAAGACATAGATTTGGG + Intronic
1020990639 7:15192078-15192100 GTTTTGAAAAACATTTATTTTGG - Intergenic
1021034255 7:15777724-15777746 CTTTTTAAATAGATTTAATTGGG + Intergenic
1021277308 7:18668446-18668468 CTTTTAAAATACATTTTATTTGG + Intronic
1021337675 7:19423764-19423786 GTTTTTAAAGACATGTTATTTGG + Intergenic
1021664677 7:22964541-22964563 TTTTAGAAATACATTTATTTTGG - Intronic
1021677063 7:23091079-23091101 CTTTTTAAAAATTTGTACTTGGG - Intergenic
1021684766 7:23173375-23173397 CTTTTTAAATACAAGTTTTAAGG + Intronic
1021964348 7:25902724-25902746 CTTTTTAATTAAATTTCTTTAGG + Intergenic
1022135133 7:27439942-27439964 CTTTTTAAATTAATTTTTTTGGG + Intergenic
1022397048 7:29998481-29998503 CTTTTTAAAAATATCTATTCAGG + Intergenic
1022683611 7:32573596-32573618 CTTTTCCTATGCATGTATTTTGG + Intronic
1022778763 7:33556580-33556602 CCTTTAAAATAGATTTATTTAGG - Intronic
1023324555 7:39039005-39039027 ATATATAAATACATGGATTTAGG + Intronic
1023359793 7:39403808-39403830 CTTTATACATACATATCTTTTGG - Intronic
1023383370 7:39630740-39630762 TTTTTTAAATAAATGTCATTGGG - Intronic
1023746209 7:43325314-43325336 ATTTTTTAATACATGCATTTGGG + Intronic
1024752837 7:52488701-52488723 TTTGTTAACTACAAGTATTTTGG - Intergenic
1024829320 7:53430250-53430272 CTTTTAAAATTGAAGTATTTGGG + Intergenic
1024914183 7:54480657-54480679 GTTATTAAATACATATATTAAGG + Intergenic
1024955036 7:54909490-54909512 CTTTTCAAATAAGTGGATTTTGG - Intergenic
1025058225 7:55782367-55782389 TTTTTTAAATACAGATTTTTGGG + Intergenic
1025765130 7:64438387-64438409 CTTTTTAAATACATTAATTGAGG - Intergenic
1026076229 7:67171975-67171997 CTTTTTAATAACATGTAATTGGG + Intronic
1026209602 7:68292241-68292263 CTTTTTAAAAAAATTTTTTTTGG - Intergenic
1026700628 7:72640315-72640337 CTTTTTAATAACATGTAATTGGG - Intronic
1026740874 7:72977550-72977572 TTATTTAAATATATATATTTAGG + Intergenic
1026798177 7:73379043-73379065 CTATCTAAATATATATATTTAGG + Intergenic
1026894071 7:74000044-74000066 CTTTTTTAATGCACGTACTTTGG - Intergenic
1027102859 7:75387524-75387546 TTATTTAAATATATATATTTAGG - Intergenic
1027537162 7:79417541-79417563 CTTTTCAAACACATCTATGTAGG + Intronic
1027672395 7:81118096-81118118 ATATTTTAATACATGAATTTTGG + Intergenic
1027704683 7:81514408-81514430 CTTTTTAAATAAATGTGTTATGG + Intergenic
1027752669 7:82170395-82170417 CTTTTTAAATAAATTGCTTTTGG - Intronic
1027797924 7:82716761-82716783 CTCTCTAAATACATGTCTGTAGG - Intergenic
1027816410 7:82977713-82977735 CTTGTTTAATAGATGAATTTTGG - Intronic
1027837185 7:83259557-83259579 TTTCTTAAATACATATATATGGG + Intergenic
1027972384 7:85101850-85101872 CTTTTTAAATATATCTTATTTGG - Intronic
1028008466 7:85609699-85609721 TTTTTTAAATACCTATATTTTGG - Intergenic
1028038084 7:86011080-86011102 CTGATTAAATACATGTAGGTTGG + Intergenic
1028118424 7:87028512-87028534 ATATTTATATATATGTATTTTGG - Intronic
1028213139 7:88100174-88100196 TTTTTTAAATAGACTTATTTTGG - Intronic
1028747469 7:94343989-94344011 TTTTTTAATTACAAGAATTTGGG + Intergenic
1028769408 7:94599539-94599561 CTTTCTAAATAGAGATATTTAGG - Intronic
1029024134 7:97397199-97397221 CTTTTTGAAGAACTGTATTTTGG + Intergenic
1030120685 7:106107882-106107904 ATTTTTAAATAAATATATTTAGG - Intronic
1030169926 7:106590781-106590803 CTTTTCCAATACATTTATGTTGG - Intergenic
1030697081 7:112597361-112597383 TTTTTTAAATACAGGTTTTAAGG - Intergenic
1030728433 7:112954684-112954706 TTTTTTAAATTCATGTTTCTTGG + Intergenic
1031107116 7:117557623-117557645 CTTTTTCATTGAATGTATTTGGG + Intronic
1031223792 7:119008333-119008355 CTTTTAGAATATATGTAATTGGG - Intergenic
1031344327 7:120646385-120646407 CTTTTTAAAAAGATGTCTTAGGG - Intronic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1031645837 7:124223837-124223859 CTTTTTAGAAACATGTTCTTAGG - Intergenic
1031821249 7:126504645-126504667 ATTTTTAAAAACTTTTATTTTGG - Intronic
1031828110 7:126590971-126590993 TTTTTTAAAAAAAGGTATTTAGG + Intronic
1031835827 7:126680992-126681014 CTCTAAAAATAAATGTATTTTGG - Intronic
1032323771 7:130907897-130907919 CCTTTTAAATACATGAATCTTGG - Intergenic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1032640104 7:133756990-133757012 CTTTTTAAAAATATGTATTAAGG + Intronic
1033142174 7:138837672-138837694 CAGTTGAAATATATGTATTTTGG - Exonic
1033437450 7:141346269-141346291 TTTTTTATATTCATCTATTTGGG - Intronic
1033876427 7:145823839-145823861 CTTTTTAAAAACAACTATATGGG + Intergenic
1033898573 7:146106994-146107016 CTTTTTAAATTCATGTACTGTGG - Intergenic
1033967758 7:146998309-146998331 CTTTTTATTTCCATTTATTTGGG + Intronic
1034165770 7:149023944-149023966 CCTTTTAAAAAAATGAATTTTGG + Intronic
1035146828 7:156826861-156826883 TTTATTAAATATATGTAGTTGGG + Intronic
1035755785 8:2031500-2031522 TTTTTAAAAAACTTGTATTTAGG - Intergenic
1037119395 8:15265311-15265333 TTTTTTAAATATAAATATTTTGG + Intergenic
1037131091 8:15408461-15408483 CTTCATAAATTCATGTATTTTGG - Intergenic
1037337153 8:17802253-17802275 CTTTTTAATTACCTGGATTGTGG + Intergenic
1037369498 8:18159859-18159881 CTTTTAAAATATATATATTTAGG - Intergenic
1038279198 8:26148362-26148384 TTTTTTAAATATATGTATATAGG + Intergenic
1038321456 8:26531159-26531181 GGTTTTCAATACATGAATTTTGG + Intronic
1038668766 8:29564397-29564419 CCTTTTAAATGCATGTGTTAGGG + Intergenic
1038728322 8:30101963-30101985 CATTTTACATACTTGTATATTGG - Exonic
1038986285 8:32814499-32814521 AGTTTTAAATTAATGTATTTTGG - Intergenic
1039358757 8:36850842-36850864 GTTTTTGAATAAATGAATTTTGG - Intronic
1039396508 8:37229849-37229871 ATTTTTAAATAGATGTTATTGGG + Intergenic
1039811320 8:41051080-41051102 ATTTTTAAAAACAGGTATTCAGG + Intergenic
1040955224 8:52972967-52972989 GTTTTTAAAAAAATGTATTCTGG + Intergenic
1040984443 8:53278612-53278634 TTTTTTAATTTCATATATTTGGG + Intergenic
1040985315 8:53287513-53287535 CTGTTTAACTACAGTTATTTAGG + Intergenic
1041630777 8:60084109-60084131 CATTTTAAACATATGAATTTTGG + Intergenic
1042567146 8:70123548-70123570 CTTTTAAAATAGCTCTATTTGGG - Intronic
1043045455 8:75317305-75317327 CTTTTAACCAACATGTATTTGGG + Intergenic
1043216257 8:77592917-77592939 CTATTTATATACCTGCATTTAGG - Intergenic
1043346888 8:79308569-79308591 ATTTTTAAAAAGATGTAATTGGG + Intergenic
1043693267 8:83184477-83184499 TTTTTTTAATACATGAATTATGG + Intergenic
1044005811 8:86935840-86935862 TTTTTAAAAAACATGCATTTGGG + Intronic
1044288400 8:90438093-90438115 CTTTTTAAAAATATATAATTTGG + Intergenic
1044351920 8:91176454-91176476 TATTTTAAATAGATGTATTAGGG + Intronic
1044468085 8:92530834-92530856 ATTTCTCAATATATGTATTTGGG - Intergenic
1044567557 8:93681510-93681532 CTTTTAAAATACATGATTTCTGG - Intergenic
1044653119 8:94519814-94519836 ATATTTAAATTCATGTATCTAGG + Intronic
1044829043 8:96227622-96227644 CTTTTTAATTCCAAGTAGTTTGG + Intronic
1044829549 8:96233796-96233818 CTTTAAAAATGTATGTATTTTGG + Intronic
1044984368 8:97744872-97744894 TTTTTTAAATAAACGTTTTTTGG + Intergenic
1045072237 8:98520016-98520038 ATATTTAAATAGATATATTTTGG - Intronic
1045123895 8:99068446-99068468 TTTTGTAAATACAAGTTTTTTGG + Intronic
1045190626 8:99879355-99879377 TTTTTTAAAAAAAAGTATTTGGG - Intronic
1045323020 8:101096166-101096188 CTTTATAAATATATTGATTTCGG - Intergenic
1046192762 8:110820011-110820033 AGTTTTAAATAAATGTGTTTTGG + Intergenic
1046292029 8:112175183-112175205 AATTTTAATTACCTGTATTTTGG + Intergenic
1046298557 8:112255847-112255869 CTTTTTATATACATGTAAAAGGG - Intronic
1046358544 8:113119408-113119430 CTTTTTAACTACATGAACTTGGG - Intronic
1046485383 8:114880957-114880979 CTTTTGAGATACATTTCTTTTGG + Intergenic
1046783005 8:118235500-118235522 ATTTTTAAAAACATGTATACTGG + Intronic
1046922024 8:119740740-119740762 ATTTATAAATATATTTATTTTGG - Intronic
1047040205 8:120985476-120985498 TTTTCTAAAAACATGTATCTTGG - Intergenic
1047143036 8:122163700-122163722 CTTTTCACATCCATATATTTTGG + Intergenic
1047389090 8:124435610-124435632 CTTGTTAAATACAAGTTCTTGGG + Intergenic
1048229735 8:132626542-132626564 CTTAATAAATAAATATATTTTGG - Intronic
1049865914 8:144935504-144935526 CTTTTTAAAAAGATGTTCTTTGG - Intronic
1049972045 9:829913-829935 GCTTTTAAAAACATCTATTTTGG - Intergenic
1050202871 9:3166152-3166174 TTTTTTAAATAAAAGTGTTTAGG + Intergenic
1050485487 9:6129977-6129999 TTGTTTAAGTACATTTATTTAGG - Intergenic
1050794911 9:9526289-9526311 CTATTTACATACACGTACTTGGG + Intronic
1050847911 9:10246541-10246563 CTATTTTAAAACATGTATCTTGG - Intronic
1050985245 9:12073873-12073895 CATTGTAATTACCTGTATTTTGG - Intergenic
1050994687 9:12201268-12201290 ATTTTTAAGTAAATGCATTTGGG - Intergenic
1051111792 9:13647242-13647264 CTCTTTATAAACTTGTATTTGGG + Intergenic
1051162606 9:14225192-14225214 TTTTTTAAATACATTTGCTTTGG + Intronic
1051316697 9:15843219-15843241 CTTTTGAAATACAGTCATTTTGG + Intronic
1051326346 9:15974621-15974643 CATTTTTAATACATGTATTTTGG + Intronic
1051410211 9:16781702-16781724 CTTTTCCAATACAAGTATATTGG + Intronic
1051432735 9:16996880-16996902 TTTTTAAAAGACCTGTATTTAGG + Intergenic
1051453579 9:17226265-17226287 CTGTTCAAATTCTTGTATTTTGG - Exonic
1051836033 9:21338643-21338665 CTTTTTACAAACTTTTATTTAGG + Intergenic
1052101572 9:24452941-24452963 CTTTTTGAAGACGTGCATTTTGG + Intergenic
1052101655 9:24454187-24454209 CTTTTTGAGTAAATTTATTTGGG + Intergenic
1052420099 9:28233088-28233110 CATTTTAAATATATGTGTGTGGG + Intronic
1052456580 9:28706925-28706947 TTTTTTAGATATATTTATTTTGG - Intergenic
1052585893 9:30426924-30426946 TTTTTTAAATCCTTGAATTTTGG - Intergenic
1052592046 9:30510454-30510476 CCTTTAAAATAAATTTATTTGGG - Intergenic
1053084956 9:35211388-35211410 GTTTTTACATTCATGTATTTTGG + Intronic
1053462956 9:38284764-38284786 CTTTTTAATTGCATCTAATTTGG + Intergenic
1054357696 9:64078687-64078709 CTTTTTAAATCCATTTTTATTGG - Intergenic
1054704377 9:68447923-68447945 TTGTTTAAATACAGGCATTTGGG + Intronic
1054943412 9:70768885-70768907 CTTTTTAGGTCCATGTATTTTGG + Intronic
1054943571 9:70770710-70770732 CTTTTTAGGTTGATGTATTTGGG + Intronic
1055544289 9:77351481-77351503 CTTTTTTAAAAAAGGTATTTGGG + Intronic
1055574890 9:77650824-77650846 ATTTTTAAATAAATTTATTTTGG - Intergenic
1055796503 9:79980371-79980393 ATTTTTAAATGTTTGTATTTAGG + Intergenic
1056057469 9:82841880-82841902 CGTTTTAATTAAAAGTATTTTGG - Intergenic
1056750587 9:89348028-89348050 TCTTTTAAGTACAAGTATTTAGG + Intronic
1056936871 9:90921701-90921723 CATTTTAAAAAGATTTATTTTGG - Intergenic
1057153509 9:92817282-92817304 CTTTTTAAATCCATTTGTATTGG - Intergenic
1057373859 9:94500397-94500419 CTTTTTTGATTTATGTATTTTGG + Intergenic
1058229811 9:102411870-102411892 CTTTGTAGATAAATGTGTTTAGG - Intergenic
1059140631 9:111849579-111849601 CTTTTTGAATACAGGTTTCTGGG + Intergenic
1059206464 9:112471667-112471689 CTTTTTAAATTAATTTATTAGGG - Exonic
1059835775 9:118150459-118150481 TTTTCTAAAAACATGTATGTAGG + Intergenic
1060072769 9:120564820-120564842 CCTTTAAAAAACATGTTTTTTGG - Intronic
1060247095 9:121956396-121956418 CTTTTTAAATTCACATTTTTAGG - Intronic
1060376515 9:123119398-123119420 GTTTGTAAATACTTGTTTTTTGG - Intronic
1060380710 9:123168448-123168470 CTTTTTAAAAAAATGCTTTTTGG - Intronic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1060679067 9:125545236-125545258 CTTTTTAAAAAACTATATTTAGG + Intronic
1061628748 9:131857929-131857951 CATTTAAAATAAATTTATTTAGG - Intergenic
1203560764 Un_KI270744v1:54830-54852 CTTTTTAAATCCATTTTTATTGG + Intergenic
1185797911 X:2982615-2982637 TTTTTAAAATAAATGTATTCTGG + Intergenic
1185967247 X:4620787-4620809 TTTTTTAAATATATATATTCTGG + Intergenic
1186013030 X:5158488-5158510 CCTTTTGAAGACATGTCTTTTGG - Intergenic
1186126208 X:6417086-6417108 CTTTTTTAAAGTATGTATTTAGG - Intergenic
1186174353 X:6909520-6909542 CTTTGTAAATACAGCTTTTTTGG + Intergenic
1186305746 X:8255726-8255748 CTTCATAAATACATTTATTTTGG - Intergenic
1186386137 X:9112124-9112146 CTTTAAAAATATATTTATTTAGG - Intronic
1186658079 X:11637787-11637809 CTTCTTAATTACAAGTAATTAGG + Intronic
1186875697 X:13815634-13815656 CTTTTTAAATTAATTTTTTTAGG - Intronic
1186879309 X:13849143-13849165 TTTTTTAAACAATTGTATTTGGG - Intronic
1186943751 X:14541638-14541660 TTTTCTGAATACATTTATTTGGG - Intronic
1187811023 X:23176975-23176997 CTTTTTAAATTCATGGTGTTAGG - Intergenic
1187943097 X:24400656-24400678 CTTATGAAATACATGCAATTGGG - Intergenic
1188332049 X:28885808-28885830 CATTTGAACTACATGTCTTTCGG + Intronic
1188607492 X:32050038-32050060 GTTTTTTAATAAACGTATTTTGG + Intronic
1188619546 X:32203187-32203209 CTTTTAAAATACAGTTATTATGG + Intronic
1188636566 X:32439334-32439356 TTTTTAATATAAATGTATTTAGG - Intronic
1188913817 X:35885079-35885101 ATTTATATATACATGTGTTTGGG - Intergenic
1188923228 X:36005298-36005320 CTTTTTAAATATAGGTTTTATGG + Intergenic
1189393491 X:40598753-40598775 TTTTTTAATTCCATTTATTTTGG + Intronic
1189707669 X:43775405-43775427 GTTTTTAAAGATATGTCTTTGGG + Intronic
1189945093 X:46169769-46169791 ATTTTTAGCTACATGTATGTTGG + Intergenic
1190257084 X:48771615-48771637 CTTTTTATATAAATGTATTTAGG - Intronic
1190449188 X:50560743-50560765 CTTTTTTGATATAGGTATTTAGG - Intergenic
1190799415 X:53773670-53773692 ATTTTTAAATATATTTATTGAGG + Intergenic
1190835541 X:54097623-54097645 CTTTTTAATTTTATGTATTTTGG + Intronic
1191590007 X:62871670-62871692 CTTTTAAGATACATCTATTCAGG - Intergenic
1192069822 X:67925756-67925778 CTTTTTAAAGACTTGTTTTTTGG - Intergenic
1192288263 X:69762128-69762150 CTTTTTAAAAATAGGTGTTTTGG + Intronic
1192332377 X:70186670-70186692 CTGTTAAAATACATTAATTTAGG - Intronic
1192570275 X:72198057-72198079 CTTTTTAAATAAATGTTTATTGG + Exonic
1192864067 X:75111297-75111319 CTTTTTAAATAAATGGATTATGG + Intronic
1193189813 X:78556908-78556930 TTTTTTAAATGTATGTATTTTGG + Intergenic
1193335776 X:80287126-80287148 CTTTTTAAAAAACTATATTTGGG - Intergenic
1193365574 X:80628290-80628312 ATTTTTAAATCCAATTATTTAGG + Intergenic
1193491542 X:82155824-82155846 TCTTTTAAAAACATGTTTTTTGG + Intergenic
1193654150 X:84178091-84178113 CTTTTTAAATAAAATTATTTTGG - Intronic
1194009808 X:88547663-88547685 AATTTTAAATAAATGTATCTGGG - Intergenic
1194088403 X:89556845-89556867 CTATTAAAATAAATGTATGTAGG - Intergenic
1194263054 X:91721468-91721490 ATTTTTAAATATATTTATTGGGG - Intergenic
1194549785 X:95282678-95282700 AATTTTAAAGACATTTATTTGGG - Intergenic
1194807074 X:98343322-98343344 TTTTTGAACTGCATGTATTTAGG + Intergenic
1195255734 X:103088256-103088278 CTTTTTAAATACTTTTTTCTAGG - Intronic
1195305250 X:103575774-103575796 CTTTAAAATTATATGTATTTTGG + Intergenic
1195955539 X:110325882-110325904 CTTTTTAAATATAGGTATTATGG + Intronic
1196204261 X:112921170-112921192 CTATTTAAATAAAACTATTTTGG + Intergenic
1196501830 X:116392959-116392981 ATTTTCAAATACATGCATTTAGG + Intergenic
1196711470 X:118768146-118768168 CTTTTTAAACAGCTGTATATTGG + Intronic
1196886317 X:120249632-120249654 CTTTTTAAAAAGATATATATAGG - Intergenic
1196934089 X:120712310-120712332 CTTTAAAAATACATTGATTTTGG - Intergenic
1197128613 X:122977337-122977359 TTTTTTAAATACAGGAATTTGGG + Intergenic
1197436548 X:126435527-126435549 GTTGTTGAATACATCTATTTGGG - Intergenic
1197811034 X:130443351-130443373 CCTTTAATATTCATGTATTTAGG + Intergenic
1198724502 X:139663288-139663310 CTTGTTAAATACTTGTTTTGTGG + Intronic
1199021532 X:142884092-142884114 CTTTTTAAAAATATGTTTGTTGG - Intergenic
1199150714 X:144482315-144482337 CTTTCTAAATACATGATTATTGG + Intergenic
1199298378 X:146185109-146185131 CTTTTTAAATTTATTTATGTTGG + Intergenic
1199795889 X:151196111-151196133 CTTTTGAGAAACATTTATTTAGG + Intergenic
1200404972 Y:2800748-2800770 GTTTTTAAAAACATGTGTCTGGG + Intergenic
1200441079 Y:3212884-3212906 CTATTAAAATAAATGTATGTAGG - Intergenic
1201252830 Y:12076720-12076742 ATTTTTACATACATATATTCTGG + Intergenic
1201301991 Y:12515543-12515565 CTTTCTTCATACATATATTTTGG - Intergenic
1201975698 Y:19846739-19846761 CTTTTTAGCTCCTTGTATTTGGG - Intergenic