ID: 1129220265

View in Genome Browser
Species Human (GRCh38)
Location 15:74128319-74128341
Sequence CTTTCCCCCAGGGCAGCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 15, 3: 41, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129220252_1129220265 26 Left 1129220252 15:74128270-74128292 CCGGGCGGGCACTGGGCTCTCCA 0: 1
1: 0
2: 1
3: 16
4: 234
Right 1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG 0: 1
1: 0
2: 15
3: 41
4: 310
1129220259_1129220265 6 Left 1129220259 15:74128290-74128312 CCAGGGTCGAAGGCAGGGGTAAG 0: 1
1: 0
2: 0
3: 6
4: 183
Right 1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG 0: 1
1: 0
2: 15
3: 41
4: 310
1129220251_1129220265 27 Left 1129220251 15:74128269-74128291 CCCGGGCGGGCACTGGGCTCTCC 0: 1
1: 0
2: 3
3: 29
4: 337
Right 1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG 0: 1
1: 0
2: 15
3: 41
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129220265 Original CRISPR CTTTCCCCCAGGGCAGCCTC CGG Exonic
900037662 1:431010-431032 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900059292 1:666753-666775 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
900179775 1:1306007-1306029 CCTGCCCCCAGGACAGCCTCAGG + Intronic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
900325738 1:2107893-2107915 ATTCCCCCCAGGGCAGTGTCGGG + Intronic
901640946 1:10692715-10692737 CATCCCCTCAGGGCTGCCTCCGG + Intronic
902839147 1:19064509-19064531 TTTTCAGCCAGGTCAGCCTCTGG + Intergenic
903141251 1:21340409-21340431 CTTTCTCCCAGGGCCACTTCAGG + Intronic
903192070 1:21662518-21662540 TTTTCCCCCAAGCCAGCCTGGGG + Intronic
903740740 1:25557025-25557047 CACTCCACCAGGGCAGACTCTGG - Intronic
903814837 1:26057422-26057444 CATCCCTCCAGGGGAGCCTCTGG - Intronic
904000511 1:27335984-27336006 ATGTCCCCCAGGGCAGCTGCCGG - Exonic
904754253 1:32759522-32759544 TGTTCCCCCAGGGCACCCTGTGG + Intronic
905263549 1:36735632-36735654 CTTACCCCCAGGGCAGGCCCTGG - Intergenic
905792175 1:40795747-40795769 CTGTCCTCCAGGGGAGCCTGAGG - Intronic
905952847 1:41966508-41966530 CTTTCACCCAGGCCAGACTGCGG + Intronic
907480721 1:54743935-54743957 CTTTCTCCCAAGCGAGCCTCTGG - Intergenic
907704238 1:56819293-56819315 CTTTCCTCCAAGGCAGAGTCAGG + Exonic
912549056 1:110472757-110472779 CTTTCCTCCTGGGCAGCCGCCGG - Intergenic
915935812 1:160089745-160089767 CTTTTCTCCAGGCCAGCTTCAGG - Exonic
916297393 1:163234895-163234917 CTTTCATCCTAGGCAGCCTCAGG + Intronic
916502742 1:165400740-165400762 CTTTGCCCCAGGGCACATTCTGG - Intergenic
916880804 1:169018060-169018082 GTGTCCCCAAGGCCAGCCTCAGG - Intergenic
918337536 1:183534066-183534088 CTTTTCCCCAGGACAGCAACTGG - Intronic
919899687 1:202034790-202034812 GTTTCCACCAGAGCAGCCTCGGG + Intergenic
922594972 1:226806588-226806610 CTCTGGACCAGGGCAGCCTCTGG - Intergenic
922985317 1:229861810-229861832 CCTTTCCCAAGGGGAGCCTCTGG - Intergenic
924754702 1:246931186-246931208 CTTTCCCCGAGGGAAGCGGCCGG - Intronic
1063016397 10:2081819-2081841 CTGTTCCCCAGGCCAGGCTCAGG - Intergenic
1066464943 10:35642562-35642584 CTGTCCCCAAGGGCAGACTCGGG - Intergenic
1067228284 10:44389456-44389478 CTTCCCTCTAGGGCAGCCTGGGG - Intergenic
1067249652 10:44575860-44575882 CTTCGCCCCAGGGCAGGCCCAGG + Intergenic
1067441488 10:46311276-46311298 CTTTCAACAAGGGCAGCCACGGG + Intronic
1067450095 10:46376763-46376785 CTTTCCTCCCAGGCAGCCTCAGG + Intronic
1067587148 10:47483000-47483022 CTTTCCTCCCAGGCAGCCTCAGG - Intronic
1067634207 10:47990767-47990789 CTTTCCTCCCAGGCAGCCTCAGG - Intergenic
1069806025 10:71125584-71125606 CCTGCTTCCAGGGCAGCCTCAGG - Intergenic
1070354772 10:75629143-75629165 CTCTGCCCCAGGGCAGTATCTGG - Intronic
1070979126 10:80630369-80630391 CTTGCTCCCATGGCAGCCACAGG + Intronic
1072253782 10:93601399-93601421 CTCACCTCCAGGACAGCCTCGGG + Exonic
1072286770 10:93923592-93923614 ATTTCCTGCAGGGCAGCCCCCGG - Intronic
1072748274 10:97957551-97957573 CTTTCCAGCTGTGCAGCCTCAGG - Intronic
1073045354 10:100634486-100634508 CATTTCCCCAGGGCTGCCTGGGG - Intergenic
1073228102 10:101941528-101941550 CTTTCCCCCATCACAGCCACAGG - Intronic
1073295058 10:102433835-102433857 CTTCCCCACAGGGCAGCACCGGG - Intergenic
1073420074 10:103417611-103417633 CAATCCCCCAGGGCAGCCTTTGG - Intronic
1075075507 10:119347822-119347844 CTGCCCCCCAGGGAAGACTCAGG - Intronic
1075412907 10:122242147-122242169 CTTTGCCCCAGGACAGAGTCTGG + Intronic
1076713693 10:132352750-132352772 CTGTCCCACAGGGAGGCCTCGGG - Intronic
1076964389 11:68933-68955 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1077148192 11:1055260-1055282 CTTTCCCCTGGAGCAGCGTCAGG - Intergenic
1077358668 11:2130172-2130194 CTTCCCCTCCGGCCAGCCTCAGG + Intronic
1077443215 11:2578318-2578340 CTTGCCAGCAGGGCAGCCACAGG + Intronic
1079076984 11:17390139-17390161 CCATGCCACAGGGCAGCCTCAGG - Intergenic
1080195171 11:29600278-29600300 CCTTCCCGCGGGGCAGGCTCGGG - Intergenic
1081995401 11:47360485-47360507 CTTTCCCTGAGGGCCGGCTCTGG - Intronic
1082609717 11:55282210-55282232 CTTTCCCCAAGTGCAGCCAATGG - Intergenic
1083570993 11:63762445-63762467 CTTTTCCCCGTGGCAGCCGCAGG - Exonic
1084020314 11:66413415-66413437 CCATCCCCCAGGCCTGCCTCTGG - Intergenic
1084162121 11:67355603-67355625 TTTTCTCCTTGGGCAGCCTCTGG + Intronic
1084174995 11:67418425-67418447 CTCCGCCCCAGGACAGCCTCGGG - Exonic
1084597143 11:70123621-70123643 CTCTGTCCCAGGACAGCCTCTGG + Intronic
1084721090 11:70906169-70906191 CTGTCACCCAGGCCAGCCCCAGG + Intronic
1085198619 11:74687884-74687906 CTTTCTCCCACAGAAGCCTCAGG + Intergenic
1089466382 11:118689106-118689128 CCTTCCCCCAGGGCAGGCCTCGG - Intergenic
1090069210 11:123528977-123528999 CTTTCCCAGAGAGCAGGCTCAGG + Intronic
1090071711 11:123549865-123549887 CCCTCCCCCAGGGCAGCACCTGG - Intronic
1091150050 11:133319804-133319826 GTTTCCTCCAGGGCGACCTCAGG - Intronic
1091270395 11:134307352-134307374 CTATCCACCAGAGCATCCTCAGG - Intronic
1091343892 11:134839947-134839969 GTTTCCCCCAAGCCAGCCCCTGG + Intergenic
1091596667 12:1883156-1883178 CTTTACCCAGGGGCAGCCGCAGG + Intronic
1091679332 12:2515614-2515636 CTTCTCCCCTGGGCAGCATCTGG + Intronic
1091921450 12:4308122-4308144 CATCTCCCCAGGGCAGCCTGGGG + Intergenic
1096254739 12:50056164-50056186 CTATGCCCCCGGGCAGCCACTGG - Intergenic
1102037601 12:109781159-109781181 TTTTCCCTCAGGTCAGGCTCTGG - Intergenic
1104038085 12:125112321-125112343 CAGTCCCCCAAGGCTGCCTCCGG - Intronic
1104750620 12:131235928-131235950 CTTTCCCACAGGGGAGCCCGGGG - Intergenic
1104782102 12:131428532-131428554 CTTTCCCACAGGGGAGCCCGGGG + Intergenic
1104902689 12:132197780-132197802 ACTTCACCCAGGTCAGCCTCTGG - Exonic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106756788 13:32829831-32829853 TCTTCCTCCAGGGCAGCCTTGGG - Intergenic
1111386849 13:87538888-87538910 CTTTTCCCCAGGACTGACTCAGG + Intergenic
1115223269 14:31078163-31078185 CTGTCCCCAAGGCCAGTCTCTGG - Intronic
1116030690 14:39567873-39567895 CTGCCCCCCTGGGCAGCCTTTGG + Intergenic
1116548863 14:46208013-46208035 AGTTCCCCCATGCCAGCCTCTGG - Intergenic
1118753576 14:68822992-68823014 CTTTCCCTCAGGGCGCCCTGGGG - Intergenic
1119323790 14:73746695-73746717 CTTTGGCCCAGGGCAGAGTCTGG - Intronic
1119441330 14:74630811-74630833 CTTTCTGCCTGGGCAGCCTGTGG - Intergenic
1121634707 14:95446075-95446097 CTTTCCATCAGGGCTGCCTGTGG + Exonic
1121957777 14:98229614-98229636 CTTGTCCCCAGTGCAGCCTCTGG + Intergenic
1122691526 14:103534044-103534066 CCTCCCACCAGGGCAGCCACGGG - Intronic
1122800169 14:104225412-104225434 CTTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800236 14:104225692-104225714 CTTTCACTCAGAGCAGCCCCAGG - Intergenic
1124494018 15:30175500-30175522 CTTTCCCCATGGGGAGCCACGGG - Intergenic
1124630121 15:31331439-31331461 CCCTCCCCCAGGGCACACTCTGG + Intronic
1124641436 15:31398786-31398808 CTCTCCCCCAGGGCAGCTATAGG + Intronic
1124749551 15:32363146-32363168 CTTTCCCCATGGGGAGCCACAGG + Intergenic
1125061934 15:35436045-35436067 CCTGGCCCCAGGGCAGTCTCAGG + Intronic
1125860328 15:42993008-42993030 CTTCTCCCAAGGCCAGCCTCAGG - Intronic
1125973134 15:43928473-43928495 ATTTCACCCAGTGCTGCCTCAGG - Intronic
1127282311 15:57502896-57502918 CTTGGTCCCAGGGCAGCCCCTGG - Intronic
1127331345 15:57943113-57943135 CTTTCACCCAGGGCAGTCGTGGG + Intergenic
1128800285 15:70492788-70492810 CTAACCCCTAGGGCAGCCTTGGG + Intergenic
1128838583 15:70831293-70831315 CTGTACCCCAGGGCAGCCCCAGG - Exonic
1128944227 15:71810537-71810559 ATTTCTCCCGGGGCAGCCGCTGG - Exonic
1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG + Exonic
1129933605 15:79431898-79431920 CTTTCCTCCGCCGCAGCCTCTGG + Intergenic
1130322146 15:82850343-82850365 CTCAGCCCCAGGCCAGCCTCTGG + Intronic
1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG + Intergenic
1132206249 15:99988024-99988046 CCTTCCCCCAGCTCAGCCTCAGG + Intronic
1132444161 15:101896250-101896272 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1133774994 16:8889151-8889173 CTTTGTCCCAGGGAAGCCTCAGG + Intergenic
1136146161 16:28317772-28317794 CTTTCCCCCTGGGCTGCCTCAGG - Intronic
1136567039 16:31076784-31076806 CCTGACCCCAGGGCAGCTTCGGG + Exonic
1136585041 16:31179444-31179466 CTTTGCCCCTGGGGAGCCACGGG - Intergenic
1136610597 16:31362875-31362897 CTGGCCCACAGGGCTGCCTCTGG + Intronic
1136618178 16:31411016-31411038 CTGGCCCACAGGGCTGCCTCTGG + Intronic
1136933773 16:34440067-34440089 CTTTTCTCCTGGGTAGCCTCAGG - Intergenic
1136970799 16:34971747-34971769 CTTTTCTCCTGGGTAGCCTCAGG + Intergenic
1138809040 16:60127443-60127465 CTTCCCCCTAGGGCTGACTCTGG + Intergenic
1139430957 16:66910837-66910859 CCTTCCCCAGGGGCAGCCCCTGG + Intronic
1139619091 16:68122646-68122668 CTGAGCCCCAGGCCAGCCTCAGG + Exonic
1139671825 16:68497427-68497449 CCTTAGCCCAGGGCAGCCTGGGG + Intergenic
1140153208 16:72393793-72393815 GTTGCCTTCAGGGCAGCCTCTGG - Intergenic
1141446419 16:84061545-84061567 CTTCTCCCCAGGAGAGCCTCTGG - Intronic
1141720267 16:85751683-85751705 CTGGCCCCCTGGGCAGCTTCAGG + Intergenic
1141808514 16:86358053-86358075 CCTTCCCCCACTGCAGCCTCGGG + Intergenic
1142039022 16:87880938-87880960 CTTGCACCCAGGGCAGCAGCAGG - Intergenic
1142579008 17:929205-929227 CTTTCCCCGAGGGCTGGCTGCGG + Intronic
1142693553 17:1621210-1621232 CTTTGCCTCAGGGGAGCCTGGGG - Intronic
1142737809 17:1912647-1912669 CTTGCCCACAAGGCACCCTCAGG - Intergenic
1145976454 17:28986858-28986880 CTGTCACCCACCGCAGCCTCTGG + Intronic
1145995183 17:29100887-29100909 CTTTTTCCAAGGCCAGCCTCAGG - Intronic
1146277632 17:31525275-31525297 CTATCCCACAGGGCTGCCCCAGG - Intronic
1146581134 17:34039953-34039975 CTCTCCCCCTGGGCAGGCCCGGG + Intronic
1147175472 17:38653508-38653530 CTTTCTCCCAGGGTTGCCTGGGG + Intergenic
1148123236 17:45224297-45224319 CTTTAGCCCTGGGCAGCCTCAGG - Intronic
1148760418 17:49997005-49997027 CTTTCCCACGCGGCGGCCTCCGG - Intergenic
1148960982 17:51392570-51392592 GTCTCCCACAGGTCAGCCTCAGG - Intergenic
1148974149 17:51512108-51512130 CATTGGCCCAGGGCAGCCCCTGG + Intergenic
1149421842 17:56519305-56519327 CTTTCCCCCAAGGCAAAGTCAGG + Intergenic
1150108631 17:62479193-62479215 CTCTCCCCCTGGGCAGGCCCGGG - Exonic
1150253405 17:63723315-63723337 CTCTACCCCAGAGCAGCCTCCGG - Exonic
1151625234 17:75271808-75271830 CTGTCACCCAGGGCAGACGCCGG - Intergenic
1151713883 17:75821742-75821764 CTGGCCCCCAGGGCAGCCCCGGG - Intronic
1152143302 17:78551472-78551494 GTTTGCCCCAGGGCAGCCCCAGG + Intronic
1152310518 17:79547114-79547136 CTGAACCCCAGGGCAGACTCAGG - Intergenic
1152405372 17:80095252-80095274 CTGTCTCCCAGGTCAGGCTCGGG + Exonic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152699572 17:81812305-81812327 CTGTCTCCTGGGGCAGCCTCAGG - Intronic
1152945765 17:83196634-83196656 CTTCTCCACAGGGCAGCCACGGG - Intergenic
1153925061 18:9828174-9828196 CTATTCCCCAGGGCAGGCGCAGG - Intronic
1153962807 18:10153872-10153894 CCTTCCATCATGGCAGCCTCAGG - Intergenic
1156856772 18:41791406-41791428 GTATCCCTCAGGGCAGCTTCTGG - Intergenic
1159211722 18:65331700-65331722 CTTTCCTCCATGGTAGCCTCAGG - Intergenic
1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1160715880 19:576328-576350 CTTGCCAGCTGGGCAGCCTCTGG + Intronic
1160765105 19:804151-804173 CCTTCCCAAAGGGCAGCCCCAGG - Exonic
1160839257 19:1138240-1138262 GTGTCCCCCAGGGCAGCCCCTGG - Intronic
1161470668 19:4455492-4455514 CTGCCCCCCTGGGCAGCCACAGG + Intronic
1162380495 19:10329041-10329063 CTTTCCACCAGAGCCGCCTGCGG - Exonic
1162460686 19:10812253-10812275 CTTTCCCCCAGGTGATCCGCAGG + Exonic
1163271756 19:16258729-16258751 CTGTTCCCCGGGGAAGCCTCAGG + Intergenic
1163976614 19:20858834-20858856 CTTTCCCCTAGGGGAGCGACTGG - Intronic
1164136387 19:22420585-22420607 CTTTTCCCCAGGGTATCCACTGG + Intronic
1165004643 19:32794931-32794953 CTTTCCCACAGGACAGTTTCTGG - Intronic
1165076255 19:33281448-33281470 CCTTCCCCCACAACAGCCTCTGG - Intergenic
1165898717 19:39158448-39158470 CCTTCCCCCTGCCCAGCCTCAGG + Intronic
1167159212 19:47756410-47756432 TCTCCCCCCAGGGCAGCCTGTGG - Intronic
925362439 2:3288918-3288940 CTGGCCCCCTGGGCAGCCACAGG + Intronic
926008152 2:9388787-9388809 AACTCCCCCAGGGCAGCCTGAGG + Intronic
926087060 2:10027219-10027241 CCTTCCCCAAAGGCAGCATCAGG - Intergenic
926823786 2:16882158-16882180 AGTTCCTCCAGGGCATCCTCAGG + Intergenic
926847215 2:17154582-17154604 CTTTCCTCCAGGCCAGACTGAGG - Intergenic
927153170 2:20207144-20207166 CTCTGCCCCAGGGCTGCCTCAGG - Intronic
927879784 2:26682242-26682264 CCCTCCCCCAGGGCAGTGTCAGG + Intergenic
929005299 2:37387667-37387689 CTGGCCCCCAGGGCAGCTGCTGG - Intergenic
929610975 2:43270387-43270409 CCTTTCCCCAGGGCACACTCTGG + Intronic
929670699 2:43874911-43874933 GTTTCCCCCAGGGCAGCAATGGG - Intronic
931431049 2:62209296-62209318 CTCTTCCCCAGGGCAGCCTTGGG + Intronic
932335730 2:70930432-70930454 CCTCCTCCCAGTGCAGCCTCTGG + Intronic
932620838 2:73264212-73264234 CTTTCCCCCTGGGTAGAATCTGG - Intronic
932816734 2:74867792-74867814 CCTTCTCTCAGGGCAGCCCCTGG + Intronic
933538690 2:83610620-83610642 CTTTTCCCCACCCCAGCCTCAGG - Intergenic
933650580 2:84846992-84847014 CTTCCCTCCAGGGCAGCCTGAGG - Intronic
934899061 2:98142525-98142547 CTTGCCCCCAGGGAGGCCTATGG - Intronic
936250814 2:110866950-110866972 CTTGCACCCTGGCCAGCCTCTGG - Intronic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
938274464 2:130005772-130005794 CTTTCACACAGGGAAGCCTGGGG + Intergenic
938440909 2:131331508-131331530 CTTTCACACAGGGAAGCCTGGGG - Intronic
940509620 2:154596649-154596671 CCTTCCCCCATCCCAGCCTCTGG - Intergenic
941429492 2:165395788-165395810 CTTTCCCACAGAGAAGACTCAGG - Intergenic
943345730 2:186734912-186734934 CTTTGCCCCAGGGCTGGCACCGG + Intronic
945841288 2:214890799-214890821 CTTTCCAGCAAGGCAGCCTCAGG + Intergenic
947525186 2:230873303-230873325 CTTTCCCCCAAGACTCCCTCCGG + Intronic
1168979672 20:1993921-1993943 CTTTGTCCCTGGGCAGCTTCTGG + Exonic
1169832859 20:9843166-9843188 CTTTCCCTCAGAACACCCTCAGG - Intergenic
1169856965 20:10113495-10113517 ATGTCCAGCAGGGCAGCCTCGGG - Intergenic
1170055596 20:12199591-12199613 CTTACCTCAAGGGCAGCTTCTGG - Intergenic
1170442119 20:16389765-16389787 ATTTCACCCAGGGTAGGCTCTGG + Intronic
1170847604 20:19975226-19975248 CAATCCCCCGGGGCGGCCTCAGG - Exonic
1171212346 20:23326745-23326767 CTGTCCACCAGGGCAGCCACTGG + Intergenic
1172133695 20:32673264-32673286 CTGTCCCCCATGGCAGCCACAGG - Intergenic
1172630988 20:36378046-36378068 CTGTCCCCCAGGAGAGCCCCTGG + Intronic
1173706283 20:45112343-45112365 CATTCCCCAAGGCCAGCCCCAGG - Intronic
1173750371 20:45470858-45470880 CTTTCCCGCAGGGCAGGCTTCGG - Intronic
1173799640 20:45886970-45886992 AGTCCCCCCAGGGCAGCCCCTGG + Exonic
1174096116 20:48090966-48090988 CTTTCCTGCAGTGCAGCCTTTGG + Intergenic
1174216418 20:48920110-48920132 CTTCCCCCAAGGGCAGCCATGGG - Intergenic
1175371724 20:58496865-58496887 CTTTCCTCCATGCCAGGCTCAGG - Intronic
1175466586 20:59193981-59194003 CTTTCTCCCAGCCCAGCCTCAGG + Exonic
1175996063 20:62812868-62812890 CCCTCAGCCAGGGCAGCCTCAGG + Exonic
1176048528 20:63104784-63104806 CTCTCCCCCAGGGCAGCTCGTGG - Intergenic
1176072791 20:63235667-63235689 CAGGCGCCCAGGGCAGCCTCCGG - Intergenic
1176369446 21:6053605-6053627 CTTGCCCCCGGGGCCTCCTCTGG - Intergenic
1178083153 21:29086456-29086478 ATTTCCCCCAGAGCATCATCAGG - Intronic
1179098187 21:38334312-38334334 TGTTCCCCCAGGGCAGCTACAGG - Intergenic
1179123611 21:38571860-38571882 CTCTCCTCCAGGACAGCCTACGG + Intronic
1179754073 21:43484936-43484958 CTTGCCCCCGGGGCCTCCTCTGG + Intergenic
1180014885 21:45075207-45075229 CTTGTACCCGGGGCAGCCTCTGG - Intronic
1181110664 22:20600918-20600940 CTCAGCCCCAGGGCAGCGTCTGG - Intergenic
1181943411 22:26496537-26496559 TTTTCCCCCAAGCCACCCTCAGG - Intronic
1182576509 22:31276678-31276700 CTGTCCGCCACGGCGGCCTCCGG - Intronic
1183027474 22:35076617-35076639 CTTTGCCGCTGGGCAGTCTCTGG - Intronic
1183724376 22:39580412-39580434 CTGACCCCCAGGGCAACCTCAGG + Intronic
1183748136 22:39704090-39704112 CTGTCCCCCAGGACAGGCTGAGG - Intergenic
1183898484 22:40987988-40988010 CCTTGCCCCAGCCCAGCCTCTGG + Intergenic
1183901568 22:41009780-41009802 CTCAGCCCCAGGTCAGCCTCTGG - Intergenic
1184001810 22:41680212-41680234 CATTCCCCCAGAGCATCCTGTGG + Intronic
1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG + Intergenic
1184714680 22:46274102-46274124 CACTCCCCCAGCTCAGCCTCAGG - Intronic
1184922685 22:47616523-47616545 CTTTCCCGCTGGGCACCCTTGGG + Intergenic
1184993219 22:48184404-48184426 CCTGCCCCCATGGCGGCCTCTGG + Intergenic
1185213654 22:49586321-49586343 CTTCCAGCCAGGGCAGGCTCAGG + Intronic
949394519 3:3600644-3600666 GTTTCCACCAGGTCAGCCTTAGG - Intergenic
950397027 3:12741379-12741401 CTGTCCCTCAGGGCAGCCCCAGG + Intronic
950584079 3:13880378-13880400 CTCCACCCGAGGGCAGCCTCTGG - Intergenic
950741085 3:15052354-15052376 CTTTGGCCCAGGGAAGCCCCTGG - Exonic
951619604 3:24586855-24586877 CTTCCCTCCAGTGCACCCTCTGG + Intergenic
952018018 3:28982466-28982488 CTGTCCCATAGGGCAGCCACTGG + Intergenic
952221417 3:31327510-31327532 CTGCCACCCAGTGCAGCCTCAGG - Intergenic
953033404 3:39192095-39192117 CTTCCTCCCAGGGAAGCTTCAGG - Intronic
953383833 3:42493512-42493534 CTGTCCCCCACTGCAGCCACAGG - Intronic
955207330 3:56908165-56908187 CTTCCCACCTGGGCAGCCACAGG + Intronic
956412886 3:68996712-68996734 CTTGCTGGCAGGGCAGCCTCAGG - Intronic
956841240 3:73142174-73142196 CTTTTCCCAAGGCCAGCCCCTGG + Intergenic
957080496 3:75632249-75632271 CTTTCCCTCAGGGCCGCATGTGG + Intergenic
957199701 3:77116771-77116793 CCTTAGCCCAGGGCAGCCTTTGG + Intronic
957870565 3:86085831-86085853 CTGTCACCCAGGGCAGCTTGAGG - Intergenic
959508047 3:107177034-107177056 GTTTCCCCCAGGCCATTCTCAGG + Intergenic
960155229 3:114291874-114291896 CTTTCCTCCAAGGCAGCCTCAGG + Intronic
961633977 3:128321487-128321509 CACTCCCCCAGGACAGTCTCTGG + Intronic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
962669085 3:137686611-137686633 CTTCCCCACAGGGAAGCTTCAGG - Intergenic
963000630 3:140678534-140678556 CTTTCCACAAGGGCCGCCTCAGG + Exonic
963004289 3:140711541-140711563 CTTTTTCCCAGGGCAGCCTTGGG + Intergenic
963776985 3:149449835-149449857 CTTTCCCCCAGAGAAGCCTCTGG + Intergenic
968443597 4:636804-636826 CCTGGCCCCAGGGCTGCCTCAGG + Intronic
968722686 4:2219332-2219354 CTTTCCGCCAGGGAAACCTGTGG - Intronic
968908110 4:3463743-3463765 CTTTCCAGCAGGGCAGACTGAGG + Intronic
969366033 4:6694692-6694714 CTTCCGCCCGGGGCAGCCTCCGG + Intronic
969444972 4:7239501-7239523 CTTTCACCCAGGGAAGGGTCTGG - Intronic
969841842 4:9888645-9888667 CTTTCCCACTGGGCTGACTCTGG - Intronic
969884348 4:10201927-10201949 CTTTCCCCCATGCTTGCCTCAGG - Intergenic
971720928 4:30244450-30244472 CTTTCCCTCTGGGCACCCACAGG + Intergenic
973229454 4:47824985-47825007 CTTTCCACCAGGGCAGCCGCAGG + Intronic
973735631 4:53868993-53869015 CTTTCCCCCAGGACAGCACCTGG + Intronic
976341297 4:83947986-83948008 TTTTCCCCAAGGGCAGCGTTTGG - Intergenic
978342547 4:107733948-107733970 CCTTCCCCCAGGGAGCCCTCTGG + Intergenic
981054184 4:140343189-140343211 CTTACCCCCAGGTCATGCTCTGG + Intronic
982221874 4:153131587-153131609 ATTTCTCACAGGGCAGCCACGGG - Intergenic
984768677 4:183419328-183419350 CTCTCCCTCGGGGCTGCCTCAGG - Intergenic
985067948 4:186142002-186142024 CTTTCCTCCAGGGAAGGCTGGGG - Intronic
985574412 5:666952-666974 CATTTCACCAGGGAAGCCTCTGG + Intronic
985787470 5:1904991-1905013 GTGTCCCCCAGGGAAGCCACAGG + Intergenic
987869639 5:23598560-23598582 CTGTCCCCCATCTCAGCCTCAGG - Intergenic
988159459 5:27501482-27501504 CTTTTCCCCAGTGTTGCCTCTGG + Intergenic
990264260 5:54058761-54058783 CTTTTCCCCATGGGAGCCACAGG + Intronic
990481921 5:56220032-56220054 CTCTCCCTCAGCTCAGCCTCCGG - Intronic
991113011 5:62923104-62923126 CCCTCCCTCAGGGCAGGCTCTGG - Intergenic
991635457 5:68699913-68699935 CTTTCCCCCACGACTCCCTCTGG + Intergenic
992553347 5:77880260-77880282 CTGTCCCCCAGGGCAGCCCCTGG - Intergenic
994242256 5:97437752-97437774 CTTGGCCCTGGGGCAGCCTCCGG + Intergenic
995418692 5:111938053-111938075 CTTTCCCTCAGGGTTTCCTCTGG + Intronic
996590866 5:125146512-125146534 CTTTCCCCCAAGCCAGACACTGG - Intergenic
997331139 5:133062786-133062808 CAATCTCCCAGGGCAGCCACAGG - Intronic
997359447 5:133285415-133285437 CTTTCCCTGAAGGCTGCCTCTGG + Intronic
997401933 5:133610693-133610715 CTGGCCCCCAGGACAGACTCTGG - Intronic
997668522 5:135651361-135651383 GTTTCCCCCAGGACTCCCTCAGG + Intergenic
997718249 5:136058019-136058041 CTGTCCCCCAGGGGTGCCTCAGG - Intronic
998282389 5:140823837-140823859 ACATCCACCAGGGCAGCCTCGGG - Exonic
999230033 5:150056330-150056352 CTTTCCCTCAGTGCATCCACCGG - Exonic
1000366299 5:160494395-160494417 CCTTCCTACAGGTCAGCCTCTGG + Intergenic
1001940427 5:175736115-175736137 CTCTCCCACAGGTCAGCATCTGG - Intergenic
1002736159 5:181387856-181387878 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG + Intergenic
1003477535 6:6497989-6498011 CATTGCCACAGAGCAGCCTCAGG - Intergenic
1005321518 6:24659909-24659931 CTTTCCAGCATGGCAGTCTCAGG - Intronic
1006025203 6:31142485-31142507 GTATCCCCCAGGGCAACCCCAGG + Exonic
1006257120 6:32840757-32840779 ATTTCCCCCAGGGAAGTTTCTGG - Exonic
1006718743 6:36136570-36136592 CCCTCCCCCAGGGAAGCCCCTGG + Intronic
1006729989 6:36229486-36229508 CTCTCCACCATGGAAGCCTCAGG - Intronic
1007582837 6:42969444-42969466 CTGTCCTCCAGGGCTGGCTCTGG - Intronic
1007765030 6:44155082-44155104 CTTTGCCCCGGGGCCGGCTCGGG - Exonic
1011084661 6:83525779-83525801 TTTTGCCCCAGGGCAGTCACTGG - Intergenic
1012487531 6:99738874-99738896 CTTTCCAGCATGGCAGCTTCAGG - Intergenic
1014104567 6:117547787-117547809 CTTTCCCCCCGGGTGCCCTCAGG - Intronic
1014272239 6:119348707-119348729 TTGTCCTCCAGGGCGGCCTCCGG + Exonic
1014913897 6:127121283-127121305 CTTTCCCCGGGCGCTGCCTCAGG + Intronic
1019031515 6:169017980-169018002 CTTGTCCCCAGGGCTCCCTCAGG + Intergenic
1019042484 6:169118561-169118583 CCGGGCCCCAGGGCAGCCTCAGG + Intergenic
1019241255 6:170663384-170663406 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1019329258 7:454632-454654 CTGTGTCCCAGGGCAGCCCCTGG - Intergenic
1019649702 7:2150208-2150230 CAGGCCCCCAGAGCAGCCTCGGG + Intronic
1022113894 7:27246662-27246684 CCTTCCTCCGGGGCAGCCTCCGG + Intronic
1022522801 7:31019003-31019025 CTTTTCCCCATGCCAGACTCAGG + Intergenic
1024241379 7:47439056-47439078 CTTGTCTCCAGGGCAGCCCCTGG + Intronic
1024294279 7:47830332-47830354 CTTTCCCACTAGGCAGCTTCAGG - Intronic
1024606632 7:51027454-51027476 CTTTCCCACAGGGCAGCCAGGGG + Intronic
1024648132 7:51385589-51385611 CTTTCCCCCAGCACAGCAGCAGG - Intergenic
1030060548 7:105617780-105617802 CTTTCAGCCAGGTCAGCATCTGG - Intronic
1031415613 7:121492710-121492732 CTTTCCCCCACCCCAACCTCTGG - Intergenic
1032037650 7:128531709-128531731 CTCTCCCCCTGGGCAGGCCCGGG - Intergenic
1032267584 7:130380022-130380044 CTTGTCCCCAAGGCAGCTTCAGG - Intergenic
1032554066 7:132813147-132813169 CTTTCCCCCTGAGAAGCCACTGG + Intronic
1032637654 7:133727536-133727558 CTAACCCCAAAGGCAGCCTCAGG - Intronic
1032787322 7:135211299-135211321 CTTCCCCCCAGCACTGCCTCCGG - Intronic
1033436603 7:141338695-141338717 CTGTCCCCCTGGCCAGCCACTGG + Intronic
1033579170 7:142715991-142716013 CTTCCCCACACGCCAGCCTCAGG + Intergenic
1033941554 7:146661217-146661239 GTTTCACCCAGGGCTGCCTGTGG - Intronic
1034337597 7:150333500-150333522 CTTCAACCCAGAGCAGCCTCGGG - Intronic
1035250989 7:157596705-157596727 GGTTCCCCCAGCGCAGCATCCGG - Intronic
1035506860 8:144711-144733 CTTTCCCCCATCGCAGCCTCAGG + Intergenic
1035672044 8:1425659-1425681 CTTGCCATCAGGGCAGTCTCAGG - Intergenic
1036036670 8:5027801-5027823 CTTTGCCCAAGGGCATCTTCTGG - Intergenic
1037982701 8:23266063-23266085 CCGTCCCCCAGGGCAGTATCTGG - Intergenic
1040385893 8:46914792-46914814 CCTTCTCCCAGTGTAGCCTCAGG + Intergenic
1040560417 8:48518645-48518667 CTTTCCCTCAGCACACCCTCTGG - Intergenic
1042427090 8:68661119-68661141 CCATGCCCCAGGGCAGTCTCAGG - Intronic
1045438250 8:102185884-102185906 CTTTCCCATCTGGCAGCCTCCGG + Intergenic
1047948238 8:129904431-129904453 CTTTCTCACAGGGCTTCCTCAGG + Intronic
1049354580 8:142181375-142181397 CTTCCCCCCAGTGCAGCAGCTGG - Intergenic
1049476950 8:142801284-142801306 CTTCCCTCCAGGGGAGCCTCTGG + Intergenic
1056804894 9:89721049-89721071 CCTTCCCCCTGGGCAGACTAAGG + Intergenic
1056926315 9:90837729-90837751 GCTTCCACGAGGGCAGCCTCAGG + Intronic
1057009851 9:91591279-91591301 CTCACCCCCAAGGCAGGCTCTGG - Intronic
1057433251 9:95015086-95015108 CTCTAGCCCAGGGTAGCCTCGGG - Intronic
1057955386 9:99403227-99403249 CAGTGCCCCAGGGCACCCTCTGG - Intergenic
1058809589 9:108626798-108626820 CCTTCCGCCACGGCCGCCTCTGG + Intergenic
1059512413 9:114861743-114861765 GTTTCCCAGAGTGCAGCCTCAGG - Intergenic
1060277843 9:122195428-122195450 CTATCCCCCAGTGGAGCCTAAGG - Intronic
1060920960 9:127419935-127419957 TGTTCCCCCAGGGCAGGCACGGG - Intergenic
1061239792 9:129362918-129362940 CGTCCCACCATGGCAGCCTCTGG - Intergenic
1062159218 9:135070504-135070526 CTTTCCCGCTGAGCTGCCTCAGG - Intergenic
1062181112 9:135191783-135191805 CTGGCCCCCAGGTCACCCTCGGG - Intergenic
1062524405 9:136972452-136972474 CCTGCCCCCAGGGCTGCCTTGGG - Intergenic
1062634055 9:137480720-137480742 CTTCCCGCCTGGGCAGCCCCGGG - Intronic
1203601447 Un_KI270748v1:12618-12640 CTTTCCCCCATCGCAGCCTCGGG - Intergenic
1187969812 X:24647866-24647888 GTTCCCCCTAGGGCAGCCCCAGG - Intronic
1189536155 X:41937185-41937207 CTTTCCTCCTGGGCTGCCTCTGG + Intergenic
1189576233 X:42356617-42356639 TTTTCCCCCAGAGGAACCTCAGG - Intergenic
1190202120 X:48371332-48371354 CTTTCGCCCAGGCCAGACTGCGG + Intergenic
1190208418 X:48424081-48424103 CTTTCGCCCAGGCCAGACTGCGG - Intergenic
1194857227 X:98947102-98947124 CTTTCCCACATGGCAGCTTAGGG + Intergenic
1195730578 X:107963286-107963308 CCTTCCCCCACTGCAGCCTCTGG + Intergenic
1199473863 X:148224672-148224694 CCTTACCCCATGGCAGACTCAGG + Intergenic
1200172249 X:154085739-154085761 CTTTCCCCCACCCCACCCTCTGG - Intronic