ID: 1129221599

View in Genome Browser
Species Human (GRCh38)
Location 15:74134638-74134660
Sequence GGTCAGGGGCCTGAGGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 364}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129221599 Original CRISPR GGTCAGGGGCCTGAGGCCGC AGG (reversed) Exonic
900179575 1:1305326-1305348 GGTCAGGGTCCAGGGGCTGCAGG - Intronic
900191836 1:1355394-1355416 GGGCAGGGGTCCGGGGCCGCGGG - Intronic
900225704 1:1532821-1532843 GGTCAGGGGCCTGGGAGCGCAGG - Intronic
900345734 1:2209520-2209542 GGGCTGGGCCCTGAGGGCGCTGG - Intronic
900794193 1:4698230-4698252 GCTAAGGGGCCTGAGGCCGGAGG + Intronic
900981303 1:6047720-6047742 GGTCAGGGGGCAGTGGCAGCAGG + Intronic
903133044 1:21291414-21291436 GGTGAGGGGCCTGACGTCACAGG + Intronic
903138935 1:21327005-21327027 GGGCAGGGTCCTGAGGGCCCTGG + Intronic
903193235 1:21668320-21668342 GGTCAGGCCCCTGGGGCGGCAGG - Intronic
903231852 1:21927071-21927093 GGGAAGGGGCCAGAGGCAGCTGG + Intronic
903236993 1:21956626-21956648 GGTCAGGGTCCTCAGGTCTCTGG - Intergenic
905019306 1:34797495-34797517 GGTGAGAGGCCAGAGGCTGCAGG + Intronic
905803804 1:40861986-40862008 GGACAGTGGGCTGAGGCCGCGGG - Exonic
905880610 1:41460938-41460960 ACTCAGGGGCCTGAGGCTGGAGG - Intergenic
906533785 1:46539987-46540009 GGACAGGGGGCTGGGGCCCCTGG - Intergenic
906614520 1:47225421-47225443 GGTCAGGGGCCAGGGGCCAGGGG - Exonic
906719985 1:47997416-47997438 GGGCTGGGGGCTGGGGCCGCTGG + Intergenic
907269315 1:53281331-53281353 AATCAGGGGCCTGAAGCCCCAGG + Intronic
907591116 1:55672525-55672547 GCTCAGGAGCCTGAGGCAGGAGG - Intergenic
909933443 1:81524794-81524816 GGTCAGGGGGCTGAGGCAGGAGG + Intronic
913163357 1:116165118-116165140 AGTGAGGGGCCTGAGGCCCAGGG - Intergenic
916408192 1:164518428-164518450 GCTCAGGGGGCTGAGGCAGAAGG + Intergenic
917817469 1:178725419-178725441 GGTCGGTGGGCTCAGGCCGCGGG + Exonic
918057902 1:181038553-181038575 GGTCTGGAGCCTGTGGCCCCAGG + Intronic
920505505 1:206512758-206512780 GGTCAGGGGCCAGAGGCTCAGGG + Intronic
922359733 1:224810489-224810511 GGCCTGGGGCCTGAGGCTGCTGG - Intergenic
922701532 1:227763935-227763957 GCACAGGGGCCTGTGGCCTCAGG + Intronic
923093314 1:230755561-230755583 GTGCAGGGGCTTGAGGCCACTGG - Intronic
923744995 1:236692075-236692097 GGACAAGGGCCTGAGGCTGGGGG + Intronic
924668260 1:246095797-246095819 GCTCAGGAGCTTGAGGCTGCAGG + Intronic
1064133005 10:12726914-12726936 GCACAGGGGCCTGAGGGGGCTGG - Intronic
1064251285 10:13708221-13708243 GGTCAGGAGCCTGAGGTCCGAGG - Intronic
1065022327 10:21510389-21510411 GGTCAGTGGCCGGGGGCTGCTGG - Intergenic
1067031935 10:42884178-42884200 GGGAAGGGGCCTGGGGCCGTGGG + Intergenic
1067136287 10:43609779-43609801 ACTCAGGGGCCTGAGGCAGGAGG - Intronic
1067139925 10:43648531-43648553 GGCCCGGGGCCTGAGGCGGGAGG - Intronic
1067473785 10:46553525-46553547 CCTCAGGGGCCAGAGGCTGCTGG - Intronic
1067525232 10:47034661-47034683 TGTCAGGCCACTGAGGCCGCAGG - Intergenic
1068955861 10:62818222-62818244 GGTCAGGGCCCTGAGGCTGCCGG + Intronic
1069109288 10:64425220-64425242 GGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1069195867 10:65550679-65550701 GGACAGGGGCATGAGCCCCCTGG + Intergenic
1069849831 10:71397473-71397495 GGCCAGGGGCCTGGGACCGAAGG - Intronic
1070257297 10:74824338-74824360 TGTCAGTGGCATGAGGCTGCAGG + Intergenic
1070351518 10:75597369-75597391 GGGCAGGGGTCTGAGGCCACTGG - Intronic
1070704263 10:78626396-78626418 GCTCTGGGGCCTGATGCAGCAGG + Intergenic
1071399058 10:85251611-85251633 AGTCAGGGGACTGGGGCCTCAGG - Intergenic
1071501677 10:86208475-86208497 GGTGAGGAGCATGAGGCTGCAGG - Intronic
1072159435 10:92752563-92752585 GCTCAGGAGGCTGAGGCGGCAGG + Intergenic
1073225082 10:101911491-101911513 GCTCAGGGGACTGAGGCGGGAGG + Intronic
1075906330 10:126084826-126084848 GATCAGGAGCCTGAGGCTGCAGG + Intronic
1076315852 10:129540968-129540990 GGGCAGGGGCCAGAGCCAGCAGG - Intronic
1076696228 10:132248680-132248702 GGTCAGGGGCCTGGCACAGCAGG - Intronic
1076806029 10:132859231-132859253 CGTCAGGTGCCTGAGCCTGCGGG - Exonic
1076843071 10:133056124-133056146 GGGCACAGGCCTGAGGCTGCAGG + Intergenic
1077124463 11:926204-926226 GGCCCGGGGCCTGAGGGTGCGGG + Intronic
1077233545 11:1469219-1469241 AGGCAGGGGGCTGAGGCAGCTGG + Intergenic
1077235523 11:1480311-1480333 GGACAGGAGCCTGGGGCAGCGGG + Intronic
1077279750 11:1737962-1737984 GGGCAGGAGGCTGAGGCAGCTGG + Intronic
1077303368 11:1857068-1857090 GGTAAGGGGTCTGAGGCATCTGG + Intronic
1077445456 11:2588576-2588598 GGACAGGGACCTGAGGCCTGGGG - Intronic
1077576276 11:3386415-3386437 GGCCAGGGGCCTGAGGAAGAAGG + Intergenic
1078447234 11:11413475-11413497 GTTAAGGGGCCTGAGGGAGCTGG - Intronic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1081811931 11:45918900-45918922 GGCCAGTGGCCTGAGGGAGCGGG + Intergenic
1081863831 11:46348754-46348776 GGTAAGGGACGTGAGGCCCCAGG + Intronic
1082001243 11:47394752-47394774 GGTCTGGGGCCTAGGGCTGCTGG + Intergenic
1083747528 11:64744242-64744264 AGTCAGGGAGCTGGGGCCGCAGG - Intronic
1083755600 11:64790111-64790133 GCTCAGGGGCCTGGGGCTGGCGG - Intronic
1083894678 11:65613988-65614010 GGTGAGGCGCCGGAGGCCCCGGG - Exonic
1083951102 11:65956738-65956760 GGTCAGGAGTCTGAGACAGCTGG - Intronic
1084963904 11:72733430-72733452 AGTCAGGGGCATGAGACCCCAGG + Intronic
1085210618 11:74774235-74774257 GCTCAGGAGGCTGAGGCAGCAGG + Intronic
1086420204 11:86631051-86631073 GGTCTGGGGCCTGAGGCCCTGGG + Intronic
1088462299 11:110093721-110093743 GGACCGGTGCCTTAGGCCGCGGG - Intronic
1089564687 11:119364371-119364393 GGTCAGCGGGCTGGGGGCGCCGG - Intronic
1090378835 11:126310820-126310842 GGACAGAGGGCTGAGGCTGCAGG - Intronic
1091370414 11:135052843-135052865 GCTCAGGGGGCTGAGGCAGGAGG - Intergenic
1091546318 12:1503515-1503537 GGGCAGGTGCCTGAGGTGGCAGG - Intergenic
1091652322 12:2319474-2319496 TGTCAGGGGCCTGGGGCCTGGGG - Intronic
1092220663 12:6710866-6710888 GGTCAGGAGGCTGAGGCAGGAGG + Intergenic
1093289334 12:17301828-17301850 GGTCAGGTACCTGAGGGAGCAGG - Intergenic
1094821990 12:34233120-34233142 GCTCAGGAGGCTGAGGCAGCAGG + Intergenic
1095099307 12:38163775-38163797 GGGCAGGGGACGGAGGCCTCTGG - Intergenic
1097022303 12:56028974-56028996 GGTGTGGGGCCTGAGGCAGATGG - Intronic
1097106679 12:56630087-56630109 GGCCAGGGGCCTGAGGGGGAGGG - Intronic
1098245644 12:68514349-68514371 GGTCGGGGGCCAGGGGCCGGGGG + Intergenic
1102505459 12:113381637-113381659 GGGAAGGGGACTGAGGCAGCTGG + Intronic
1103703624 12:122860210-122860232 GGTGAGGGGCCGGCGGCAGCAGG + Exonic
1104464658 12:128980532-128980554 GGTGAGTGGCCTGGGGCCACTGG + Intronic
1104762388 12:131305281-131305303 GGGCAGGGGCCTGAGATCTCCGG - Intergenic
1104954694 12:132458470-132458492 GGTGAGGAGACTGAGGCCGAGGG + Intergenic
1106246435 13:27954066-27954088 GGCCAGACGCCGGAGGCCGCGGG + Intergenic
1107490474 13:40876413-40876435 GGTCAGGTGCTTGAGGGAGCAGG + Intergenic
1107507274 13:41047496-41047518 GGTCAGGACCCTCAGGCTGCAGG + Intronic
1108638883 13:52363338-52363360 AGTCAGGGGGCTGAGGCAGGAGG + Intergenic
1108651059 13:52480213-52480235 AGTCAGGGGGCTGAGGCAGGAGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113229938 13:108202296-108202318 GGTCAGGCGGCTGAGGCAGAAGG + Intergenic
1113708706 13:112450268-112450290 TGTGAGGGACCTGAGGCTGCTGG - Intergenic
1113737605 13:112689829-112689851 GGGCAGAGGTCAGAGGCCGCGGG - Intergenic
1113776194 13:112946915-112946937 AGTCACGGGCCTGAGGACCCAGG + Intronic
1113800779 13:113085347-113085369 TGTTAGGGGTCTGAGGACGCAGG + Intronic
1114031362 14:18583646-18583668 GGTGAGGAACCTGAGGTCGCAGG + Intergenic
1114049668 14:18912957-18912979 GGGCATGAGCCTGAGGCAGCTGG + Intergenic
1114112893 14:19488974-19488996 GGGCATGAGCCTGAGGCAGCTGG - Intergenic
1116887142 14:50232031-50232053 GGTGCGGGGCCTGGGGCCCCGGG + Intergenic
1117253216 14:53955023-53955045 GGTCCGGGTGCGGAGGCCGCGGG + Intronic
1117872219 14:60213069-60213091 GGACAGGAGTCTGAGGCCACAGG - Intergenic
1119386706 14:74261763-74261785 GCTCAGGGGCCCGAGGACCCAGG - Exonic
1119391849 14:74296184-74296206 GGGCAGGGGCCTGAGCACGTGGG + Intronic
1122424650 14:101598868-101598890 GGGCAGGGGCCTGGGGCTGGAGG - Intergenic
1122472842 14:101983588-101983610 CGTCAGGGTCCTGAGGCCACAGG + Exonic
1123033483 14:105462074-105462096 GCTCAGGGGACTGCGGCTGCGGG + Intronic
1123500448 15:20877306-20877328 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123557693 15:21450999-21451021 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1123593920 15:21888280-21888302 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1124081419 15:26501621-26501643 GGTCAGAGTCATGAGGCCCCTGG - Intergenic
1124645954 15:31437665-31437687 GGGCTGGGGGCTGAGGCTGCTGG + Intergenic
1125704866 15:41725227-41725249 ACTCAGGAGGCTGAGGCCGCAGG + Intronic
1125724670 15:41862207-41862229 GGTCAGCGCCCAGAGGCTGCGGG - Exonic
1125968549 15:43893694-43893716 GGTGTGGGGGCTGAGGCTGCTGG + Intronic
1126709643 15:51442649-51442671 GGTCTGGGTCCTGAGTCTGCAGG + Intergenic
1126709920 15:51443884-51443906 AGTGAGGGGCCTGGGGCTGCAGG + Intergenic
1127979610 15:64024913-64024935 GATCAGGGTCCTAAGGCCTCAGG + Intronic
1128103101 15:65021734-65021756 GCTCAGGAGGCTGAGGCAGCAGG + Intronic
1129221599 15:74134638-74134660 GGTCAGGGGCCTGAGGCCGCAGG - Exonic
1129326143 15:74801173-74801195 GGTCGGGGGACTGAGGGAGCAGG - Intronic
1129332444 15:74834589-74834611 GGCCTGGGGACTGAGGCTGCTGG - Intergenic
1130231803 15:82102949-82102971 GCTCAGGGCCCTCAGACCGCAGG - Intergenic
1202966045 15_KI270727v1_random:178171-178193 GGCCAGGGGCCAGGGGCCGCAGG - Intergenic
1133012850 16:2924586-2924608 GGCCAGGGCCCTGAGTCTGCAGG - Intronic
1136226786 16:28865225-28865247 AGTCTGGGGCCAGAGGCCGCAGG - Intronic
1136287206 16:29251593-29251615 GGTGACGGTCCTGGGGCCGCTGG - Intergenic
1136385897 16:29925923-29925945 GGTCAGCGGCTTGAGACCGTAGG + Exonic
1137727731 16:50668375-50668397 GGCCCTGAGCCTGAGGCCGCTGG - Intronic
1139440274 16:66963294-66963316 GGTCAGGGCCCAGTGGCGGCTGG - Exonic
1139849743 16:69943777-69943799 GTTCAGGGCCCTGAAGCAGCTGG - Intergenic
1139878737 16:70166774-70166796 GTTCAGGGCCCTGAAGCAGCTGG - Intergenic
1140373779 16:74428718-74428740 GTTCAGGGCCCTGAAGCAGCTGG + Intergenic
1140478849 16:75251806-75251828 GGGCAGGGGCCTGGAGCCTCGGG - Intronic
1142131591 16:88433841-88433863 GGGCAGGGGCCCAAGGCTGCAGG - Exonic
1142261880 16:89046714-89046736 GGTCAGGGGCCTGGGGTCTCAGG + Intergenic
1143166706 17:4900528-4900550 AGTTAGGGGCCAGAGGCGGCGGG + Exonic
1144578438 17:16444286-16444308 TGTCAGGGGACTGAGGTCCCTGG - Intronic
1144773871 17:17774428-17774450 TTTCAGGGGCCTGGGGCCGCAGG + Intronic
1144857812 17:18279793-18279815 GGTCAGGAGGCTGAGGCAGGAGG - Intronic
1144947331 17:18976611-18976633 GGTCAGGGGACTGAGTCCCTGGG + Intronic
1144949896 17:18988538-18988560 GGTCCCGGGCCTGAGGCTCCAGG - Intronic
1145766054 17:27458848-27458870 GGTGAGGAGGCTGAGGCCTCCGG - Intronic
1146017638 17:29246804-29246826 GGCCAGAGGCCAGAGGCCGCAGG + Intergenic
1146451291 17:32976131-32976153 GGTCAGGGAGCTTAGGCCACAGG + Intronic
1147879780 17:43646164-43646186 GGCCTGGAGCCAGAGGCCGCCGG - Intronic
1148694008 17:49548386-49548408 GGGCAGGGGCCTGAGCAAGCAGG + Intergenic
1149076154 17:52597729-52597751 GGTCAGGTGCCTGAGGGAGCAGG - Intergenic
1149427612 17:56570218-56570240 GGTATGGGGCCTCAGGCCTCAGG + Intergenic
1150490639 17:65572104-65572126 GGTCAGGGGGCTGAGGTGGGAGG + Intronic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150809288 17:68344141-68344163 GTTCAGGGGCCTAAAGTCGCTGG - Intronic
1151682646 17:75629946-75629968 GGTCAGTTGCCTGTGGCCACTGG - Intronic
1151975373 17:77481163-77481185 GGTCAGAGGCCTGGGGCTGGGGG - Intronic
1152579651 17:81160325-81160347 GGTCAGGGGGCTGCGGCCTTGGG - Intronic
1152644934 17:81464407-81464429 GGGCAGGGGGCAGAGGCCACGGG + Exonic
1152710725 17:81869520-81869542 GGTGAGTGCCCTGCGGCCGCGGG - Exonic
1154197976 18:12279961-12279983 GGTCCAGGCCCTGAGCCCGCTGG - Intergenic
1157329235 18:46691211-46691233 GATCAGGTGCCAGAGGCCTCTGG - Intronic
1157485512 18:48084255-48084277 GATCAGGGGCCAGAGGTCGGGGG + Intronic
1160786532 19:902533-902555 ACTCAGGGGCCTGAGGCAGGAGG + Intronic
1161087023 19:2340047-2340069 GGGCAGGGCCGTGAGGCCGGGGG - Intronic
1161093347 19:2374726-2374748 GGTAAGGGGCCAGAGCCAGCCGG - Intergenic
1161286900 19:3473037-3473059 GCTCAGGAGGCTGAGGCAGCAGG + Intergenic
1161624992 19:5321162-5321184 GCTCAGGGGGCTGAGGCAGGAGG + Intronic
1161773354 19:6243265-6243287 GGGCAGGGGCCGGGGGCTGCCGG - Intronic
1161797184 19:6393826-6393848 GGGCAGGGCTCTGAGGCCCCAGG + Intronic
1162125918 19:8499465-8499487 GGTCAGTGACCTCAGGCGGCGGG + Exonic
1162125929 19:8499501-8499523 GGTCAGTGACCTCAGGCGGCGGG + Exonic
1162125940 19:8499537-8499559 GGTCAGTGACCTCAGGCGGCGGG + Exonic
1162125951 19:8499573-8499595 GGTCAGTGACCTCAGGCGGCGGG + Exonic
1162267036 19:9584304-9584326 GGCCAGTGGCTAGAGGCCGCAGG - Intronic
1162382696 19:10340785-10340807 GGTCAGAGGCCTGAGGTCAGAGG - Intergenic
1162534800 19:11256513-11256535 GGTCAGTGGCCTGAGCCCTGAGG - Intronic
1162935425 19:13979363-13979385 GTGCAGGCCCCTGAGGCCGCAGG - Intronic
1163123424 19:15231743-15231765 GGCCAGGGGCCTGAGGCCCACGG - Intronic
1163309315 19:16503671-16503693 GGTCAGGAGGCTGAGGCAGGCGG - Intronic
1163437929 19:17306298-17306320 GGTCCGGCGCCTGAGCACGCCGG + Exonic
1163530686 19:17847255-17847277 ACTCAGGGGGCTGAGGCAGCAGG + Intronic
1163767189 19:19170261-19170283 GATCAGGGGCCCGCGGCCGCAGG + Intronic
1164481092 19:28611480-28611502 GGTCAGGTGCCTGAGGGAGCAGG - Intergenic
1164564422 19:29315730-29315752 AGTGTGGGGCCTGAGGCCACTGG - Intergenic
1164855494 19:31517638-31517660 GGGCTGTGGCCAGAGGCCGCGGG + Intergenic
1164995462 19:32717925-32717947 GCTCAGGGGGCTGAGGCGGAAGG + Intergenic
1166174306 19:41055102-41055124 GGTGAAGAGCCTGAGGCCGTGGG + Intergenic
1166383853 19:42369732-42369754 GGTCGGGGGTCTGAGGCTCCGGG - Intronic
1166857928 19:45792497-45792519 GGTCCGGGGCCTGCGGGCGGCGG + Exonic
1166895173 19:46018239-46018261 TGTGAGGGGCCTGAAGCCCCAGG - Intronic
1167214198 19:48153602-48153624 GGGCAGGGGCCTGAGAGCTCAGG - Intronic
1167591834 19:50408487-50408509 ACTCAGGGGCCTGAGGCAGGAGG - Intronic
1168467888 19:56618797-56618819 GCTGAGGGCCCTGAGGCTGCTGG + Intronic
927125990 2:20012701-20012723 GGGGCGGGGCCCGAGGCCGCGGG - Intergenic
927129402 2:20045355-20045377 GGTCAGGTGCCTGAGGTGGGAGG + Intronic
927138482 2:20114195-20114217 GATCCGGAGCCTGAGGCTGCAGG - Intergenic
927278228 2:21279742-21279764 GGTCCGGGGGCTGTGGCAGCAGG - Intergenic
927645006 2:24872063-24872085 CAGCAGGGCCCTGAGGCCGCAGG + Intronic
927848288 2:26483375-26483397 GGTGTGGGGCCTGGGGCAGCTGG - Intronic
929619702 2:43342104-43342126 GCTCAGGGGACTGAGGCGGAGGG + Intronic
930518584 2:52435736-52435758 GGTCACGTGCCTGAGGGAGCAGG - Intergenic
931698353 2:64889007-64889029 GGTCAGGTACCTGAGGGAGCAGG + Intergenic
931712136 2:64997480-64997502 GGTCAGCTGCCTGAGGCCAGGGG - Intronic
932268379 2:70387594-70387616 GGCCAGGAGCCTGAGGCCCTGGG - Intergenic
932369032 2:71172613-71172635 GGGCAGGAGACTGAGGCCCCAGG + Intergenic
932866441 2:75347852-75347874 GGGCAGGGGCCTGGGGCAGCAGG + Intergenic
935301574 2:101697779-101697801 GCGCCGGGGCCTGAGGCGGCGGG + Intronic
938288564 2:130137600-130137622 GGGCATGAGCCTGAGGCAGCTGG - Intergenic
938467968 2:131535334-131535356 GGGCATGAGCCTGAGGCAGCTGG + Intergenic
938496840 2:131802149-131802171 GGTGAGGAACCTGAGGTCGCAGG - Intergenic
938647197 2:133344009-133344031 GGTAAGGGGCCAGAGACTGCGGG + Intronic
941259545 2:163279539-163279561 GGTCAGGAGGCTGAGGCTGTAGG + Intergenic
942113795 2:172707600-172707622 GGTCAGGGACCTCAGGACCCAGG - Intergenic
945253389 2:207783479-207783501 GCTCAGGAGGCTGAGGCTGCAGG + Intergenic
946758014 2:222965824-222965846 GGTCAAGGGCCTGAGGGGGTTGG + Intergenic
947137260 2:226987654-226987676 GATGAGGGGCCTGAGGCCCAGGG + Intronic
948465019 2:238148145-238148167 TGTGAGAGGCCTGCGGCCGCCGG - Intronic
948887082 2:240889805-240889827 GGTCAAGGGAATGTGGCCGCGGG - Intronic
1169640495 20:7745342-7745364 GCTCAGGGGCCTGAGGCAGGAGG + Intergenic
1171823092 20:29873790-29873812 GGGCAGGGGACGGAGGCCTCTGG + Intergenic
1171897011 20:30816521-30816543 AGGCAGGGGACTGAGGCCTCCGG - Intergenic
1172484858 20:35292003-35292025 GCTCAGGGGCAGGAGGCCTCCGG - Exonic
1173827976 20:46059175-46059197 GGTCAGGGCCCTGGGGCTGGAGG - Intronic
1173837484 20:46135499-46135521 ACTCAGGGGCCTGAGGCGGGAGG - Intergenic
1175116245 20:56684602-56684624 GGCCAGGGGCCTGAGGCTGGAGG + Intergenic
1175806984 20:61835157-61835179 GCTCAGGGGGCTGAGGCGGGAGG - Intronic
1175810139 20:61853334-61853356 AGTCAGAGGGCTGAGGCCACTGG + Intronic
1176008499 20:62879768-62879790 GGACAGGGCCCCGAGGCCGACGG - Exonic
1176147901 20:63573604-63573626 AGTCAGGAGCCTGAGGCCCTGGG - Intronic
1176200683 20:63858925-63858947 GGTCAGCGGGCTGGAGCCGCTGG - Intergenic
1176243096 20:64084072-64084094 GGGCTGGGCCCTGACGCCGCAGG - Exonic
1176284282 21:5011097-5011119 GCTCAGGGGGCTGAGGCAGGAGG + Intergenic
1179502667 21:41819901-41819923 GGTGAGGGGGCTGGGGGCGCTGG + Intronic
1179711154 21:43263977-43263999 GGTGTGGGCCCTGAGGCCTCTGG + Intergenic
1179872899 21:44252378-44252400 GCTCAGGGGGCTGAGGCAGGAGG - Intronic
1179912384 21:44456977-44456999 GGCCGGGGGCCTGCGGCTGCTGG + Exonic
1180028122 21:45180285-45180307 GGTTAGGGGCCAGATGCAGCTGG - Intronic
1180064603 21:45405952-45405974 GGACAGAGGCCTGAGGGCGGCGG - Intronic
1180064775 21:45406660-45406682 GGTCTGGGCCCTGTGGGCGCTGG - Intronic
1180109463 21:45641432-45641454 GGGCAGGCAGCTGAGGCCGCAGG + Intergenic
1180233078 21:46439442-46439464 GGTCAGGAGGCTGAGGCAGGAGG - Intronic
1180455475 22:15510703-15510725 GGTGAGGAACCTGAGGTCGCAGG + Intergenic
1180468147 22:15635332-15635354 GGGCATGAGCCTGAGGCAGCTGG + Intergenic
1180713314 22:17854758-17854780 TGTCATGTGCATGAGGCCGCAGG + Intronic
1181042049 22:20196926-20196948 CCCCAGGGGCCCGAGGCCGCAGG - Intergenic
1181570784 22:23767001-23767023 GGTCTGGGCACTGTGGCCGCTGG - Intronic
1181669532 22:24419700-24419722 GGTCATGGGGCTGGGGCCACAGG + Intronic
1182031263 22:27161132-27161154 GGTCAGGGGCCTTAAGGCCCAGG - Intergenic
1182122989 22:27798989-27799011 GGTCCGGGGCCGGATGCTGCAGG + Exonic
1183391576 22:37548225-37548247 TGCCAGGGCCCTGAGGCAGCAGG + Intergenic
1183428454 22:37751828-37751850 GGTAAGAGGACTGAGGCCGGAGG + Exonic
1183486377 22:38089444-38089466 GGCTGGGGGCCTGAGGCCCCGGG + Intronic
1184094563 22:42309517-42309539 GCTCAGGAGCCTGGGGCAGCGGG - Intronic
1184453635 22:44597196-44597218 GGGCAGGGGCAGGAGGCTGCAGG + Intergenic
1184506193 22:44904914-44904936 GGTCATCTGCCTGAGGCTGCTGG + Intronic
1184679287 22:46061710-46061732 GGTCCGGGGCCTGCGTCCGAGGG - Intronic
1185101804 22:48844603-48844625 GGTCAGGGAACCCAGGCCGCAGG - Intronic
1185161488 22:49232562-49232584 GTTCAGGGACCTGAGGCTGCAGG - Intergenic
1185208651 22:49554433-49554455 GGCCAGGGGCCGGGGGCCTCAGG + Intronic
1185415064 22:50705294-50705316 GGTCAGGGGTCAAAGGCCTCAGG - Intergenic
1185420245 22:50730915-50730937 GGTGGGGGGCGTGAGGCCGAAGG - Intergenic
949158148 3:851368-851390 GGTCAGGTGCCTGAAGGAGCAGG - Intergenic
950548878 3:13654776-13654798 GGTCAGGGGCATCAGGACCCAGG + Intergenic
950642862 3:14359785-14359807 GGTCAGGGCCCTAAGGCCTGTGG + Intergenic
953901295 3:46845643-46845665 GGCCAGGGCCCTGAGGCGGGAGG + Intergenic
955311846 3:57895833-57895855 GCTCAGGGGGCTGAGGCAGGAGG + Intronic
957022529 3:75141170-75141192 GGTCAGGTTCCTGAGGGAGCAGG - Intergenic
960963135 3:123085759-123085781 GGTCAGAGTCCTGAGGCCCTGGG + Intronic
961467152 3:127088933-127088955 GGTGAGGGCCCAGAGGCCCCAGG - Intergenic
961561225 3:127731729-127731751 GGTCAGGGGCCAGAGGGAGAGGG - Intronic
963205527 3:142630310-142630332 GCTCAGGGGGCTGAGGCGGGAGG + Intronic
964794678 3:160483893-160483915 GGCCACGGGCCTGAGGCAGAGGG + Intronic
965289873 3:166865312-166865334 CTGCAGGGGCCTGAGGCAGCAGG - Intergenic
965787296 3:172349173-172349195 GCTCAGGAGCCTGAGGCAGGAGG + Intronic
967933226 3:194705794-194705816 GGTCAGTGGGGTGAGGCCGTGGG - Intergenic
967969141 3:194986359-194986381 GGTCAGCTGCCTTAGGCCACAGG - Intergenic
968079460 3:195836058-195836080 GGACAGGGGCCTGATGCGGGAGG - Intergenic
968582885 4:1403115-1403137 GCTGAGCGGGCTGAGGCCGCCGG + Exonic
968628401 4:1638132-1638154 GGTCACCTGCCTGAGGCCGGGGG - Intronic
968653059 4:1767544-1767566 GGTCCCGGGCGCGAGGCCGCCGG + Intergenic
968703315 4:2066811-2066833 GCTCAGGGGCCTGGGGCTCCTGG + Exonic
968738806 4:2316449-2316471 GCTCAGGAGGCTGAGGCCGGAGG - Intronic
968898061 4:3416471-3416493 GGTCATGGGCATTAGGCCCCAGG + Intronic
969573249 4:8022446-8022468 TTGGAGGGGCCTGAGGCCGCAGG + Intronic
969631884 4:8343737-8343759 AGTCTGGGGCCTGAGGAGGCAGG - Intergenic
969817840 4:9699379-9699401 GGTCAGGGTCCTGTGGAGGCTGG + Intergenic
971244146 4:24913124-24913146 GGTCGCGGGGCTGAGGGCGCGGG - Intronic
973820401 4:54657797-54657819 GAGCAGGGGCCAGACGCCGCCGG + Intergenic
974514902 4:62896932-62896954 GGGCAGGGGCCTGAGCTCCCAGG + Intergenic
975195438 4:71518529-71518551 GGCCTGGAGCCTGAGGCCACAGG + Intronic
975448807 4:74500585-74500607 TGTCAGAGGCCTGAGGTCCCTGG + Intergenic
979638902 4:122989402-122989424 GGGCTGGAGCCTGAGGCCACAGG + Intronic
984891593 4:184498802-184498824 GGCCAAGGGCCTGAGGCAGGTGG + Intergenic
985445101 4:190017447-190017469 GGGCAGGGGACTGAGGTCTCTGG + Intergenic
985515846 5:344172-344194 GCTCAGGGCCCCGAGGGCGCAGG - Intronic
986285162 5:6353845-6353867 TTTCAGGGGCCCGAGGCAGCAGG - Intergenic
986530042 5:8726704-8726726 GGTTAGGGGCCTTAGGGCACGGG + Intergenic
986948936 5:13058472-13058494 GGTCAGGAGGCTGAGGCAGGAGG + Intergenic
989408663 5:41091694-41091716 GGCCTGGAGCCTGAGGCCGCTGG - Intergenic
989475770 5:41870741-41870763 GTTCAGGGCCCTCCGGCCGCGGG + Intergenic
994167761 5:96625951-96625973 GGTCAGGGGTCTCAGACTGCAGG - Intronic
994408803 5:99380380-99380402 GCTCAGGGGTCTGAGGCAGTAGG + Intergenic
995492471 5:112707594-112707616 GCTCCCGGGCCTGAGCCCGCAGG - Intronic
997295143 5:132764303-132764325 GGTCATAGGTCTGGGGCCGCAGG + Exonic
997371281 5:133362601-133362623 GGTCTGGGGGCTGAGGCCTCTGG + Intronic
998179891 5:139929379-139929401 TGTCAGGGCACTGAGGCCACAGG - Intronic
998402343 5:141854247-141854269 GGGCAGGAGCCTGCGGGCGCCGG - Exonic
999299432 5:150482023-150482045 GGTCAGGGAGCTGAGCTCGCTGG - Intergenic
1002763324 6:218370-218392 GGTGGGGGTCCTGAGGCAGCAGG + Intergenic
1004167153 6:13266896-13266918 GGGCAGGGGCCAGATGCCGTGGG - Exonic
1004382547 6:15145008-15145030 AGTCAGGAGCCTGAGGCAGAAGG + Intergenic
1005873493 6:29994637-29994659 GGGCAGGGGGCTGAGGCCCTTGG + Intergenic
1006075489 6:31529690-31529712 GGGCAGGGGGCTGAGGCCCTGGG - Intronic
1006317458 6:33298915-33298937 GGTCCGGGGCCGGAGACCGACGG - Exonic
1006472987 6:34238338-34238360 GGTCTGGAGCCTGATGCCTCGGG + Intronic
1007397693 6:41586984-41587006 GGTGAGGGGCCCGAGGGGGCGGG - Intronic
1007400847 6:41601416-41601438 GCACAGGGGTCTGAGGCGGCGGG - Exonic
1007612752 6:43160967-43160989 GGGCAGGGGCCTCAGGGCCCAGG - Exonic
1007633907 6:43286849-43286871 GGCCAGGGGACAGAGGCTGCAGG - Exonic
1012611657 6:101226922-101226944 GGTCAGGTGCCTGAGGGAGCAGG + Intergenic
1012959603 6:105608775-105608797 GGTCAGTGGCCTCAGTCCGGAGG + Intergenic
1013870692 6:114755712-114755734 ACTCAGGGGCCTGAGGCAGAAGG - Intergenic
1014140701 6:117938847-117938869 AGCCAGGGGCCTGAGGGCGGGGG - Intronic
1015398191 6:132758878-132758900 GCTCAGGGGCCCCAGGCCTCAGG + Intronic
1015938238 6:138424158-138424180 GGCCGGGGGCCTGGGGCTGCAGG + Exonic
1016809394 6:148244880-148244902 GGCCTGGGGCCTGAGGCCTGGGG + Intergenic
1019102114 6:169640019-169640041 GCTCAGGGGTCAGAGGCTGCAGG - Intronic
1019197215 6:170289821-170289843 GGGCGGGGGCGTGAGGACGCGGG + Intronic
1019415980 7:926665-926687 GGTCAGAGGCCTGGGGTCCCAGG + Intronic
1019471512 7:1223917-1223939 GAGCAGGGTCCTGAGGCCCCAGG - Intergenic
1019700576 7:2473154-2473176 GCTCAGGAGGCTGAGGCAGCAGG - Intergenic
1022207612 7:28179789-28179811 GGGCCGGGGCCGGCGGCCGCGGG - Intronic
1022361667 7:29665728-29665750 GGTCAGGGAGCTGAGGTCACAGG + Intergenic
1022416751 7:30185020-30185042 GATCTGGGGCCTGAGGCCTGAGG - Intergenic
1023830456 7:44036279-44036301 GTCCAGGGGCCTGAGCCCCCAGG - Intergenic
1023849407 7:44141732-44141754 GGTCTGTGGCCTGAGACCCCCGG + Intergenic
1025078870 7:55965045-55965067 CGTCCGGGGCCTGCGGCCTCAGG - Intronic
1025943033 7:66087466-66087488 GGGCAGGGGCCTGTGGCTCCTGG + Intronic
1029273264 7:99389733-99389755 CGTCAGGGCCCTGGGGCGGCAGG - Intronic
1029402701 7:100355707-100355729 GGTACCGGGCCTGAGGCCCCTGG + Intronic
1029740779 7:102490573-102490595 GTCCAGGGGCCTGAGCCCCCAGG - Intronic
1029758773 7:102589746-102589768 GTCCAGGGGCCTGAGCCCCCAGG - Intronic
1030259001 7:107543491-107543513 GGTCTGGGGCCTGGGGTCACTGG - Intronic
1032170806 7:129583055-129583077 GGTCAGGTGCTTGAGGGAGCAGG - Intergenic
1033987158 7:147240212-147240234 ACTCAGGGGCCTGAGGCAGGAGG + Intronic
1034255055 7:149720337-149720359 GGTGGGGGGCCTGAGGCAGGAGG - Intronic
1036381112 8:8237160-8237182 GGTCAGGGTCCTGCGGAGGCTGG + Intergenic
1036387588 8:8295519-8295541 GGCCATGGACCTGAGGCCACAGG - Intergenic
1036811185 8:11868302-11868324 GGGCGGGGGCCTGAGCGCGCGGG + Intronic
1037605112 8:20431715-20431737 AGTCAGGGGCCTGATCCTGCAGG - Intergenic
1038048750 8:23789733-23789755 GGTCAGTGGTCAGAGGCCTCGGG - Intergenic
1039278421 8:35956498-35956520 GGTCAGGTGCCTGAGGGAGCAGG - Intergenic
1039485236 8:37904676-37904698 GGGCAGGAGGCTGAGGCAGCTGG - Intergenic
1040847784 8:51862675-51862697 TGCCAGGGGCCTGAGGACCCTGG - Intronic
1041142990 8:54842845-54842867 GGGCAGGGGCCTGAGGGCTCTGG - Intergenic
1041302109 8:56422726-56422748 GCTCAGGAGCCTGAGGCAGGAGG - Intergenic
1042860742 8:73310732-73310754 GGGGAGGGGCCTGAGGCTGAAGG + Intronic
1044421500 8:92001080-92001102 ACTCAGGAGCCTGAGGCAGCAGG + Intronic
1048009157 8:130443013-130443035 GGGTAGGGGCCGGGGGCCGCGGG + Intronic
1049088472 8:140495713-140495735 GGGCAGGGGGCTGGGGCCGGAGG - Intergenic
1049154020 8:141056059-141056081 AGTGAGCTGCCTGAGGCCGCAGG - Intergenic
1049284614 8:141767741-141767763 GGCGAAGGGGCTGAGGCCGCTGG + Intergenic
1049382661 8:142325191-142325213 GGGCAGAAGCCTGAGGCCGTGGG + Intronic
1049453415 8:142675033-142675055 GCTCAGGTGCCGGAGGCCTCAGG + Intronic
1049530693 8:143153366-143153388 GGGCTGGGGCCTCAGGCTGCAGG - Intergenic
1049579798 8:143406162-143406184 GGTCAGGAGGCTGAGGTCCCTGG - Intergenic
1049607707 8:143537397-143537419 GGGCAGGGGCCGGGGGCTGCTGG - Intronic
1049623582 8:143610050-143610072 GGCCAGGGGCCTGAGACCGACGG + Intergenic
1051730701 9:20139894-20139916 GGTCAGGGGCCTGGGCCTGCTGG - Intergenic
1052356460 9:27509831-27509853 ACTCAGGGGCCTGAGGCAGGAGG - Intronic
1052856866 9:33412599-33412621 ACTCAGGAGCCTGAGGCAGCAGG + Intergenic
1055016841 9:71627519-71627541 GCTCAGGAGCCTGAGGCAGGAGG + Intergenic
1057769824 9:97957827-97957849 GCTCAGGGGGTTGAGGCCGGAGG + Intergenic
1058013537 9:100004345-100004367 GGTCTGGAGCCTGAAGCCACTGG + Intronic
1059251637 9:112891576-112891598 GGGCAGGGGCTTGAGCCCACTGG + Intergenic
1060505083 9:124191761-124191783 TGTCAAGGGCCTGAGGCAGCAGG + Intergenic
1060878873 9:127103807-127103829 GGTCAGGTCCCTGTGGCAGCTGG + Intronic
1060925271 9:127451515-127451537 GGGCAGGCGCCTGAGGCTGACGG + Exonic
1061130579 9:128705736-128705758 GGCCGGGGTCCTGAGGCCACAGG - Exonic
1061789480 9:133051595-133051617 GGCCAGGGGGCTGGGGCAGCGGG - Intronic
1061861241 9:133469694-133469716 GGCCAGCGGGCTGAGGCCACAGG - Exonic
1061990812 9:134157650-134157672 GGACAGGGGCAGGAGGCCACAGG - Intronic
1062007683 9:134249493-134249515 AGTCAGGGGCCTGAGGGAGCTGG - Intergenic
1062032505 9:134368063-134368085 GGCCAGGAGCCTGCGGCAGCGGG + Intronic
1062038749 9:134394662-134394684 CCTCAGGGGCCAGAGGCCTCAGG + Intronic
1062460023 9:136659134-136659156 GGTCAGGGGCCGGAGCAGGCAGG + Exonic
1062469816 9:136697331-136697353 GGTCAGCGGCCTGAGCCCAAGGG + Intergenic
1203794252 EBV:168010-168032 TGTCAGGGTCCTGAGGCAGCGGG + Intergenic
1203376160 Un_KI270442v1:380339-380361 GGGCAGGGGACGGAGGCCTCCGG + Intergenic
1190037141 X:47036033-47036055 ATTCAGGGGGCTGAGGCGGCAGG + Intronic
1190265895 X:48827018-48827040 GGCCCGGGGCCTCAGCCCGCGGG - Intergenic
1190314738 X:49143278-49143300 GGTCAGGTGCCTGAGGGAGCAGG + Intergenic
1190605544 X:52139004-52139026 AGCCAGGGACCTGAGGCCACTGG - Intergenic
1194916676 X:99717103-99717125 GGTCTGGAGCCTGTGGCTGCAGG - Intergenic
1196749991 X:119107420-119107442 GGTCATGGTCATGAGGCTGCAGG + Intronic
1198967672 X:142244678-142244700 GGTCTGGTGCCTGAGGCCACAGG - Intergenic
1199849518 X:151715501-151715523 GGTGCAGGGCCTGAGGCCCCTGG + Intergenic
1200925326 Y:8649197-8649219 GGTCAGATGCCTGAGGAAGCAGG - Intergenic
1201065368 Y:10090795-10090817 GGGCAGGGGACTGAGGCCTCTGG - Intergenic
1201065877 Y:10093240-10093262 GGGCAGGGGACTGAGGCCTCTGG - Intergenic
1202037339 Y:20648202-20648224 TGTCAGGTGCCTGAGGGAGCAGG - Intergenic
1202126794 Y:21575454-21575476 GGTCAGGTGCCTGAGGAAGCAGG - Intergenic