ID: 1129221646

View in Genome Browser
Species Human (GRCh38)
Location 15:74134847-74134869
Sequence CTGGGACTCCACCAGTGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 223}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129221646_1129221657 28 Left 1129221646 15:74134847-74134869 CCTGCTCACTGGTGGAGTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1129221657 15:74134898-74134920 CGGGCTCTGAGTACAGCGATCGG 0: 1
1: 0
2: 0
3: 2
4: 56
1129221646_1129221654 8 Left 1129221646 15:74134847-74134869 CCTGCTCACTGGTGGAGTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1129221654 15:74134878-74134900 CAACCAAGAGGAGTTCGAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 125
1129221646_1129221655 9 Left 1129221646 15:74134847-74134869 CCTGCTCACTGGTGGAGTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1129221655 15:74134879-74134901 AACCAAGAGGAGTTCGAGGCGGG 0: 1
1: 0
2: 2
3: 8
4: 99
1129221646_1129221650 -4 Left 1129221646 15:74134847-74134869 CCTGCTCACTGGTGGAGTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1129221650 15:74134866-74134888 CCAGTCCAAGGCCAACCAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 124
1129221646_1129221652 5 Left 1129221646 15:74134847-74134869 CCTGCTCACTGGTGGAGTCCCAG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1129221652 15:74134875-74134897 GGCCAACCAAGAGGAGTTCGAGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129221646 Original CRISPR CTGGGACTCCACCAGTGAGC AGG (reversed) Exonic
901640200 1:10689176-10689198 CTGGGGCTGCACCACTGACCTGG + Intronic
901681566 1:10915864-10915886 CTGGGACACCCCTAGGGAGCAGG - Intergenic
903670387 1:25031806-25031828 CTGGGAGTCCCCCGGGGAGCAGG - Intergenic
904003591 1:27351653-27351675 CTGGGCTTTCACCACTGAGCAGG + Intronic
904575067 1:31500164-31500186 CTCAGACTCCAACAGGGAGCTGG - Intergenic
905023824 1:34836493-34836515 CAGGGACTCCACAAGGGGGCAGG - Intronic
905887233 1:41497870-41497892 CAGGGACTCCGCAATTGAGCAGG + Intergenic
905889311 1:41509676-41509698 CTGGCACTCCACAGGTGGGCAGG - Exonic
907184056 1:52595609-52595631 TTGGGACTCCAGCATTCAGCTGG - Intergenic
907477673 1:54716217-54716239 CTGTGACTCCACCACTTAACTGG + Intronic
908511759 1:64855080-64855102 CTGGGAAACCCCCAGAGAGCAGG + Intronic
915479440 1:156175011-156175033 CTGGGCCTGCACCAGCGTGCTGG + Intronic
919922533 1:202174917-202174939 CTGGGACTCCCCCAGGGCCCTGG + Intergenic
920186445 1:204162208-204162230 CAGGGACTCCACCACTGTGGTGG - Intronic
920346644 1:205310121-205310143 CTGGGACTCCTCTAGGGAGAAGG - Intronic
922567642 1:226611337-226611359 CTGGGACTCAAGCTGTGGGCAGG - Intergenic
1063957263 10:11278934-11278956 CTGGGTTTGCATCAGTGAGCCGG - Intronic
1064175645 10:13072612-13072634 CTGGGATTCAACCTGTGAGGTGG + Intronic
1064370985 10:14751396-14751418 CTGGGAAACCACCACTGAGAAGG + Intronic
1067044098 10:42974842-42974864 CTGGGGCTCCACGAATGACCTGG + Intergenic
1070998187 10:80805265-80805287 CTGGGACTCCATCTCTGATCAGG - Intergenic
1072995638 10:100241271-100241293 CTGGGATTACAGCCGTGAGCAGG + Intronic
1073103798 10:101021020-101021042 CTGGGGCTGCAACAGTGAACAGG - Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1074998305 10:118776552-118776574 GTGGAACTCCACCAGGAAGCTGG - Intergenic
1075226177 10:120631244-120631266 CTGTGACTCCACCTATGACCCGG + Intergenic
1076690717 10:132222736-132222758 CTGCGACCCCACCTTTGAGCTGG - Exonic
1077544376 11:3162908-3162930 CAGGGAGTGCACCAGTGTGCTGG - Intronic
1078359616 11:10658191-10658213 CCGCGACTCCACAAGTGAGCCGG + Intronic
1078731008 11:13974014-13974036 CTGAGAATCCAAAAGTGAGCAGG - Intronic
1079062792 11:17264209-17264231 CTGGAACCCCTCCATTGAGCTGG - Intronic
1080697345 11:34614070-34614092 CTGACATTCCACCAGTGTGCAGG + Intergenic
1081822594 11:46014167-46014189 TAGGGACTCCACAAGTGAGTAGG - Intronic
1082236242 11:49822489-49822511 CTGAGACTCCTCCTGGGAGCAGG + Intergenic
1082633346 11:55566653-55566675 CTGGGATTCAATCAGTGAGGTGG - Intergenic
1083158642 11:60841202-60841224 TTGGGACCTCACCAGTGAGCAGG - Intergenic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084169186 11:67392258-67392280 GTGGGACTCCAGCCGGGAGCGGG + Intronic
1084198801 11:67541700-67541722 CTGGGACTGCAAGTGTGAGCCGG - Intergenic
1084225805 11:67714087-67714109 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1084263628 11:67993944-67993966 CAGGGTCTCCACCAGGGGGCAGG - Intronic
1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG + Intergenic
1084809781 11:71605177-71605199 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
1085284240 11:75349847-75349869 CTGGGCCTCCAGCACAGAGCAGG + Intronic
1086498849 11:87431648-87431670 CTGGGGCTGCAGCTGTGAGCAGG + Intergenic
1086805941 11:91242206-91242228 CTGGGACTACAACTGTGAGAAGG + Intergenic
1087137476 11:94735249-94735271 CAGGGACTCCAGCTGTAAGCCGG - Intronic
1088835551 11:113575458-113575480 CTTGAACTCCACTGGTGAGCTGG - Intergenic
1090273908 11:125406340-125406362 CTGGGACTCGACCATTGCCCAGG + Intronic
1091267617 11:134282937-134282959 CTGGCACTTCCCCAGTGACCTGG + Intronic
1091826305 12:3515309-3515331 CAGGGACCACACCAGTGAGCAGG - Intronic
1092720504 12:11436001-11436023 CTGGGATTCAACCTGTGAGGCGG - Intronic
1096237502 12:49939758-49939780 CTAGGACTCCAGCAATGGGCTGG - Intergenic
1096788605 12:54031703-54031725 CAGTGCCTCCACCAGTGAGGAGG + Intronic
1099375833 12:81895405-81895427 CTGGGAATGGACCAGGGAGCAGG - Intergenic
1100870308 12:98903838-98903860 CTTGGACTCCTCCAGTGATAGGG + Intronic
1101417365 12:104520012-104520034 CTGGGACTCCATCAGGGAACGGG + Intronic
1102818959 12:115891786-115891808 CTGAGAATGCAACAGTGAGCAGG - Intergenic
1103226552 12:119292777-119292799 CTGGGACTGCTGCTGTGAGCTGG - Intergenic
1104282249 12:127388843-127388865 TGAGGACTCCACGAGTGAGCTGG - Intergenic
1104485031 12:129143925-129143947 CTGGGAGTTCAAGAGTGAGCAGG - Intronic
1107595399 13:41958695-41958717 CTGGGAACCCACCAGAGATCTGG - Intronic
1108000327 13:45900341-45900363 CTGGGATTCCATCTGTGAGGTGG - Intergenic
1111264776 13:85794933-85794955 CTGGGACTGCTCCTGTGACCTGG - Exonic
1113913484 13:113855932-113855954 CTTGGACTCCTCCAGTGGCCGGG + Intronic
1118823959 14:69363621-69363643 CTGGCAATCCAGCCGTGAGCAGG - Intergenic
1118864888 14:69695024-69695046 CTGGCTCTCCCCCAGTGAGTGGG + Intronic
1119192752 14:72694315-72694337 CAGGCACTCCAGCAGAGAGCAGG - Intronic
1119617801 14:76110289-76110311 CTGGGCTTCCCCCAGTGAGCTGG - Intergenic
1121488929 14:94343983-94344005 CTGAGACTCCACCAGGGAACAGG - Intergenic
1122201865 14:100127682-100127704 CTGGGACACGACCGGAGAGCAGG - Intronic
1122281930 14:100628774-100628796 CTGGGACTCAACCTCTGTGCAGG - Intergenic
1122414199 14:101541021-101541043 CTGGGGCCCTCCCAGTGAGCTGG + Intergenic
1123042586 14:105496466-105496488 CTGGGGCTCCAGCAGTGGGCTGG - Intronic
1123112801 14:105880979-105881001 CTGGGCCTCCAGCAGTGGCCGGG + Intergenic
1125721237 15:41846092-41846114 CTGGGGCTGCACCAGGGGGCGGG + Intronic
1127333757 15:57963893-57963915 CTTTGACCCCACCACTGAGCAGG - Exonic
1129221646 15:74134847-74134869 CTGGGACTCCACCAGTGAGCAGG - Exonic
1129384455 15:75188272-75188294 ATGTGATTCCACCAGGGAGCTGG - Intergenic
1129591722 15:76921021-76921043 CTGGGTCTCCAACAGTGATGAGG + Intergenic
1132825679 16:1904106-1904128 CTGGGAGACCACCAGTGGGATGG + Intergenic
1132985705 16:2766197-2766219 CTCGAACTTCACCAGTCAGCCGG + Exonic
1132985738 16:2766407-2766429 CCAGGACTCCACCAGTAACCAGG + Exonic
1133102611 16:3488343-3488365 CTCGGGCTCCACCCCTGAGCAGG - Intergenic
1133934023 16:10254504-10254526 CTGGGATTACAGGAGTGAGCTGG - Intergenic
1134595390 16:15491819-15491841 CGGGGACTCCTCCAGATAGCGGG - Intronic
1134684376 16:16148432-16148454 CTGGGGCGCCCCCAGGGAGCTGG + Intergenic
1135720490 16:24813340-24813362 TTGGGACTCCACAAGTGGGGAGG - Intronic
1136990668 16:35149580-35149602 CATGGACACCACAAGTGAGCTGG - Intergenic
1136999418 16:35216253-35216275 CTGGGACTTCTGGAGTGAGCAGG + Intergenic
1137589722 16:49686175-49686197 CTGGGCATACAACAGTGAGCTGG - Intronic
1140647903 16:77052904-77052926 CTGGGACTACACATGTCAGCTGG - Intergenic
1141077057 16:81016387-81016409 CTGGGACTACAACAGTGAACAGG + Intronic
1142219910 16:88848999-88849021 CTGGGACTCCACACGTTAGGAGG - Intronic
1143551296 17:7631923-7631945 CTGGGACTCAAGCAGGCAGCAGG + Exonic
1144285685 17:13771569-13771591 CTGGTGCTCCACCAGTGATATGG - Intergenic
1144416040 17:15048181-15048203 CTGGGAATGCAGCTGTGAGCTGG - Intergenic
1147798783 17:43066738-43066760 CTGGGACTACACTGGTGAGGTGG - Intronic
1148858847 17:50593627-50593649 CTGGGACTGCCCCAGTGTGAGGG + Intronic
1150649716 17:67001826-67001848 CTGGAAAGCCACCAGTGGGCAGG + Intronic
1151329628 17:73399168-73399190 CTGGGCTTCCACCAGCCAGCGGG + Exonic
1151403058 17:73868710-73868732 CTGCGACTCCAGCAGAGACCAGG - Intergenic
1151469922 17:74311686-74311708 CTGGGATCTCACCATTGAGCTGG + Intronic
1151586516 17:75012200-75012222 CTGGGGATATACCAGTGAGCCGG + Intergenic
1152169564 17:78735359-78735381 CTGGGACAGCAGGAGTGAGCCGG - Intronic
1152169880 17:78738366-78738388 TTGGGAGTCCAGCAGAGAGCAGG - Intronic
1156505273 18:37586698-37586720 CTGGGCCTCCAAGAATGAGCAGG - Intergenic
1159310909 18:66707532-66707554 CTGGGATTCCATCTGTGAGGTGG + Intergenic
1159357003 18:67349408-67349430 CTGGGATTCAACCTGTGAGGTGG - Intergenic
1160921222 19:1521703-1521725 CTGAGACTCCACTATGGAGCTGG - Intergenic
1161066030 19:2237944-2237966 CTGGGACTAGACCATTGAGAAGG - Intronic
1161670363 19:5604449-5604471 CTGAGACTCCAGCAGGAAGCTGG + Intronic
1163303355 19:16461995-16462017 CTGGGAACCCAGCAGGGAGCAGG + Intronic
1163499741 19:17669242-17669264 CTGAGACTGCAACAGTGAACTGG - Intronic
1164435073 19:28221984-28222006 CGGGGAAGCCACCAGTGAGGAGG - Intergenic
1165692809 19:37876745-37876767 CTGGGATTACAGCTGTGAGCAGG + Intergenic
1166313833 19:41977809-41977831 CTGGGACTCCTCCATGGACCAGG - Intronic
1167096740 19:47378559-47378581 CTGGGATTCCAGGTGTGAGCTGG - Intronic
1167321220 19:48798274-48798296 CCTGGACTCCCCCAGTGAACTGG + Intronic
927111717 2:19868757-19868779 CGGGGACTCCACTACTGGGCTGG - Intergenic
931259608 2:60605779-60605801 CTGGGGTTCTAGCAGTGAGCAGG + Intergenic
932471444 2:71962040-71962062 TGGGGACACCACCTGTGAGCTGG - Intergenic
938278334 2:130047831-130047853 CAGCGCCTCCAGCAGTGAGCAGG + Intergenic
938329307 2:130438636-130438658 CAGCGCCTCCAGCAGTGAGCAGG + Intergenic
938360639 2:130682857-130682879 CAGCGCCTCCAGCAGTGAGCAGG - Intergenic
938437042 2:131289555-131289577 CAGCGCCTCCAGCAGTGAGCAGG - Intronic
942943443 2:181646627-181646649 TTGGGACTCCACCATTTGGCAGG + Intronic
943905898 2:193501280-193501302 CTGTGGCTCCACCTGTGTGCAGG + Intergenic
946308299 2:218868520-218868542 CTGGGGCTCCACCTGTGAGTCGG - Intronic
1170335704 20:15267843-15267865 CTGGGATTCAATCAGTGAGATGG + Intronic
1171459125 20:25288679-25288701 TGGGGACCCCTCCAGTGAGCTGG - Intronic
1172715825 20:36962779-36962801 TAGGGTCTCCACCACTGAGCTGG + Intergenic
1174764733 20:53242347-53242369 ATGGGACTCCAGGAGTCAGCTGG - Intronic
1175994147 20:62804874-62804896 CTGCGACTCCACCTGGGAGGAGG + Exonic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1180180859 21:46118170-46118192 CTGGGGCTCCACCTGGGAGGAGG - Intronic
1181689242 22:24549208-24549230 CTGAAAATCCTCCAGTGAGCTGG + Intronic
1181954087 22:26575568-26575590 CCGGGAATCCAGCAGTGAGCAGG - Intronic
1183184107 22:36282097-36282119 CTGGGCCTCCACCTCTGTGCAGG - Exonic
1183241962 22:36664368-36664390 CTGGGGCTCCAGCAGTGAACAGG + Intronic
1183451530 22:37898630-37898652 CTGGGGCTCCACGAGGGGGCAGG - Intergenic
1183932963 22:41246560-41246582 CTTGGCCTGGACCAGTGAGCTGG - Exonic
1184604141 22:45562620-45562642 GTGGGGCTCTGCCAGTGAGCAGG + Intronic
949403279 3:3687959-3687981 CTTTGAATCCACCAGTGACCTGG - Intergenic
950304524 3:11907814-11907836 CTGGGACTCCACCACTGCTGCGG - Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
954806700 3:53224808-53224830 TGGGGACTCCACCAGTGGCCGGG + Intronic
957079067 3:75621895-75621917 CAGGGTTTCCACCAGGGAGCAGG - Intergenic
965165320 3:165189120-165189142 TTGGGACTGCACCTGTGACCTGG - Exonic
966759873 3:183408284-183408306 TTGGGACTCCACGAGCGACCTGG + Intronic
967261748 3:187649337-187649359 CTCAGACTACAGCAGTGAGCAGG + Intergenic
967271398 3:187736489-187736511 CTGGAAATCCACAAGCGAGCTGG - Intronic
967745723 3:193052739-193052761 CAGGGAGTCCATGAGTGAGCCGG - Intergenic
967929395 3:194679782-194679804 ACAGGACTCCACCAGTGAGACGG - Intergenic
968481252 4:834034-834056 CTGGGCCTCTCCCTGTGAGCCGG + Intergenic
968561888 4:1288070-1288092 CTTTGAATCCACCTGTGAGCTGG + Intergenic
968720380 4:2198208-2198230 CTGGGACTCTGCCAGTGACAGGG + Intronic
969022144 4:4145850-4145872 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
969731723 4:8961542-8961564 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
969791316 4:9495649-9495671 CAGGGTCTCCACCAGGGGGCAGG + Intergenic
972239454 4:37174533-37174555 TTGGGAACCCACCAGTCAGCAGG - Intergenic
974765350 4:66337241-66337263 CTGGGATTACAAGAGTGAGCAGG + Intergenic
976223682 4:82778538-82778560 GTGGGCCTCAACCTGTGAGCTGG + Intronic
976842984 4:89453338-89453360 CTGGGACTACAACAGTGAATTGG - Intergenic
981189977 4:141851261-141851283 CTGGGATTCAATCAGTGAGGTGG + Intergenic
982151065 4:152458068-152458090 CTGAGACTGCACCAGTGCACTGG - Intronic
984219091 4:176951711-176951733 CTGGGACTCAATCTGTGAGATGG - Intergenic
985106767 4:186507207-186507229 TTGGGACTCCACCCTAGAGCAGG + Intronic
985408858 4:189662792-189662814 CTGGGCCTCAGCCAGTCAGCTGG + Intergenic
985715602 5:1458006-1458028 CTGGGACTCAGCCAGTCAGATGG - Intronic
986357720 5:6944862-6944884 CTGGGCATCCTCCAGGGAGCAGG + Intergenic
987518524 5:18947362-18947384 CTGGGTCTCCAACAGTGTGCTGG - Intergenic
988849342 5:35163127-35163149 CTGGGATTCAACCTGTGAGGTGG + Intronic
992576044 5:78113828-78113850 TGAGGACTCCTCCAGTGAGCAGG - Exonic
993728675 5:91397225-91397247 CTGGGATTCAATCAGTGAGGTGG - Intergenic
994093326 5:95827182-95827204 CTGGAACTCAATCTGTGAGCCGG + Intergenic
995035690 5:107531636-107531658 CTGGGAATACACCAGTGATTTGG + Intronic
1001412612 5:171521465-171521487 CTGGGAATACATCTGTGAGCAGG + Intergenic
1002400474 5:178989097-178989119 CCGGGACTCCACCTACGAGCAGG - Exonic
1004100967 6:12610940-12610962 CTGGGATTACAGGAGTGAGCCGG + Intergenic
1004174451 6:13327887-13327909 CTGCGACGTCCCCAGTGAGCAGG + Intronic
1008043689 6:46829975-46829997 CTGGGATTCCAGGCGTGAGCTGG - Intronic
1008242995 6:49135544-49135566 CTGGGATTCAATCAGTGAGGTGG - Intergenic
1011591295 6:88972743-88972765 CTGGGATTCAATCTGTGAGCTGG + Intergenic
1013535633 6:111060852-111060874 CTGGGTCTCCTCTAGTCAGCAGG - Intergenic
1015500555 6:133928547-133928569 CTAGTACTCCAGCAGAGAGCTGG + Intergenic
1016277934 6:142377306-142377328 CTGGGAATCAATCAGTGAGGTGG - Intronic
1018030761 6:159839422-159839444 CTGGGATTACAGGAGTGAGCTGG + Intergenic
1018406787 6:163493614-163493636 GTGGGATTCCACCACTGAGGTGG + Intronic
1018521942 6:164659036-164659058 CTGGGCCTCAACCAGTCAGTTGG + Intergenic
1018714059 6:166518061-166518083 TAGGGTCTCCACCACTGAGCTGG + Intronic
1019209740 6:170395296-170395318 CTGTGACTCCACTCCTGAGCCGG + Intronic
1019306848 7:339711-339733 CTGGGGGTGCACCAGTGAGAGGG - Intergenic
1019550115 7:1597941-1597963 CTGGGATCCCACCCGTGAGCCGG - Intergenic
1019938810 7:4273420-4273442 CTGGGACTCCACCAGGGGAATGG - Intergenic
1020309568 7:6857892-6857914 CAGGGTCTCCACCAGGGGGCAGG - Intergenic
1021942304 7:25689733-25689755 CTGGGGCTGCACCTGTGAGGTGG - Intergenic
1022033774 7:26515720-26515742 CTGGGACTCCAGCCAGGAGCAGG - Intergenic
1023071594 7:36440210-36440232 CTGGCACTCCTCCAGTGAGTTGG - Intronic
1031773555 7:125877443-125877465 TTGGAACTCCCCCAGTGGGCTGG - Intergenic
1032057922 7:128698394-128698416 CTGGGATTGAACCAGGGAGCAGG - Intergenic
1033247046 7:139726439-139726461 GTGGGGCTCCACGAGTGAGAAGG + Intronic
1034717849 7:153260194-153260216 TTGGGACTCCACCAGCAAGACGG - Intergenic
1034973946 7:155437096-155437118 CTGGGATTGCACCAGGGAGCTGG - Intergenic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1035200175 7:157258290-157258312 CTGGGACTACATGAGTGTGCAGG - Intronic
1035708954 8:1698145-1698167 CTGGAACTCCACTAGTGGCCAGG - Intronic
1037654071 8:20867853-20867875 CTGGGACACCAACAGTTAACTGG + Intergenic
1037826593 8:22164038-22164060 CTAGGACGCCTCCGGTGAGCAGG + Exonic
1038433046 8:27515122-27515144 CTGGGATTCCAACAGCGAGGCGG + Intronic
1038581059 8:28749817-28749839 CTGGGACTACACCAGATAGCTGG + Intronic
1040831490 8:51681818-51681840 CTGGGACTCCACCTCTCAGTGGG + Intronic
1045236176 8:100354263-100354285 CTGGGAATTCTCCAGGGAGCAGG + Intronic
1045410033 8:101907937-101907959 CTGGGATTCCACAAGGGAGTAGG + Intronic
1047402709 8:124559578-124559600 CTAGGACTCCAGCAGGGACCTGG - Intronic
1048840179 8:138558731-138558753 ATGAGACTCAACCAGTGAGAAGG - Intergenic
1049137297 8:140915075-140915097 CTGGGAATGCAGCAATGAGCAGG + Intronic
1049519091 8:143079190-143079212 CTGGGTCTGCAGCAGTGAACCGG - Intergenic
1049840127 8:144765731-144765753 CTGGCCCTTCACCCGTGAGCTGG + Intergenic
1049844967 8:144795877-144795899 CTGGGACCCCACCTGTGTGTGGG + Intergenic
1050135796 9:2462228-2462250 TTGTGACTCCAGCAGGGAGCTGG - Intergenic
1050365343 9:4868742-4868764 CTATGACTCCTCCAGTGGGCGGG + Intronic
1051088710 9:13381272-13381294 CTGGGTCTCCAAGAGGGAGCAGG + Intergenic
1052519937 9:29533807-29533829 CTGGGATTCAATCAGTGAGGTGG - Intergenic
1056779335 9:89537855-89537877 CTGGGACTCCTCAAGTAACCAGG + Intergenic
1060544343 9:124451479-124451501 CTGGGAACCAACCAGTGGGCTGG - Intergenic
1060603466 9:124893906-124893928 CTGGGAGTCCTCAGGTGAGCTGG + Intronic
1061326569 9:129868169-129868191 CTGTGACTCGAGCAGTGACCGGG + Exonic
1061761024 9:132851373-132851395 CTGGGACTGCACCCATGACCAGG - Intronic
1062391308 9:136335010-136335032 CTGGGACCCCGGCAGGGAGCTGG + Intronic
1062666643 9:137676827-137676849 CTGGGATTCCATCTGTGAGATGG + Intronic
1188567159 X:31539833-31539855 CTGAGAATCCACCAGTAAACAGG + Intronic
1189617068 X:42794750-42794772 CTGGGACTCAATCTGTGAGATGG - Intergenic
1190774673 X:53543303-53543325 CCGGGACCCCAACACTGAGCTGG + Intronic
1191851881 X:65591374-65591396 CTGTGACAGCAGCAGTGAGCTGG - Intronic
1194640998 X:96404280-96404302 CTGGGATTCAATCGGTGAGCTGG - Intergenic
1197779754 X:130147802-130147824 CTGTGCCTCCACCAATTAGCAGG + Exonic
1199983344 X:152933216-152933238 CTGGGCCTCCAGCTGTGAGTGGG - Intronic
1200252253 X:154559864-154559886 CTGGGACTCCAGCAGAGCTCTGG + Intronic
1200258320 X:154597668-154597690 CTGGGATTCAACCTGTGAGATGG + Intergenic
1200265515 X:154644552-154644574 CTGGGACTCCAGCAGAGCTCTGG - Intergenic