ID: 1129222586

View in Genome Browser
Species Human (GRCh38)
Location 15:74140252-74140274
Sequence TGTTATTTTGATGTCATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129222586_1129222591 28 Left 1129222586 15:74140252-74140274 CCACCCATGACATCAAAATAACA No data
Right 1129222591 15:74140303-74140325 ATTCGTTGTCAGTACATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129222586 Original CRISPR TGTTATTTTGATGTCATGGG TGG (reversed) Intergenic
No off target data available for this crispr