ID: 1129226734

View in Genome Browser
Species Human (GRCh38)
Location 15:74174587-74174609
Sequence ACCCCAGCTCCTCCTCCGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129226734_1129226737 7 Left 1129226734 15:74174587-74174609 CCACTCGGAGGAGGAGCTGGGGT 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1129226737 15:74174617-74174639 CATCCCGTCTTCATCCTGCCTGG 0: 1
1: 0
2: 3
3: 15
4: 132
1129226734_1129226741 21 Left 1129226734 15:74174587-74174609 CCACTCGGAGGAGGAGCTGGGGT 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1129226741 15:74174631-74174653 CCTGCCTGGCTGCGTGACCTCGG 0: 1
1: 2
2: 27
3: 266
4: 1160
1129226734_1129226742 22 Left 1129226734 15:74174587-74174609 CCACTCGGAGGAGGAGCTGGGGT 0: 1
1: 0
2: 1
3: 19
4: 236
Right 1129226742 15:74174632-74174654 CTGCCTGGCTGCGTGACCTCGGG 0: 1
1: 1
2: 20
3: 177
4: 1026

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129226734 Original CRISPR ACCCCAGCTCCTCCTCCGAG TGG (reversed) Intronic
900164294 1:1238573-1238595 CCCCCAGCTCCAGCTCCCAGCGG + Intergenic
900365272 1:2309669-2309691 CCCCCACCTCCTCCTCCCTGTGG + Exonic
901302303 1:8208757-8208779 TCCCCGGCTCCTCCACCAAGTGG + Intergenic
903414651 1:23173804-23173826 ATCCCATCTCCTCCTTCGTGGGG + Intronic
903639331 1:24847997-24848019 CCCCCACCTCCTGCTGCGAGAGG + Intergenic
904120381 1:28194116-28194138 AGCCCAGCCCTTCCTCCCAGAGG - Intergenic
904466656 1:30712201-30712223 ACCAAAGCTCCCCCTCTGAGAGG + Exonic
904642110 1:31938529-31938551 TCCCCCGCTCCTCCTCCTCGTGG + Intronic
905405152 1:37727430-37727452 AGCCCAGCTCCTGCTCAGAGAGG + Intronic
905475664 1:38225925-38225947 AGCCCAGCTCCACCTCTGACTGG - Intergenic
906231780 1:44170656-44170678 AGCTCAGCTCCTCCCCCTAGAGG - Intergenic
906661885 1:47588784-47588806 ATCTCAGCACCTCCTCCAAGAGG - Intergenic
906802532 1:48750254-48750276 ACCCCAGCCCCTCCTACAGGTGG - Intronic
907518576 1:55008583-55008605 AACCCAGCTCCTTGTCCGGGAGG - Exonic
908845802 1:68323152-68323174 CCCTCAGTTCCTCCTCCCAGGGG + Intergenic
908898731 1:68930820-68930842 ACCCCTGCTCCACCTCCCAATGG + Intergenic
912468560 1:109890944-109890966 TCCCCAGCTCCCCCTTCCAGGGG + Intergenic
912648235 1:111415206-111415228 ACCCCAGCCTCTCCTCCTGGGGG + Exonic
914742075 1:150473092-150473114 CCCCCACCTCCTCCTCCATGGGG - Exonic
915025509 1:152826086-152826108 ACCCCTGCTCCTTTTCCCAGTGG - Intergenic
915325678 1:155080271-155080293 GCGGCAGCCCCTCCTCCGAGAGG - Intronic
915491359 1:156251688-156251710 CTCCCAGCTCCTCCCCTGAGAGG - Intronic
919810638 1:201406953-201406975 GCCCCACCTCCTCCTCCCATGGG + Exonic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
922481954 1:225945266-225945288 TCCCCAGCTCCTCCACCTAAGGG - Intergenic
1062906798 10:1184921-1184943 CCCACAGCTCCTCCGCCCAGTGG + Exonic
1066109367 10:32182647-32182669 ACCCCAGCTGCTGCCCCGGGTGG + Intergenic
1067073890 10:43161666-43161688 ACACCAGCTCCTCCTCCTGATGG + Intronic
1067092091 10:43272512-43272534 TCCCCACCACCTCCTCCCAGAGG + Intergenic
1070789609 10:79181449-79181471 ACCCCAGCACCTCCTTGGGGCGG + Intronic
1073002761 10:100297575-100297597 CCCCCAACTCATCCTGCGAGTGG + Exonic
1073075971 10:100826215-100826237 ACCCCAGCTCCCTCTCAGAGAGG + Intronic
1075092251 10:119450396-119450418 ACCCCTGCTCCTCTTCAGACTGG - Intronic
1075630727 10:123999321-123999343 ACCTGAGCTCCACCTCCTAGTGG - Intergenic
1076555854 10:131321037-131321059 ACCCCTGCTGCTGCTCCGAGGGG + Intergenic
1076746909 10:132519146-132519168 ATCCCAGCTACTCCTCCAGGTGG + Intergenic
1076762109 10:132611079-132611101 ACCCCACATCCTCCTCTGACAGG - Intronic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1077184455 11:1229998-1230020 TCCCCAGCACCTGCTCCGGGGGG + Exonic
1077344493 11:2039982-2040004 ACCTCGGCTTCTCCTCCGATGGG - Intergenic
1077429311 11:2508127-2508149 ACCCCAGCTCCACTGCCGTGGGG - Intronic
1077482489 11:2822400-2822422 TCCCCACCTCCACCTCCTAGAGG - Intronic
1079718928 11:23786570-23786592 ACCCCTGCTCATCCTTCAAGAGG - Intergenic
1080214735 11:29827585-29827607 ACACCTGCCCCTCCTCCTAGGGG - Intergenic
1082260710 11:50074646-50074668 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1083032755 11:59608917-59608939 ACCCCAGGTCCTTCTCAAAGGGG + Intronic
1083043602 11:59712033-59712055 ACCCCAACTCTTCCTCCAGGAGG - Intergenic
1083634332 11:64112031-64112053 ACCCCACCTCCTTCTGCCAGGGG + Intronic
1084256028 11:67943394-67943416 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1084816731 11:71651916-71651938 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1202827479 11_KI270721v1_random:95171-95193 ACCTCGGCTTCTCCTCCGATGGG - Intergenic
1091992120 12:4963920-4963942 GCCCCACCTCCTCCTCCATGTGG - Intergenic
1094580381 12:31728915-31728937 GCCCCAGCACCTCCTCCAAACGG - Intronic
1096214223 12:49790878-49790900 TCCCCAGCTCCCTCTCCAAGGGG + Intergenic
1096837288 12:54359006-54359028 ACCCCAGTTTCCCCTCCCAGTGG + Intergenic
1097707229 12:62880825-62880847 ACCCCAGATGATCCACCGAGTGG + Intronic
1100341583 12:93684427-93684449 ACCTGAGCTCCTCCTCCTATTGG - Intronic
1101828906 12:108242112-108242134 ACTCCAGCCCCTCCCCAGAGAGG + Intronic
1102237581 12:111303949-111303971 AACCCAGAACCTCCTCAGAGGGG + Intronic
1102508277 12:113397652-113397674 TCCCCTGCTCCTTCTCCCAGGGG + Intronic
1104647827 12:130509564-130509586 ACCCCAGTTCCACCACCCAGTGG - Intronic
1105368511 13:19782571-19782593 ACCCCATCTCCTCGTCCGGGTGG + Exonic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106759049 13:32849787-32849809 CCCCCAGCTTTTCATCCGAGAGG - Intergenic
1111371576 13:87326098-87326120 ATCCCTTCTCCTCCTCCCAGAGG + Intergenic
1113928590 13:113954445-113954467 ACTCCCTCTCCTCCTCTGAGTGG + Intergenic
1115770008 14:36658317-36658339 ATCCCTGCAACTCCTCCGAGTGG + Intronic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1119197176 14:72725612-72725634 ACCCCATCTCCTCTTCCTTGTGG + Intronic
1121095769 14:91217081-91217103 CCACCAGCTTCTCCTCCAAGAGG - Intronic
1121448212 14:93991741-93991763 ATCCCAGCTCCTCCTCAGAGTGG - Intergenic
1121957379 14:98226642-98226664 GCCCCAACTGCTCCTCCGAGGGG + Intergenic
1122812878 14:104297662-104297684 GCCCCCTCTCCTCCTCCTAGAGG - Intergenic
1123059630 14:105588689-105588711 ACCCCAGTTCCTGCTCTGGGTGG + Intergenic
1124338553 15:28875377-28875399 TCCCCAGCGCCTCCTGCCAGAGG + Intergenic
1125024785 15:35019394-35019416 CCCCCCGCTCCTCCTCCAACTGG + Intergenic
1125722971 15:41853917-41853939 AACCCAGATCCTTCCCCGAGGGG - Intronic
1127541545 15:59943919-59943941 ACCCCAGCTCCTCTCTCTAGAGG - Intergenic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129757347 15:78106342-78106364 ATCCCTGCTCCATCTCCGAGTGG - Intronic
1129851463 15:78796332-78796354 ACTCCTGCTCCCCCTCCTAGTGG + Intronic
1130893048 15:88149685-88149707 AGCCCAGCTCCTGCTCAGAAGGG + Intronic
1131641303 15:94296996-94297018 ACCCCAGCTCCTTCAAGGAGAGG - Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132861390 16:2073452-2073474 ACACCAGCTCCTCGTCCCGGAGG - Intronic
1133230823 16:4365733-4365755 ACCCCAGCTGCTCCTCCCCAGGG + Intronic
1133372073 16:5252779-5252801 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1135565542 16:23508846-23508868 AAACCAGCTCCTCCTCACAGGGG + Intronic
1136020440 16:27436707-27436729 ACCTCATCTCCTCCTCTGGGTGG - Intronic
1136535397 16:30896464-30896486 AGCTCAGCTCCTCGTCCGTGGGG - Intergenic
1136565144 16:31065352-31065374 ACACCAGCTCATCCTCCCTGGGG + Intronic
1138414135 16:56861574-56861596 TTCCCAGCCCCTCCTCAGAGAGG - Intergenic
1138672860 16:58629643-58629665 ACCCCTGTTCCTCCTCCCACCGG + Intronic
1139375445 16:66493797-66493819 CTCCCAGCACCTCTTCCGAGAGG + Intronic
1141157783 16:81609371-81609393 GCCCCATCTCCCCCGCCGAGGGG - Intronic
1141456240 16:84144659-84144681 CACCCGGCTCCTCCCCCGAGCGG - Intronic
1141734848 16:85845491-85845513 ACACCAGCTTCTCCACCGGGAGG + Intergenic
1142050083 16:87952055-87952077 ACCCCAGCCCGTCCCCCGAGGGG + Intronic
1142412215 16:89922689-89922711 ACCCGACCTCCTCCACCAAGGGG - Intronic
1143026539 17:3944835-3944857 ACCTCGGCTCCGCCCCCGAGAGG + Intronic
1143398928 17:6627916-6627938 GCCCCAGCTCCTCTTTCCAGCGG - Intronic
1145224872 17:21119745-21119767 ACGCCATCTCCTCCTCCGGGAGG - Intergenic
1147387526 17:40090994-40091016 ACCCCACCTCCTGCTCCCATGGG - Intronic
1147596386 17:41720752-41720774 ACCCCAGCTCCCCCACCCAAGGG + Intronic
1148471509 17:47896452-47896474 AGCCCCGCTCCTCCTCCGGGCGG - Intronic
1148716168 17:49717665-49717687 GCCCCAGCTCCTCCCCAGAGTGG - Exonic
1150105939 17:62462529-62462551 ACCCCAGCCCCTGCTCTTAGGGG - Intronic
1151349421 17:73522882-73522904 TCCCCAGCTCCTCTTGCGGGTGG + Intronic
1152044876 17:77929313-77929335 ATCCCAGCTGGTCCTCAGAGGGG + Intergenic
1152145660 17:78567242-78567264 TCCCCAGCTCCTCCTGCCTGGGG - Intronic
1152200516 17:78943198-78943220 CCCCCGGCTCCTCTTCTGAGGGG - Intergenic
1152495855 17:80670924-80670946 AACCCAGCTCCACCACAGAGAGG - Intronic
1152701447 17:81821853-81821875 TCCCCTGCTCCTCCTCCCCGGGG + Intergenic
1154314292 18:13292057-13292079 ACCCCAGCTGCACCTCTGAAGGG - Intronic
1155444793 18:25899814-25899836 CCCTCAGCTCCACCTCCCAGAGG + Intergenic
1157201517 18:45663887-45663909 ACCTTTGCTCCTCCTCCGAATGG - Exonic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1158546809 18:58404263-58404285 ACCCCACCACCTCCACCGAGGGG + Intergenic
1158558137 18:58491908-58491930 AGCCCAGCTGCTCCTCTGAATGG - Intronic
1159970493 18:74646835-74646857 CCCCCAGCTCCTCCTCACAGGGG + Intronic
1160686312 19:438569-438591 CCCCCAGCTCCTGCTCAGCGGGG + Intronic
1161121146 19:2527452-2527474 ACCTCCTCTCCTCCTCCCAGTGG - Intronic
1161435097 19:4258367-4258389 TCCGCCGCTCCTCCTCCGACAGG - Exonic
1161591486 19:5131179-5131201 GCCACAGCGCCTCCTCTGAGGGG - Exonic
1161735582 19:5990460-5990482 TCCCCAGCTCCTCCTCGGCCGGG - Intergenic
1161775980 19:6262393-6262415 ACCCCACCACCTCCTCACAGGGG + Intronic
1162687602 19:12400680-12400702 ACCCCAGATCCGCCTCCCTGAGG - Intronic
1162691915 19:12440524-12440546 ACCCCAGATCCGCCTCCCTGAGG - Intronic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
1163663707 19:18593446-18593468 ACCCCAGCTCCTGCTGAGGGTGG + Exonic
1163699826 19:18781560-18781582 ACTCCACCTCCTGCTCCCAGGGG - Exonic
1164715045 19:30385046-30385068 AACCCAGCTCCACCTCCCATTGG + Intronic
1165064593 19:33221588-33221610 ACCCCAGCCCCTCCTCACCGGGG - Intronic
1165145731 19:33728802-33728824 ACCCCAGCTCCTCCTGCCCTGGG - Intronic
1165195545 19:34099913-34099935 GACCCAGCTCCTCTTCCAAGAGG + Intergenic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
1167614230 19:50523079-50523101 ACCCCAGCTCCAGCCCTGAGAGG - Intronic
1167638256 19:50667408-50667430 CCCCCGGCCCGTCCTCCGAGGGG + Exonic
1168071921 19:53958316-53958338 CCCACCGCTCCTCCTCCAAGTGG - Intergenic
1168325509 19:55536790-55536812 CCCCCAGCCCCTCCTCCGCCAGG + Intronic
925132379 2:1503080-1503102 ACCCCGGCTCCTCCACTCAGCGG + Intronic
925235712 2:2275613-2275635 ACACCAGCTCCTGCTCTGAGAGG + Intronic
925238195 2:2297410-2297432 ACCCCAGGGCCTCCTCCTGGTGG - Intronic
925925380 2:8666393-8666415 ACCTCATCTCATCTTCCGAGGGG + Intergenic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
927938236 2:27087143-27087165 GCCCTGGCTCCTCCTCCGCGTGG - Exonic
928270112 2:29848148-29848170 TCCCCACTTCCTCCTCCCAGAGG - Intronic
928278166 2:29921034-29921056 ACCCCAGCTCCGACTGCGGGGGG - Exonic
932207138 2:69893198-69893220 TCCCCAGCTCCTCCCCCTACAGG - Intergenic
932627264 2:73307819-73307841 AGCCCAGCTCCTGCTCAGCGCGG - Intergenic
932781555 2:74561690-74561712 CCCCCACCTCCTCCCCAGAGAGG - Intronic
936519195 2:113201226-113201248 TCCCCAGCTGCTCCTCCCACAGG - Exonic
940001419 2:148969946-148969968 AGCCCAGCTCCTGCCCAGAGAGG - Intronic
944048196 2:195437789-195437811 AACCCAGCTCCTGCACCCAGCGG + Intergenic
945225802 2:207530228-207530250 ACCGCGGCCCCTCCTGCGAGGGG - Intronic
946133889 2:217629514-217629536 AGCCCAGCTCCTGCTCTGTGGGG - Intronic
947595620 2:231409818-231409840 ACCCCAGGTCCAGCCCCGAGAGG - Intergenic
947873620 2:233453669-233453691 ACCCCTGTTCCTCCACCCAGAGG - Intronic
948894338 2:240921333-240921355 ACCCCAGCTCCTGCCCTCAGGGG - Intronic
1168849973 20:969741-969763 CCCCCACCTCCTACTCCCAGTGG - Intronic
1169075765 20:2759089-2759111 ACCCCAGCTCCCCATCCCTGTGG - Intronic
1169215890 20:3794745-3794767 ACCCCAGCCCCACCTGAGAGGGG - Intronic
1172702577 20:36862506-36862528 GCCCCAGATCCACCTCAGAGTGG + Intronic
1172846593 20:37933342-37933364 ACCTCACCTCCTCCCCTGAGTGG + Intronic
1173865069 20:46308111-46308133 ACCCCGGCTCCTCCTGCGGCTGG + Intronic
1175181676 20:57152797-57152819 CCACCGGCTCCTCCTCCCAGTGG - Intergenic
1175287277 20:57845252-57845274 TCCCCAGGTCCTCCTCCCACAGG - Intergenic
1175921179 20:62451264-62451286 ACCCCAGCCCCTCCTCCACCTGG + Intergenic
1176083804 20:63286787-63286809 GCGCCAGCTCCTCCTACGTGGGG - Intronic
1178813533 21:35906187-35906209 TGTCCAGCTCCTCCTCCCAGTGG + Intronic
1179474025 21:41631932-41631954 ACCCCATCTCCTCTTCCGCAGGG - Intergenic
1179568265 21:42262613-42262635 TCCCTCCCTCCTCCTCCGAGTGG - Intronic
1179622131 21:42623938-42623960 ACCACAGCTCATCCTCATAGAGG - Intergenic
1180019681 21:45114364-45114386 ACCCCAGCACCCTCTCAGAGTGG + Intronic
1181923150 22:26336280-26336302 ACCCCAGCTCCTTCTCCCTATGG + Intronic
1182461085 22:30484645-30484667 ACCCCAGCTGCACTTCCCAGAGG - Intergenic
1183787500 22:40038655-40038677 GCCCCTCCTCCTCCTCTGAGGGG - Exonic
1184752328 22:46494272-46494294 ACCTCAGCTCTTCCTCAAAGTGG + Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
949667440 3:6356502-6356524 CCCGCAGCTTCTCCTCGGAGTGG - Intergenic
951582345 3:24179188-24179210 ACCTCAACTCCCCCTCCAAGGGG + Intronic
952822162 3:37494758-37494780 ACCCCACCTCCTCTGCCCAGTGG - Intronic
953248867 3:41224633-41224655 ACCACAGCTCCTTCTCTGAGTGG + Exonic
953764863 3:45731019-45731041 GACCCAGCCCCTCCTCAGAGTGG - Intronic
954861596 3:53695171-53695193 TCCCCAGCACCTCCTCCACGGGG - Intronic
961283181 3:125779296-125779318 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
962270301 3:133973408-133973430 ACCCAAGCTCCACCTCCCTGGGG - Intronic
966880313 3:184346332-184346354 ACCCCTGCTCCCCCTTTGAGGGG - Exonic
966946539 3:184780964-184780986 ACCCCAGCTCCACTCCGGAGTGG - Intergenic
968884730 4:3321701-3321723 ACGTCAGCTCCTCCCCCCAGTGG + Intronic
969622585 4:8286109-8286131 ACAACACCTCCTCCGCCGAGTGG - Intronic
969739409 4:9013321-9013343 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
969798590 4:9544836-9544858 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
978489254 4:109294200-109294222 AGCTCAGTTCCTCCTCCTAGAGG + Intronic
978768795 4:112432315-112432337 ACTCCAGCTCATCCTCAGTGTGG + Exonic
980877183 4:138673211-138673233 AACAGAGCTCCTCCACCGAGGGG + Intergenic
991573415 5:68078705-68078727 ACCCCACCACCGCCTCCCAGAGG - Intergenic
992615194 5:78540741-78540763 ACAACAGCTCCTCCTCCTTGGGG + Intronic
997283875 5:132664811-132664833 CCCCCACCTCCTCTCCCGAGAGG - Intergenic
998133063 5:139660777-139660799 ACCCCAGCAGCTGCTCCCAGAGG - Intronic
998378908 5:141710095-141710117 CCCCCACCTCCTCCTCCAACTGG - Intergenic
998855562 5:146391981-146392003 AACCCAGCTCCTCTTTCTAGAGG + Intergenic
1000064460 5:157683077-157683099 ACCCAATTTCCTCCTCCTAGGGG - Intergenic
1001246048 5:170106293-170106315 TCATCAGCTCCTCCTGCGAGGGG - Exonic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1001915628 5:175557910-175557932 GCCCCATCTCCTCCTTCCAGTGG + Intergenic
1001950002 5:175809676-175809698 ACCTCAGCTCCTCTTCCAGGTGG + Intronic
1002080191 5:176733079-176733101 CCCCAATCACCTCCTCCGAGAGG - Intergenic
1003521110 6:6859310-6859332 TTCTCAGCTCCTCCTCTGAGTGG + Intergenic
1003831535 6:10017427-10017449 TAACCAGCTCCTCCTCAGAGGGG + Intronic
1004707148 6:18135035-18135057 ACCCCAGCTCCTCTACTGACTGG + Intronic
1005229960 6:23688657-23688679 ACCCAAGCTTCCCCTCCGTGTGG + Intergenic
1006349383 6:33509673-33509695 ACCCCACCTCCTCCTGGGAATGG + Intergenic
1006539956 6:34731546-34731568 ACCCCAGCCACTCCTCCTAAGGG + Intergenic
1006630602 6:35427401-35427423 AGCCCAGCACCTGCTCCCAGTGG + Exonic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1007699753 6:43759660-43759682 ACCCCTGCTCTTCCTCTGGGTGG - Intergenic
1018762372 6:166903554-166903576 ACCCCAGCTTGCCCTCCAAGGGG + Intronic
1019180091 6:170181276-170181298 CCTCCAGCTCCTCTTCCCAGCGG + Intergenic
1019367909 7:644726-644748 ACCCCAGCTCTCCCTCCCAGAGG + Intronic
1024544567 7:50506241-50506263 ACCCCAGCATCTCCTCTGTGGGG - Intronic
1024649122 7:51389660-51389682 GGCCCAGCTCTTCCTCCCAGCGG - Intergenic
1026300826 7:69096605-69096627 ACTCAAACTCCTCCTCAGAGTGG + Intergenic
1032035099 7:128515734-128515756 ACCCCAGCCCCTGCTCTTAGGGG - Intergenic
1032439151 7:131928564-131928586 CCCCCAGCTCCTCTTCCAGGTGG - Intergenic
1032461496 7:132114692-132114714 ACCCCAGCTCCTTCAGCGAATGG - Intergenic
1034448567 7:151125746-151125768 CCCCCAGCTCCTGCTGGGAGTGG + Intronic
1035231000 7:157465397-157465419 ACGCCAGCTCGGCCTGCGAGGGG + Intergenic
1035248081 7:157577947-157577969 GGCCCTGCTCCTCCTCCGAATGG - Intronic
1036308317 8:7667779-7667801 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1036361218 8:8078299-8078321 TCCCCAGCTCCTTCTGCAAGGGG + Intergenic
1036889758 8:12588704-12588726 TCCCCAGCTCCTTCTGCAAGGGG - Intergenic
1039494310 8:37969231-37969253 CCCCCAGCTCAGCCTCCCAGAGG - Intergenic
1039906593 8:41790972-41790994 AGCCCAGCTCCCCCACCCAGAGG + Intronic
1048966252 8:139616907-139616929 ACCCCACCACCTCCCCCAAGAGG + Intronic
1049102342 8:140588737-140588759 ACCTCAGCTGCTCCTGGGAGGGG + Intronic
1049548058 8:143243825-143243847 CCCCCAGCCCCTCTTCAGAGAGG + Intergenic
1049662013 8:143823731-143823753 GGCCCAGCTCCACCTCTGAGAGG + Intronic
1051009705 9:12396412-12396434 ACCCATACTCCTCTTCCGAGGGG - Intergenic
1053045436 9:34912184-34912206 CCCCCAGTTCCTCCTTCCAGAGG - Intergenic
1056787285 9:89602410-89602432 GCCTCAGCCCCTCCTCCGAGAGG - Intergenic
1057200141 9:93135325-93135347 GCCCCAGCTCTGCCTCAGAGGGG + Intergenic
1059388149 9:113981275-113981297 ACCCCTGCTCTTCCTCCAAAGGG - Intronic
1061415140 9:130443615-130443637 CCCCCAGCTGCTCCTGTGAGAGG + Intergenic
1061627489 9:131849632-131849654 GCTGCAGCTCCTCATCCGAGAGG + Intergenic
1061668120 9:132172234-132172256 ACCCTACCTCCTCCTCCAGGAGG + Intronic
1061668627 9:132175255-132175277 ACCCCAGCTCCTACACTCAGTGG - Intronic
1062066646 9:134531540-134531562 AACCCAGCCCCTCCCCGGAGTGG - Intergenic
1186464558 X:9774787-9774809 ACCCCTTCTTCTCCTCCCAGGGG + Intronic
1187226383 X:17377603-17377625 AGCCCAGCTCAGCCTCCCAGCGG + Intronic
1190008085 X:46759040-46759062 CCCCCCGCGCCTCCTCCGAGCGG + Exonic