ID: 1129226939

View in Genome Browser
Species Human (GRCh38)
Location 15:74175619-74175641
Sequence CACTGCACTGTGATGTGGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129226936_1129226939 -7 Left 1129226936 15:74175603-74175625 CCTGGTTTTGTGCTGGCACTGCA 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154
1129226928_1129226939 24 Left 1129226928 15:74175572-74175594 CCAACCCAGCCAGGATGGTGCCG 0: 1
1: 0
2: 3
3: 11
4: 196
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154
1129226930_1129226939 19 Left 1129226930 15:74175577-74175599 CCAGCCAGGATGGTGCCGAGCTG 0: 1
1: 0
2: 1
3: 13
4: 211
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154
1129226934_1129226939 4 Left 1129226934 15:74175592-74175614 CCGAGCTGCGGCCTGGTTTTGTG 0: 1
1: 0
2: 1
3: 12
4: 187
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154
1129226932_1129226939 15 Left 1129226932 15:74175581-74175603 CCAGGATGGTGCCGAGCTGCGGC 0: 1
1: 0
2: 0
3: 8
4: 159
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154
1129226929_1129226939 20 Left 1129226929 15:74175576-74175598 CCCAGCCAGGATGGTGCCGAGCT 0: 1
1: 0
2: 1
3: 28
4: 143
Right 1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG 0: 1
1: 0
2: 0
3: 4
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129226939 Original CRISPR CACTGCACTGTGATGTGGAC GGG Exonic
900324965 1:2104215-2104237 CACCTCACTGGGATGTGGGCGGG + Intronic
900767415 1:4514423-4514445 CACTGCAATGTGAAGAGGAAGGG + Intergenic
901625891 1:10624873-10624895 CGCTGCACTGCGGTGTGGATGGG - Intronic
902738116 1:18414592-18414614 CACTGCATTCTGATGTGGTCTGG + Intergenic
909417316 1:75421515-75421537 CACTGCACTGTGGTGTGCTATGG + Intronic
909477092 1:76093270-76093292 CAATGCTGTGTGCTGTGGACTGG + Intronic
910803098 1:91164730-91164752 CACTCCACTGGGAACTGGACTGG + Intergenic
911896847 1:103446838-103446860 CACTGCACTCTGGCCTGGACTGG - Intergenic
912488391 1:110047158-110047180 CTGTGCACTGGGAGGTGGACTGG - Intronic
912768924 1:112444304-112444326 CACTGTACTGGGAAGTGGAGAGG + Intronic
913258134 1:116973772-116973794 CACTGCACTGTGCTGGGTGCTGG - Intronic
919734451 1:200937019-200937041 CACTGCACTCTGCTCTGGTCAGG - Intergenic
920008832 1:202853104-202853126 TTATGCACTGTTATGTGGACAGG - Intergenic
920032663 1:203046559-203046581 CCCTGCAGGGTGATGAGGACAGG - Intronic
921966787 1:221098904-221098926 CAATGCACTGTGATAAGCACTGG + Intergenic
1062856040 10:779918-779940 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856067 10:780056-780078 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856140 10:780370-780392 CACTGCAGGGTAATGAGGACGGG + Intergenic
1062856165 10:780508-780530 CACTGCAGGGTAATGAGGACAGG + Intergenic
1064354715 10:14606170-14606192 CCCTGCTCTGTGATGAAGACTGG + Intronic
1069608946 10:69759568-69759590 CCCTCCACTGTGATCTGGATGGG - Intergenic
1070758692 10:79009570-79009592 CCCTGCACTGTGATTTGATCTGG + Intergenic
1071514111 10:86285636-86285658 CACTGCTCTGAGATATGTACCGG + Intronic
1073329367 10:102660733-102660755 CAATCCACTGAGATGTGGAGGGG + Intergenic
1074788496 10:116863293-116863315 CAGTGCACAGTGATATGGAAGGG + Intronic
1077242269 11:1516828-1516850 CACTGCACGGTGGGGTGGAGTGG + Intergenic
1077499515 11:2902839-2902861 AGCTGCACTGTGTTGGGGACAGG + Intronic
1078550368 11:12276028-12276050 CACAGCACAGTGATGCGGAAGGG + Intergenic
1083199382 11:61110782-61110804 CATAGCACTGTGGTGAGGACTGG + Intronic
1083890463 11:65593259-65593281 CACTGCGCTGGGAGGTGGGCGGG - Intronic
1084188535 11:67488343-67488365 CACTGCCCTGTTGTCTGGACAGG - Intronic
1089617838 11:119705082-119705104 CCCTGGCCTGTGATGTGGGCTGG - Intronic
1090957375 11:131525278-131525300 CAATGCCCTGTGATGGGCACCGG - Intronic
1093403103 12:18770943-18770965 CCCTGCACTCTGTTTTGGACTGG - Intergenic
1094558975 12:31531958-31531980 CATTTCACTGTGCTGTGTACTGG + Intronic
1095824885 12:46520638-46520660 CACTGCCCTGTGAGGGGGGCAGG + Intergenic
1105826595 13:24128623-24128645 CACTCCTCGCTGATGTGGACAGG + Intronic
1112881661 13:104114219-104114241 CAGTGTACTGTGATGTGAAGTGG - Intergenic
1113509716 13:110843445-110843467 CACTCTTCTGTGATGTGGCCAGG - Intergenic
1114194350 14:20463995-20464017 GAACCCACTGTGATGTGGACAGG + Intergenic
1116224424 14:42130879-42130901 AACTCCACTCTGAAGTGGACAGG - Intergenic
1118608784 14:67523356-67523378 CACTGTACTGTTTTGAGGACTGG - Intronic
1119054355 14:71403994-71404016 CTCTTCACTGTGATGTGGGTGGG - Intronic
1119978921 14:79057751-79057773 CACTGCACTGGGCAGTGAACGGG + Intronic
1122337705 14:101004769-101004791 CTCTGCACTGGGTTGTGTACTGG - Intergenic
1122896382 14:104759564-104759586 CACTGAACTGTGGGGTCGACGGG + Exonic
1122995457 14:105261454-105261476 CACTCCACTGTGAAGAGGATGGG + Intronic
1124244097 15:28055629-28055651 CAAACCACTGTGATGTGGCCTGG - Intronic
1126778222 15:52117822-52117844 CCCTGCCCTGAGATCTGGACTGG - Exonic
1127788698 15:62378967-62378989 GGCTGCACTGTGATGGGGAGAGG + Intergenic
1129226939 15:74175619-74175641 CACTGCACTGTGATGTGGACGGG + Exonic
1133653230 16:7833035-7833057 CACTTCACTGCAGTGTGGACTGG - Intergenic
1135179729 16:20262254-20262276 CACCTCACTGTGATGTGTAAGGG - Intergenic
1135284472 16:21181632-21181654 CACTGAACTGTCATGGGGAGGGG - Intergenic
1135627181 16:24006146-24006168 GACTGCAGTGTTATGTGAACAGG - Intronic
1136228598 16:28874306-28874328 CACTGCAGAATGATGGGGACTGG - Intergenic
1137627230 16:49916857-49916879 CAATGCACTGCGATGGGAACAGG - Intergenic
1142780914 17:2180510-2180532 CACTGCAGAGTGATGAGGGCAGG - Intronic
1146539310 17:33680709-33680731 CACTGCACTGTGGTGGGGTGGGG - Intronic
1147438842 17:40434818-40434840 CACTGCACTGGGATCTGGCAAGG + Intergenic
1149290540 17:55213995-55214017 CACTGCACAGTCATTTGGAAGGG - Intergenic
1156211963 18:34953961-34953983 CATTACACAGAGATGTGGACAGG + Intergenic
1156398449 18:36719824-36719846 CACTGCTGTGGGATGTTGACAGG + Intronic
1158646485 18:59253165-59253187 CAGTGCACTGTGATTTTCACTGG - Intergenic
1162499854 19:11046594-11046616 CACTGTAATGTGATTTGCACAGG + Intronic
1164433318 19:28207344-28207366 CAATGCACTGAGAAGTGGAAGGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
926013479 2:9426999-9427021 CACTGCCCTGGGAGGTGGTCTGG + Intronic
929567883 2:43000875-43000897 CTCTGCTCTGTGATGGGGAGGGG + Intergenic
929773321 2:44911479-44911501 AATTGCACTGTGATGTGTATGGG - Intergenic
929868069 2:45735105-45735127 CAGTGGCCTGTGATGTGGGCAGG + Intronic
930383269 2:50658889-50658911 TGCTGTACTGTGATGTGGGCTGG - Intronic
931659297 2:64543631-64543653 CACTGCAGTGTGGTGGGGAAAGG - Intronic
933256471 2:80086730-80086752 CACTGCTCTGTGAGGTTGGCAGG - Intronic
939127461 2:138194203-138194225 CACAGCACTGTGTTGGGCACTGG - Intergenic
941377290 2:164747304-164747326 CACTGCAGTGTGCAGTAGACAGG - Intronic
946640238 2:221776047-221776069 CAGTGAACTGTGATGTGTCCTGG - Intergenic
948910727 2:241001165-241001187 CACTGCAGTGGGATGGGGGCTGG - Intronic
949027978 2:241775163-241775185 CAGTGCAGTGTGGTGTGGAGCGG - Intergenic
1168780091 20:481794-481816 CACTGGATTGTGATTTGAACAGG - Exonic
1172161273 20:32870104-32870126 AACCACACTGTGATGTGGGCAGG + Intronic
1173204348 20:40980826-40980848 CACTGCCATGGGATGGGGACAGG + Intergenic
1175604202 20:60299052-60299074 CTCTGCACTGTGAAGAGGTCAGG - Intergenic
1176247745 20:64105450-64105472 GACAGCACTGGGATGTGAACAGG + Intergenic
1178058212 21:28823091-28823113 AAATGCACTGTAATGTGAACAGG + Intergenic
1179080163 21:38163366-38163388 CACTGGGCTATCATGTGGACTGG + Intronic
1179610811 21:42548711-42548733 CACTGGACTGTGTTGTGCAAGGG - Intronic
1179673239 21:42964312-42964334 CACAGCAGTGCTATGTGGACAGG - Intergenic
1182486671 22:30643230-30643252 GCCTGCTCTGTGATGCGGACGGG - Intronic
1182566810 22:31206226-31206248 CACTGAACTCTGGTGTTGACAGG - Exonic
1184159170 22:42687871-42687893 CACAGCACTGTGATGGGCAGAGG - Intergenic
950770104 3:15304419-15304441 CACTGCACTGTGCAGAGCACAGG - Intronic
951123432 3:18956349-18956371 GACAGCTCTGTGATGTGGAAGGG - Intergenic
954976962 3:54705038-54705060 CCCTGCACTGTCATCTGCACGGG + Intronic
956755052 3:72377299-72377321 CACTGCAATGTCATGTAGAAAGG + Exonic
957361995 3:79173112-79173134 CACTGTGCATTGATGTGGACTGG - Intronic
959968241 3:112380247-112380269 CAATGCCCTGGGATGTGGAGGGG - Intergenic
960381312 3:116965715-116965737 CACTGTACTGTGTTGTATACTGG + Intronic
962003757 3:131327465-131327487 TTCTGCACTGGGATGTGGAAGGG - Intronic
962891546 3:139677271-139677293 CACTGGACTGTGAGCTGCACGGG + Intronic
963944137 3:151126829-151126851 AACTACCCTGTGAGGTGGACAGG + Intronic
964142808 3:153422534-153422556 CACTGCACTGTGAAATGCATTGG + Intergenic
966274268 3:178145900-178145922 CACTGCAATGTGCTGAGGTCGGG + Intergenic
972399143 4:38684389-38684411 CACTGCACTGTGAGGTGATGAGG - Intronic
975172885 4:71252985-71253007 CACTGCACTGTGAAGTGCTATGG - Intronic
979558351 4:122076174-122076196 CACTGAACTCTGGTGTTGACAGG + Intergenic
980478814 4:133357825-133357847 AATTGCAATGTGATGTGGAAAGG - Intergenic
981210719 4:142100847-142100869 CACTGTTCTGTAATGTGGAGAGG + Intronic
982600448 4:157443102-157443124 CCCTGCTCTGTGATGTGGTGAGG + Intergenic
984500601 4:180553963-180553985 CACTGTACTGGGATGTAGGCAGG + Intergenic
987944852 5:24592649-24592671 TACTGCAATATGAGGTGGACAGG - Intronic
988774625 5:34466822-34466844 GAGGGCACTGGGATGTGGACTGG + Intergenic
992596782 5:78355280-78355302 CACACCACAGTGGTGTGGACAGG + Intergenic
999625509 5:153516592-153516614 CCCTCCTCTGGGATGTGGACTGG + Intronic
1001999182 5:176187660-176187682 CACTGCCAGGTGATGTGGAGGGG - Intergenic
1002137135 5:177114679-177114701 CACTGCCCAGTGATGGGGGCGGG - Intergenic
1004255549 6:14060184-14060206 CAGTGCTCTGTGCTGTGGGCCGG - Intergenic
1004370636 6:15049305-15049327 GCCTGCACTGTGATGAGGGCTGG + Intergenic
1005686987 6:28262598-28262620 CAGGGCAGTGTGATGTGGAAGGG + Intergenic
1006429070 6:33984106-33984128 CCCTGCACAGTGCTGTGGACAGG - Intergenic
1007376432 6:41460000-41460022 CACTTCACTGTGACCTGGAGGGG + Intergenic
1008859175 6:56128465-56128487 AACTTCACTGTAATGTGGTCTGG + Intronic
1010003162 6:70968635-70968657 CACTGTACTGGGTTGGGGACAGG - Intergenic
1010777648 6:79905667-79905689 CACTGGACTCTGCTGTGGGCAGG + Intergenic
1011575694 6:88795806-88795828 CAATGCACTATGATTTGGAAGGG + Intronic
1015992220 6:138957645-138957667 CATTGCACTTTGATCTGGAGTGG - Intronic
1016920953 6:149292591-149292613 CACTGAACTATGCTGTTGACAGG + Intronic
1018600594 6:165535278-165535300 CACTGCACAGTGGTGAGGTCTGG + Intronic
1019117653 6:169778097-169778119 CACAGCTCTGGGATGTGGAGGGG + Intronic
1019882762 7:3877434-3877456 CACTGAACTGTGGGGTGGAGAGG - Intronic
1020213345 7:6171190-6171212 CTCTGCACTGACCTGTGGACTGG + Exonic
1024000438 7:45185791-45185813 CTCTGCAGGGTTATGTGGACAGG - Intronic
1024232760 7:47375217-47375239 CCCTGGACTGAGATGTGGAAAGG - Intronic
1024729805 7:52241695-52241717 CCCTCCCCTGTCATGTGGACAGG - Intergenic
1026228112 7:68460357-68460379 CATTGCCCTGTGATGTGGTTTGG - Intergenic
1026587778 7:71670461-71670483 CATTGCTCTGTGCTGTGGGCTGG + Intronic
1029361445 7:100091217-100091239 CACTGCAAGGGGATGAGGACAGG - Exonic
1029634427 7:101774465-101774487 CACTGCACTGTGATCATGCCTGG + Intergenic
1030264185 7:107601011-107601033 CACTGCAATGTTATGTGGGAAGG - Intronic
1032781486 7:135168256-135168278 GGCTGCACTGTGAAGTGGGCGGG - Intronic
1038981548 8:32764728-32764750 CATTGCATTATGATGTTGACTGG + Intronic
1040483587 8:47849727-47849749 CAGAGCACAGTGATGTGGACTGG - Intronic
1040824972 8:51611039-51611061 CCCTGCCCTGGAATGTGGACGGG - Intronic
1047356331 8:124125724-124125746 CACTCCAGTGTGATCTGCACTGG - Intergenic
1048143242 8:131816332-131816354 GACTCCACTGTCCTGTGGACTGG + Intergenic
1048654817 8:136523996-136524018 CACTGCAGAATGATGTAGACTGG + Intergenic
1049099249 8:140567541-140567563 CAGTGCCCTGTGAGGTGGGCGGG - Intronic
1049982018 9:912825-912847 AACTGCTCTGGGATGTGGCCTGG - Intronic
1051153731 9:14116263-14116285 CACTGCACTGGGATGGGGAGAGG + Exonic
1051421953 9:16897583-16897605 CACTGCACTACGATATGAACAGG - Intergenic
1052890932 9:33699442-33699464 CATTACTCTGTGATGGGGACTGG + Intergenic
1055849436 9:80608633-80608655 CAGTGCACTGTGGTGTGGCTGGG - Intergenic
1061434041 9:130549405-130549427 TACTGGACTGTGATGTGAGCAGG + Intergenic
1186040095 X:5466507-5466529 CACTGCACTGGGAAGTGTTCAGG - Intergenic
1196632315 X:117956070-117956092 AATTGCTCTGTGATATGGACTGG - Intronic
1198523824 X:137479629-137479651 CACTGAACAGAGATGTGGCCTGG - Intergenic
1198703674 X:139423620-139423642 CGCAGCACTGTGATCTGGAGTGG - Intergenic
1198792677 X:140362645-140362667 CAATACAGTGTGATATGGACTGG - Intergenic
1200080083 X:153571962-153571984 CGCTGCACTGTGATGATGGCAGG - Intronic