ID: 1129228023

View in Genome Browser
Species Human (GRCh38)
Location 15:74181076-74181098
Sequence ATTGGCTGCATGGGCACGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129228020_1129228023 -8 Left 1129228020 15:74181061-74181083 CCAAGCACGTGGCACATTGGCTG 0: 1
1: 0
2: 0
3: 33
4: 318
Right 1129228023 15:74181076-74181098 ATTGGCTGCATGGGCACGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 102
1129228016_1129228023 16 Left 1129228016 15:74181037-74181059 CCTGCATCCAAGCATGTCGACAC 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1129228023 15:74181076-74181098 ATTGGCTGCATGGGCACGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 102
1129228017_1129228023 9 Left 1129228017 15:74181044-74181066 CCAAGCATGTCGACACACCAAGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1129228023 15:74181076-74181098 ATTGGCTGCATGGGCACGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 102
1129228015_1129228023 17 Left 1129228015 15:74181036-74181058 CCCTGCATCCAAGCATGTCGACA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1129228023 15:74181076-74181098 ATTGGCTGCATGGGCACGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129228023 Original CRISPR ATTGGCTGCATGGGCACGTG TGG Intronic