ID: 1129230209

View in Genome Browser
Species Human (GRCh38)
Location 15:74192853-74192875
Sequence TGCACCACAGTCCCAACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129230201_1129230209 5 Left 1129230201 15:74192825-74192847 CCAGAAAGAAGTAGTGGACCCCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG 0: 1
1: 0
2: 3
3: 13
4: 159
1129230198_1129230209 17 Left 1129230198 15:74192813-74192835 CCTCCTCTCTCACCAGAAAGAAG 0: 1
1: 0
2: 1
3: 24
4: 383
Right 1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG 0: 1
1: 0
2: 3
3: 13
4: 159
1129230197_1129230209 20 Left 1129230197 15:74192810-74192832 CCTCCTCCTCTCTCACCAGAAAG 0: 1
1: 0
2: 3
3: 47
4: 404
Right 1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG 0: 1
1: 0
2: 3
3: 13
4: 159
1129230199_1129230209 14 Left 1129230199 15:74192816-74192838 CCTCTCTCACCAGAAAGAAGTAG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG 0: 1
1: 0
2: 3
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129230209 Original CRISPR TGCACCACAGTCCCAACACC CGG Intronic
900609187 1:3537264-3537286 GGCATCACAGACCCAGCACCTGG + Intronic
901415273 1:9112077-9112099 TGCACCACAGGCCTGAAACCTGG - Intronic
903519111 1:23934053-23934075 TGCGCCACCCTCCCAGCACCTGG + Intergenic
903829421 1:26165603-26165625 AGCACCTCAATCCCAACAGCTGG + Intergenic
903990109 1:27261391-27261413 TGCACCACCTGCCCAACACAAGG - Intronic
905004138 1:34696805-34696827 CGCACCCCAGTTCCAGCACCGGG + Intergenic
909837919 1:80280621-80280643 TGGGCCACAGTGCCAACCCCTGG + Intergenic
909903088 1:81161651-81161673 TTCACCATAGCCACAACACCTGG - Intergenic
911511980 1:98818064-98818086 TGCAGCCCAGTGCCACCACCAGG - Intergenic
912430837 1:109627583-109627605 TGCCCCAGACTCCCATCACCTGG + Intronic
916793616 1:168146004-168146026 AGCAGCCCAGTCCCAAGACCAGG + Intergenic
918469090 1:184851978-184852000 CGCGCCACAGTCCCACCACGCGG + Intronic
918686919 1:187428612-187428634 TGCACCACCCTCCCAGCACATGG + Intergenic
920997587 1:211010189-211010211 TGCCCCTCAGTCCTAATACCTGG - Intronic
923512747 1:234666588-234666610 GGAGCCAGAGTCCCAACACCAGG - Intergenic
1063892221 10:10642337-10642359 TCCAGCACAGTCCCAAAGCCAGG + Intergenic
1065085065 10:22165663-22165685 TGCACCACTGTACCACAACCTGG + Intergenic
1067001421 10:42617651-42617673 TACAGAACAGTCCCATCACCAGG + Intronic
1068001596 10:51341408-51341430 TAAACAACAGTCCCAACAACAGG - Intronic
1071423954 10:85529509-85529531 TGCACCAGAATGGCAACACCAGG + Intergenic
1075577015 10:123584904-123584926 TCCTCCAGAGTCCCAAGACCTGG + Intergenic
1078324089 11:10365169-10365191 TGCACCACCCTCCCATCACGCGG - Intronic
1079986687 11:27207389-27207411 TGCACCTCAGTCCCACCACTGGG + Intergenic
1084465629 11:69321344-69321366 TGCACCACAGTCCATGCCCCAGG - Intronic
1084548171 11:69824900-69824922 CGCACCCCAGTCCCAACACCAGG + Intergenic
1084779218 11:71397591-71397613 AGCAGCACAGTTCCACCACCTGG - Intergenic
1085411917 11:76296479-76296501 TGTACCCCAGCCCCAACACTGGG - Intergenic
1085838567 11:79983259-79983281 TCCACCACAGTGCCACCAGCAGG + Intergenic
1087663913 11:101019990-101020012 TGCACCACACTCCCAGCATGTGG - Intergenic
1092960085 12:13588341-13588363 TGCCCCACACTCCCAACAACTGG - Intronic
1096189883 12:49609584-49609606 TGCACCACAATCTCTACACAGGG - Intronic
1101139606 12:101781608-101781630 CTCACCACAGCCCCAACTCCGGG - Intronic
1105404429 13:20121596-20121618 TGCACCACATTCCCACAACTTGG + Intergenic
1105446276 13:20460436-20460458 TTCACCACAGCCTCAACACTGGG + Intronic
1106093914 13:26625431-26625453 TGCACCACCTTCCCAATCCCAGG - Intronic
1110244777 13:73310338-73310360 TTCACAACAGCCCCAACACAGGG - Intergenic
1110628597 13:77679440-77679462 TGCACCAAAGTCCCAGGAACAGG - Intergenic
1110638260 13:77791192-77791214 TGCACCACAGTCTCTGCACAGGG - Intergenic
1111308608 13:86450460-86450482 TGCACCACCCTCCCAGCACATGG + Intergenic
1114065064 14:19053521-19053543 TGCACCAGAGCCCTGACACCGGG - Intergenic
1114097197 14:19346481-19346503 TGCACCAGAGCCCTGACACCGGG + Intergenic
1114888181 14:26881135-26881157 TGCACCTCAGTCTCAGCACCTGG + Intergenic
1115511157 14:34139295-34139317 TGCAACACAGTTCTAACACAAGG + Intronic
1118635531 14:67745633-67745655 TGCCCCAAAGACCCTACACCTGG + Intronic
1119385231 14:74254031-74254053 TGCACCACAGTCCACTCACAGGG + Intronic
1119406047 14:74400341-74400363 CTCACCCCAGCCCCAACACCAGG - Intergenic
1121301887 14:92878296-92878318 TGCACCACAATCCCTTCTCCCGG - Intergenic
1121786500 14:96665419-96665441 TGCACCAAAGTCCTTTCACCAGG + Intergenic
1122214563 14:100194240-100194262 TCCACCACATTGCCAAGACCAGG + Intergenic
1123025120 14:105420473-105420495 TGCACCGGAGTCCCAGCACAGGG - Intronic
1202852162 14_GL000225v1_random:28492-28514 TACACAAAAGTCCCATCACCTGG - Intergenic
1202855861 14_GL000225v1_random:51918-51940 TACACAAAAGTCCCATCACCTGG + Intergenic
1202867639 14_GL000225v1_random:133028-133050 TAGACAACAGTCCCATCACCTGG - Intergenic
1123448271 15:20344987-20345009 CCCACCCCAGTCCCCACACCAGG - Intergenic
1125025050 15:35021179-35021201 TGCACACCATTCCCACCACCTGG + Intergenic
1129230209 15:74192853-74192875 TGCACCACAGTCCCAACACCCGG + Intronic
1129882358 15:79015879-79015901 ACCACCACAGTGCCAACACTTGG + Intronic
1132350823 15:101138790-101138812 TGCACCCCAGTCCCACCCCAAGG - Intergenic
1132714605 16:1284516-1284538 TGCACCCCAGCCCCAGGACCCGG + Intergenic
1134091944 16:11396266-11396288 TCCTCCACAGTCCCAACACCCGG - Intronic
1134644790 16:15857400-15857422 TCCACCACAGCCCCGACACGGGG - Intergenic
1135682232 16:24467648-24467670 TGCACTACAGTTCAAACTCCTGG + Intergenic
1137008277 16:35298682-35298704 GGCACCAGAGTCACATCACCCGG + Intergenic
1137014980 16:35365637-35365659 GGCACCAGAGTCACATCACCTGG + Intergenic
1137307171 16:47213740-47213762 TGCACCACACTCCCAGCCCATGG - Intronic
1137622546 16:49885637-49885659 TGCACCACTGTCCCAGCATGTGG - Intergenic
1138519340 16:57562193-57562215 TGCATCACAGTCCCACGACTGGG - Intronic
1138653303 16:58474183-58474205 TGCACCACACACCACACACCCGG + Intronic
1140545597 16:75805833-75805855 TGCACCATCCTCCCAATACCTGG - Intergenic
1141162608 16:81639222-81639244 TGCACCACATTCAGATCACCTGG + Intronic
1145377931 17:22368731-22368753 TGCACCACAGTCCTCAAGCCTGG + Intergenic
1145975427 17:28981370-28981392 ATCACCACAGTCCAGACACCAGG - Exonic
1146316792 17:31813623-31813645 TGCACCAATGTCCCCACACCAGG - Intergenic
1147667302 17:42156716-42156738 GGCACCACATTCACACCACCAGG - Intergenic
1148538070 17:48457216-48457238 TGCACCCCACCCCCATCACCTGG - Intergenic
1149626856 17:58085545-58085567 TTGACCACAGTCCCAACACATGG - Intronic
1151697917 17:75727509-75727531 CCCACCCCAGTCCCCACACCAGG - Intronic
1152756739 17:82090189-82090211 TGCCCCACTGGCCCCACACCTGG - Intronic
1159986970 18:74854122-74854144 TGCACCACAGTATCCACCCCTGG + Intronic
1164490090 19:28702540-28702562 AGCAACTCAGTCCCATCACCAGG + Intergenic
1165891763 19:39116843-39116865 CGCACCACCCTCCCAGCACCTGG + Intergenic
1167136271 19:47618042-47618064 TTCACCACAGTCCCAAAAAGGGG - Intronic
1168268872 19:55239031-55239053 TGCCCCACAGTCCCTGCGCCAGG + Intronic
1168455675 19:56506567-56506589 TGCACCACCCTCCCAGCACGAGG - Intergenic
925145474 2:1580673-1580695 CGCAGCACAGTCCCACCTCCAGG - Intergenic
925422853 2:3726059-3726081 TCCACTACAGTCCCACTACCTGG - Intronic
928438737 2:31273703-31273725 TGCATCTCAGTCCCATCACAGGG + Intergenic
929558018 2:42937471-42937493 TTCATTCCAGTCCCAACACCAGG - Intergenic
930020635 2:46999868-46999890 TCCACCCCACTCTCAACACCAGG - Intronic
930169161 2:48233411-48233433 TGCTCCCCAGTACCACCACCTGG - Intergenic
931183197 2:59924117-59924139 TGCATCCCAGTCCCCAAACCAGG + Intergenic
936039452 2:109138720-109138742 AGCTCCACAGCCCCAGCACCTGG - Intronic
938218546 2:129545329-129545351 TGCTCCAGGCTCCCAACACCCGG + Intergenic
946227650 2:218272733-218272755 TGCACCCCAGACCCAACATCAGG - Intronic
947239482 2:227978628-227978650 TGCATCCCATTCCCCACACCTGG + Intergenic
948600682 2:239106080-239106102 TGTCCCACAGCCCCAACACCTGG + Intronic
948729296 2:239953024-239953046 TGCACCACAGTCCCCACCTTGGG - Intronic
1168961307 20:1871811-1871833 TACACCACAGTACCATCACAGGG + Intergenic
1172704880 20:36875847-36875869 TGGCCCACAGTCCCAAGGCCAGG + Intergenic
1173895341 20:46546398-46546420 TGCCCCACATACCCATCACCAGG + Intronic
1174197501 20:48783936-48783958 TATACCACAGTCACAACACAAGG + Intronic
1175759527 20:61551624-61551646 TGGACCACACTCCCACCAGCTGG - Intronic
1175954151 20:62599699-62599721 TGCACCACAGTCCCCATTTCAGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1180483554 22:15776141-15776163 TGCACCAGAGCCCTGACACCGGG - Intergenic
1184786086 22:46672630-46672652 TGCTGCACAGTCTCAACCCCAGG - Intronic
949663011 3:6303677-6303699 TGCACCACAATCTCCACACATGG - Intergenic
952901085 3:38112152-38112174 TGGACCTCACTCCCAACCCCAGG + Intronic
954680160 3:52341316-52341338 TGCACAAGAGTCCCCACATCAGG - Intronic
955411996 3:58661750-58661772 TGCACCCAAAACCCAACACCTGG + Intronic
955998988 3:64708658-64708680 TGCACCACTCTCCTAGCACCCGG + Intergenic
956663071 3:71618191-71618213 TGCACCACACCCACTACACCTGG + Intergenic
958058740 3:88449595-88449617 TGCACCACAATCCAAATAACAGG - Intergenic
960624227 3:119664817-119664839 TTCATCACAGACCCAACACTAGG - Intronic
961342826 3:126240223-126240245 TGCTCCACACTCCCAGCACCTGG - Intergenic
962009440 3:131380113-131380135 TGCAGCTCAGTTCCAACACTTGG + Intergenic
962829347 3:139126323-139126345 TGTACCACCATCCCAAGACCAGG - Intronic
964424328 3:156535322-156535344 TTCACCACAGTCTCCACACAGGG + Intronic
964480246 3:157132191-157132213 TGCATCCCAGTTACAACACCAGG - Intergenic
964777352 3:160292838-160292860 GACACCACGGTCCCAAGACCAGG + Intronic
965726766 3:171725301-171725323 TGCACCATGGTCTCAACAGCAGG - Intronic
966910885 3:184559381-184559403 GGAACCACAGTGCCAACATCCGG + Intronic
967862390 3:194161798-194161820 TGCACCAATGTCCCTATACCTGG - Intergenic
969670364 4:8586848-8586870 TGCACCGCAGTCCCAGGACTGGG + Intronic
970250049 4:14104883-14104905 ATCACCCCAGTGCCAACACCAGG - Intergenic
973552844 4:52052344-52052366 TGAGGCACAGTTCCAACACCAGG + Intronic
973724724 4:53763925-53763947 TGCACCACAGGCCCACAGCCTGG + Intronic
974494556 4:62609675-62609697 TGCACCATTGTCCCCACCCCCGG - Intergenic
976713863 4:88102111-88102133 TGCACCACACTACCATCAGCAGG + Intronic
985160486 4:187039185-187039207 TGCACCACAGTCACAAATTCAGG - Intergenic
988626645 5:32883529-32883551 TGCCCATCTGTCCCAACACCTGG + Intergenic
990065882 5:51714597-51714619 TGCACCACTGCCCCCAAACCTGG - Intergenic
996626037 5:125571388-125571410 CCCACCACAGTCCCAAGACTTGG - Intergenic
999687737 5:154117629-154117651 TGCGCCACCGTACCCACACCTGG + Intronic
1002605464 5:180380497-180380519 TTCAGCAGAGTCCCAGCACCTGG + Intergenic
1008507518 6:52245584-52245606 TGCACCACCCTCCCAGCACAGGG + Intergenic
1016034102 6:139368035-139368057 TGAACCACAGTCCTCACCCCTGG + Intergenic
1021370091 7:19833878-19833900 TGACCAACATTCCCAACACCTGG + Intergenic
1021655197 7:22867731-22867753 TGCACCACATTCTCTACCCCAGG - Intergenic
1021790302 7:24197853-24197875 TTCCCCACAGTCCCAATATCTGG + Intergenic
1022714596 7:32887993-32888015 TGCAGCACTTTCCCAACTCCTGG + Intronic
1024310190 7:47962172-47962194 TGAACCAGAATCCCAACCCCAGG + Intronic
1025025315 7:55511861-55511883 TGCACCAGTGTCACAACCCCAGG - Intronic
1025739713 7:64184556-64184578 TGCCCCACAGCCCCAGCACCAGG + Intronic
1026001044 7:66558884-66558906 AGCACCACAGCCCCAGCACCAGG + Intergenic
1028895733 7:96039727-96039749 TGCACCTCAGTCCCCTCCCCAGG + Intronic
1030370488 7:108694209-108694231 TGCCCCACAGTCACCACAGCTGG + Intergenic
1031472419 7:122182676-122182698 TGCTCCACAGTCACCACAGCTGG - Intergenic
1031866256 7:127040725-127040747 GGGACCAAACTCCCAACACCAGG - Intronic
1035005347 7:155653666-155653688 TGCACCACCCTCCCAGCACGAGG - Intronic
1035584230 8:759524-759546 TGCACACCCGTCCCAACCCCAGG - Intergenic
1037243466 8:16804394-16804416 TGCACCACAGGCTCAACACCAGG + Intergenic
1037783291 8:21886073-21886095 TCCTCCCCAGTCCCCACACCTGG + Intergenic
1039282479 8:36001119-36001141 TGCTCCTTATTCCCAACACCTGG - Intergenic
1039345335 8:36697590-36697612 GGCACAACTGTCCAAACACCTGG - Intergenic
1040277734 8:46022512-46022534 TTTCCCACAGTCCCAACGCCAGG - Intergenic
1047282641 8:123459340-123459362 TGCACCACCCTCCCAGCACATGG + Intronic
1047776249 8:128073157-128073179 TGCCCCTCAGACCCATCACCAGG - Intergenic
1048933577 8:139336784-139336806 TGCACCCTGGTCCCAACACTTGG - Intergenic
1049854342 8:144852290-144852312 TCCACCACAGCCCCAACCCCCGG + Intronic
1051851617 9:21516111-21516133 CACACCACAGTACCTACACCAGG + Intergenic
1051911212 9:22155042-22155064 TGCCCCACAGCCCCAGCACCAGG + Intergenic
1052433088 9:28392568-28392590 TAAACCGCATTCCCAACACCTGG + Intronic
1053091969 9:35286803-35286825 TGCACCACCCTCCCAGCACACGG - Intronic
1056504996 9:87250290-87250312 TCCCCCATAGTTCCAACACCTGG + Intergenic
1060523972 9:124310121-124310143 GGCACCACAGTCCCCAGTCCTGG + Intronic
1062096953 9:134708417-134708439 TGCACCAGAGCCCCCACCCCGGG - Intronic
1062545745 9:137063113-137063135 TGCCCCACAGCCCCAGCACCAGG - Exonic
1187836318 X:23435632-23435654 ATCACCACTGTCCCAACTCCAGG + Intergenic
1187862055 X:23692150-23692172 TGCACCATCATCCCAACACATGG + Intergenic
1189276391 X:39789226-39789248 TCTACCAGAGTGCCAACACCTGG + Intergenic
1194189368 X:90816071-90816093 TGCCCCACAGTCACTACAGCTGG - Intergenic
1199385453 X:147217635-147217657 TGTACCACAGGCTTAACACCAGG - Intergenic
1199904285 X:152208578-152208600 TGCACCCCACTTCCAACACTGGG - Intronic
1200535947 Y:4397964-4397986 TGCCCCACAGTCACTACAGCTGG - Intergenic
1201142673 Y:11041604-11041626 TGCACCACCCTCCCAGCACGTGG - Intergenic