ID: 1129230556

View in Genome Browser
Species Human (GRCh38)
Location 15:74194966-74194988
Sequence CAGCCTGACCAAAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 223}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129230544_1129230556 29 Left 1129230544 15:74194914-74194936 CCCTGACTTCGCACTTGCCGGCC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223
1129230548_1129230556 5 Left 1129230548 15:74194938-74194960 CCATCAAGCTTCACTCCCATTCC 0: 1
1: 0
2: 3
3: 22
4: 278
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223
1129230547_1129230556 8 Left 1129230547 15:74194935-74194957 CCTCCATCAAGCTTCACTCCCAT 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223
1129230549_1129230556 -10 Left 1129230549 15:74194953-74194975 CCCATTCCCTCTCCAGCCTGACC 0: 1
1: 0
2: 1
3: 48
4: 457
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223
1129230545_1129230556 28 Left 1129230545 15:74194915-74194937 CCTGACTTCGCACTTGCCGGCCT 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223
1129230546_1129230556 12 Left 1129230546 15:74194931-74194953 CCGGCCTCCATCAAGCTTCACTC 0: 1
1: 0
2: 1
3: 14
4: 229
Right 1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129230556 Original CRISPR CAGCCTGACCAAAGGGAAGC TGG Intronic
900875664 1:5340819-5340841 CAGCAGGAACAAAGGGCAGCAGG + Intergenic
900915205 1:5632677-5632699 CCGCCTGGCCACAGGGCAGCAGG - Intergenic
901687041 1:10948723-10948745 CAGCCTCCCCCAGGGGAAGCAGG - Exonic
902200072 1:14826765-14826787 CAGGCTTACCAATGGGAAACAGG - Intronic
902521744 1:17021938-17021960 GAACCTGGCCAAAGGGCAGCCGG + Intronic
903500156 1:23796184-23796206 CAGCCTGGCCCAAGAGGAGCTGG - Exonic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
911038364 1:93572873-93572895 CTCCCTGAGCAAAGGGCAGCAGG + Intronic
911040760 1:93589056-93589078 CAGCCTCACCAAGGGAAGGCCGG - Exonic
912668106 1:111601186-111601208 CGGCCTCACCAAAGAGAAGCAGG - Intronic
915952573 1:160199217-160199239 CATCCTGAGCAAGGGGAAACAGG + Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
917447718 1:175120726-175120748 CAGCATAACCAAAGTAAAGCTGG - Intronic
917985357 1:180311591-180311613 CAGCCTTAGCAAAAGGTAGCTGG + Intronic
919582144 1:199389581-199389603 CAGCCTGACCCAAGGACAGATGG - Intergenic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
920195847 1:204226565-204226587 CAGTCTGGCCACAAGGAAGCAGG - Intronic
920944146 1:210512344-210512366 CACACTAGCCAAAGGGAAGCAGG - Intronic
921286696 1:213615801-213615823 GAGCCTTCTCAAAGGGAAGCAGG - Intergenic
922538945 1:226404513-226404535 CACCCAGACCAAAGGGCAGCAGG - Intronic
924640107 1:245825461-245825483 CAGCCTGAAGACAGAGAAGCAGG - Intronic
1063959849 10:11298097-11298119 GAGCCAGAACAAAGGGAAACAGG + Intronic
1065305846 10:24367943-24367965 AAGACTGACCAATGGGAAGGAGG - Intronic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1068345851 10:55776804-55776826 CAGCCTGCCCAAAGAGCATCAGG + Intergenic
1069040369 10:63689865-63689887 CAGCCTGTCCAAGGGGACCCAGG + Intergenic
1070860823 10:79659528-79659550 CAGCCTGCCCAAAGAGCACCAGG - Intergenic
1070876441 10:79816052-79816074 CAGCCTGCCCAAAGAGCACCAGG + Intergenic
1071288706 10:84172732-84172754 CAGACTGGCAAAAGGGAGGCCGG - Intergenic
1071356386 10:84800471-84800493 CAGACTGACCAATGGGAACATGG - Intergenic
1072615416 10:97046365-97046387 CAGCCTGACCAGAGGGCAATGGG + Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1075648599 10:124112637-124112659 TAGCCTGCCCAGTGGGAAGCAGG - Intergenic
1075715556 10:124553236-124553258 CAGCCTGACAAAGGGGAACTTGG + Intronic
1077757356 11:5047023-5047045 GAGCCTGACAAAAGGGTAGGCGG - Exonic
1078870744 11:15342317-15342339 GAGGCTGGCCAAAGGGAAGGCGG - Intergenic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1080016572 11:27513259-27513281 GAGCATGAACCAAGGGAAGCTGG + Intergenic
1082702172 11:56445472-56445494 CAACCTGACAAAAGAGAAACTGG - Intergenic
1083341664 11:61962252-61962274 CAGCCTGAACAAAGAGGAGATGG + Exonic
1084374150 11:68764475-68764497 CAGCCTGGGGAAGGGGAAGCCGG + Intronic
1084404053 11:68960836-68960858 CTGACTGCCCACAGGGAAGCAGG + Intergenic
1085271355 11:75272005-75272027 CTGCCTGTCCCAAGGGAGGCCGG + Intronic
1086436470 11:86786011-86786033 CTGCCTGGCCAATGGGAATCGGG + Intergenic
1089009236 11:115119269-115119291 CAACCTGGCCCAAGGGAAGGGGG + Intergenic
1089074175 11:115724778-115724800 CAGCATGGCCAAGGGGAAGATGG - Intergenic
1089269048 11:117288795-117288817 CAGCCTGACCAAAAGTGAGATGG - Exonic
1090542761 11:127727223-127727245 CAACCTGACAAATGTGAAGCTGG - Intergenic
1090772763 11:129936020-129936042 CAGCCTGACCTCATGGAAGGAGG + Intronic
1093826118 12:23691144-23691166 CAGCCAGGCCAAAGGCAAGGAGG + Intronic
1093880293 12:24396491-24396513 CAGCATGAACAATGGGAACCGGG - Intergenic
1096037082 12:48481944-48481966 CACCATCACCAAAAGGAAGCAGG + Intergenic
1096215422 12:49795528-49795550 CTGCCTCACCAAAGTGGAGCTGG - Exonic
1096611964 12:52807941-52807963 CATCCTAACCCAAGGAAAGCTGG - Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1098772125 12:74565775-74565797 CATCCTGAACACAGGAAAGCAGG - Intergenic
1098780892 12:74685359-74685381 CACACTGAACAAAGGAAAGCAGG + Intergenic
1101119242 12:101562075-101562097 CAGCCAGGGCAAAGGCAAGCAGG - Intergenic
1101230494 12:102736477-102736499 CAGCCTCACCAATGGGGAGGGGG - Intergenic
1101848712 12:108385310-108385332 CACCCTGACCAGAGGAATGCAGG - Intergenic
1102199488 12:111047552-111047574 GAGCCTGCCCCAAGGGATGCTGG - Intronic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1103672161 12:122626742-122626764 GAGCCAGACAAAAGGGAAGAAGG + Intergenic
1104474760 12:129062129-129062151 CAGCCTGATCCAGGGGAACCAGG - Intergenic
1106285607 13:28316144-28316166 CTGCCTGAGCGTAGGGAAGCGGG - Intronic
1112094873 13:96121474-96121496 CCACCTGCCCAAAGGGAAGGAGG - Intronic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114567343 14:23642506-23642528 CAGCCTGATGGAGGGGAAGCAGG - Intronic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122814318 14:104304836-104304858 CCGCCTCACCAAAGGGCTGCAGG - Intergenic
1124149042 15:27160269-27160291 CAGACTGACCTAAGGAAAGATGG - Intronic
1126667101 15:51085413-51085435 GGGCCTGACCCAAGGGAAGGAGG + Intronic
1127393624 15:58526504-58526526 CAACCTGGCCAAATGGAAGATGG + Intronic
1128156391 15:65394447-65394469 CAGCCTGAGCAATGGGCAGGTGG - Exonic
1129230556 15:74194966-74194988 CAGCCTGACCAAAGGGAAGCTGG + Intronic
1129530903 15:76263689-76263711 CACACTGACCAAATGGAAACTGG - Intronic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1133955688 16:10441966-10441988 CACACTGAACAAAGGAAAGCAGG + Intronic
1136624873 16:31456267-31456289 CAGCCTGACCAACTAGAGGCTGG + Intergenic
1137285184 16:47009906-47009928 CAGCCTGACCAAAAATTAGCTGG - Intergenic
1137546514 16:49408191-49408213 CAGCCTATCCAAGGGGAAGCCGG + Intergenic
1139149863 16:64369443-64369465 CAGATTGACCATGGGGAAGCTGG - Intergenic
1140816991 16:78630409-78630431 CAGCCTCCACAAAGGAAAGCAGG - Intronic
1140949082 16:79798470-79798492 CAGCCAGACTGAAGGGAAGAGGG - Intergenic
1142169860 16:88616023-88616045 CAGCCTCCCCAGAGGAAAGCGGG + Intronic
1143290303 17:5823148-5823170 CAGCCTGACCAGGCTGAAGCAGG - Intronic
1144655190 17:17030764-17030786 CATCCTGACCAAGGGGTACCAGG + Intergenic
1144697447 17:17314618-17314640 CAGCCTGGCCAAGGGACAGCGGG - Intronic
1144855906 17:18267671-18267693 CTGCAGGACCCAAGGGAAGCAGG + Intergenic
1145408955 17:22638596-22638618 CAGCCTGCCCAAAGAGCATCAGG + Intergenic
1146884216 17:36460076-36460098 CAGCCAGCCCAAACAGAAGCGGG - Intergenic
1147245710 17:39119094-39119116 CAGCCAGACCTCAAGGAAGCTGG - Intronic
1148669771 17:49402037-49402059 CAGCCCGACCAAAGGGGAGAGGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1153825998 18:8875495-8875517 CAGCCTTTCCTAAGGGGAGCTGG + Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156228654 18:35132996-35133018 CAGCCTGGCATAAGAGAAGCTGG - Intronic
1157586728 18:48805817-48805839 CAACCTGTCCAAAGGGTAGGGGG - Intronic
1158885041 18:61819039-61819061 CAGCATGAGCAAAGGAAAGAAGG + Intronic
1160059383 18:75515505-75515527 CAGCCAGACCACAGAGAAGCTGG + Intergenic
1160872736 19:1284543-1284565 CAGCCTGAACAAAGGTCAGGTGG + Intergenic
1162834601 19:13308071-13308093 GAGCCTGACCCCAGGGAACCAGG + Intronic
1164478485 19:28593301-28593323 AAGGTTGACCAAAGGCAAGCAGG + Intergenic
1165341352 19:35214381-35214403 TAGACTGACCAAATGCAAGCTGG - Intergenic
1166066970 19:40365854-40365876 CAGCCTGTCCAGACAGAAGCTGG + Exonic
927061230 2:19423299-19423321 AATACTGACCAAAGGAAAGCTGG - Intergenic
927518444 2:23685592-23685614 GAGCCTGCCCACAGGGCAGCTGG - Intronic
927577680 2:24213178-24213200 GAGCCTGGACAAGGGGAAGCAGG - Intronic
928111737 2:28516212-28516234 AAGACTGACCAAAAGTAAGCTGG + Intronic
929599302 2:43194934-43194956 CACCCCGGCCTAAGGGAAGCTGG - Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
933165920 2:79074526-79074548 CCGCCTGACCAAAGGCAAAAAGG - Intergenic
934935125 2:98459841-98459863 CAACTTGACCTCAGGGAAGCAGG - Intronic
936084353 2:109456293-109456315 CAGCCTGACAATAGGGGAACAGG - Intronic
936525899 2:113241550-113241572 CAGCCACACCAAAGGCGAGCAGG - Exonic
938319801 2:130355536-130355558 CAGCCGGGCCCAAGGGAGGCCGG - Intergenic
938694520 2:133823248-133823270 CATCAAGACCAAAGGCAAGCAGG + Intergenic
939355447 2:141095759-141095781 AAGCAAGACCAAAGGGCAGCTGG - Intronic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
947991341 2:234489850-234489872 CTTCCTGATCAAAGGGCAGCAGG + Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948117044 2:235501017-235501039 CAGCCTGTCCCATGGAAAGCAGG - Intronic
948592243 2:239058553-239058575 AAACCTGGCCAAAGGGCAGCTGG + Intronic
948635360 2:239331119-239331141 CAGCCTGCCCAGGAGGAAGCGGG + Intronic
1172303203 20:33863987-33864009 CATCCTGACCAAAGCAAAGCCGG - Intergenic
1173297372 20:41771708-41771730 GAGGCTGAAGAAAGGGAAGCAGG + Intergenic
1174153325 20:48501255-48501277 CAGCCTGACAGTAGTGAAGCTGG - Intergenic
1175000361 20:55621622-55621644 CACACTGAACAAAGGAAAGCAGG + Intergenic
1177867596 21:26531223-26531245 CATGCTCACCACAGGGAAGCTGG + Intronic
1178479870 21:32970716-32970738 CACCCTGACCAAACGGGAGTGGG + Intergenic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1180133916 21:45848184-45848206 CAGCCTGACCATCGGGACTCAGG + Intronic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1183504178 22:38199956-38199978 CATCATGAGCAAAGGAAAGCAGG + Intronic
1184063905 22:42104579-42104601 CACACTGAACAAAGGAAAGCAGG + Intergenic
1184065305 22:42115541-42115563 CACACTGAACAAAGGAAAGCAGG + Intergenic
1184079252 22:42206936-42206958 CACCATGAGCAATGGGAAGCTGG + Intronic
1184538377 22:45103165-45103187 CTGCCTGACCTGGGGGAAGCAGG - Intergenic
1185237406 22:49722527-49722549 AAACCTGACCAAAGGAAAGGTGG + Intergenic
1185347350 22:50316437-50316459 CAGCCGGACAAAGGGCAAGCGGG + Exonic
951463584 3:22977420-22977442 CAGCCTGATCAAACAGGAGCAGG + Intergenic
952195725 3:31073698-31073720 CAGCCAAATCAAATGGAAGCTGG - Intergenic
952707197 3:36391463-36391485 GAGACTGTCCAAAGGGCAGCAGG - Intronic
952901073 3:38112085-38112107 TAGCCTGACCAAGGAGAGGCTGG + Intronic
953749174 3:45596144-45596166 CAGCCTTACCCTAGGGGAGCTGG - Exonic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954869670 3:53758179-53758201 AAGCCTTTCCAAAGGTAAGCGGG - Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
958896524 3:99835921-99835943 CAGCATGATCAAAGGTAAGAAGG + Intronic
959337120 3:105080088-105080110 CAGCCTGACCACATGGTAGAAGG - Intergenic
962250041 3:133830490-133830512 CAGCATGAACAAAGGAAAGAAGG - Intronic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
967351276 3:188516372-188516394 CAGCCTCACCAAACGGATCCTGG - Intronic
967811759 3:193766622-193766644 CAGCCATAAAAAAGGGAAGCGGG - Intergenic
968047270 3:195631360-195631382 CAGCCTCACCCAAGGGCAGTTGG + Intergenic
968253995 3:197248581-197248603 CACACTGAACAAAGGAAAGCAGG + Intronic
968307343 3:197658564-197658586 CAGCCTCACCCAAGGGCAGTTGG - Intergenic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969929283 4:10614346-10614368 CAGCCTTACTTAAGGGAACCAGG - Intronic
973258585 4:48137905-48137927 CAGCTTGAGCAAAGGTAAGGAGG - Intronic
978279029 4:106987542-106987564 CTGCCTGAGGAAAGGGACGCAGG + Intronic
980889468 4:138798674-138798696 CAGCCTGACTGAAGAGAAGGGGG + Intergenic
981114050 4:140969109-140969131 CAGCCTGAGCAAATGTAACCTGG - Intronic
981530060 4:145743812-145743834 CAGCTTGAGCAAAGGCAAGAAGG - Intronic
984922687 4:184779531-184779553 CAGACTGCCCAAAGGAAGGCTGG + Intronic
986704160 5:10441640-10441662 CAGCCAGAGCAAGGGGAAGAGGG + Exonic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
996789344 5:127275990-127276012 CAGCCAGCCCAAAGGGTAGTAGG + Intergenic
997782642 5:136675504-136675526 CAGCCTAAAGAAAGGGAAGGTGG - Intergenic
998537549 5:142948547-142948569 CAGCATGGCCACAGGGATGCTGG - Intronic
998847775 5:146327558-146327580 CAGCTTTAGCAAAGGGAAGGAGG - Intronic
999988861 5:157031416-157031438 CAGCCTGAACCAAATGAAGCAGG + Intronic
1000275791 5:159733623-159733645 CAGACAGACCAAAGGGGAGTAGG + Intergenic
1001110453 5:168891677-168891699 CATTCTGACCAAAGGGAAAAAGG + Intronic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1003417273 6:5921918-5921940 CAGCCTGAAGTCAGGGAAGCTGG + Intergenic
1003424161 6:5985892-5985914 CAGCCTGAGTATAGGGTAGCAGG + Intergenic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1007289564 6:40775179-40775201 CAGCATGTGCAAAGGCAAGCAGG - Intergenic
1008420474 6:51293485-51293507 CAGCCTACTCATAGGGAAGCTGG + Intergenic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1012475733 6:99613600-99613622 CAGCCTGCCCAAAGCGAGGCCGG - Exonic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018429754 6:163713557-163713579 CAGCCTCACCAAAGAGATGGGGG - Intergenic
1018613045 6:165662139-165662161 CGGCCTGGCCAAGGGGGAGCCGG + Intronic
1019181013 6:170187326-170187348 CAGCCTTGCCAAAGAGGAGCTGG + Intergenic
1020015503 7:4829179-4829201 CAGCCTGACCCACGGCAAGGAGG - Intronic
1021924804 7:25523943-25523965 AGGCCTGAGCAAAGGGAAGGGGG + Intergenic
1022099728 7:27161870-27161892 CAGCCTGGCCCAAGAGAATCTGG - Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1023664915 7:42513062-42513084 CAGCAAGGTCAAAGGGAAGCAGG - Intergenic
1026143647 7:67727094-67727116 GAGCCTGGCCAAAGGGAATTTGG + Intergenic
1026690638 7:72547497-72547519 CAGCCTGAAGCAGGGGAAGCCGG + Intergenic
1031879731 7:127183113-127183135 AATGCTGACCAAAAGGAAGCTGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1033718123 7:144024387-144024409 CAGCCTGAACAAAGACAAGGAGG - Intergenic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1034981992 7:155485035-155485057 CAGCCTGAACAAAGGCCAGCAGG + Intronic
1035131325 7:156656821-156656843 CAGCCCCTCCCAAGGGAAGCAGG + Intronic
1035324728 7:158057615-158057637 CCTCCTGAGCAAAGGGAAGTGGG + Intronic
1035553044 8:544745-544767 CCGCCTGACCATGTGGAAGCTGG - Exonic
1038455439 8:27669530-27669552 CAGCCTGGCCTCAGAGAAGCCGG - Intronic
1039358313 8:36845947-36845969 CTGCCTGACGAAAGAGAAGAGGG + Intronic
1047192810 8:122693672-122693694 CAGCCTGAACATAGAGAGGCAGG + Intergenic
1047367588 8:124226332-124226354 TGGCCTGACCAATGCGAAGCAGG + Intergenic
1048382104 8:133874281-133874303 CAGGCTGGCCAAAGGAAGGCTGG + Intergenic
1050251816 9:3752826-3752848 CAGACTGACAACAGGGATGCTGG - Intergenic
1055022372 9:71684023-71684045 CACCCTGTGGAAAGGGAAGCTGG + Exonic
1055723860 9:79206452-79206474 CACCCTGAGAAAAGGGAAGATGG + Intergenic
1056474394 9:86939437-86939459 CAGCGTGACCAAAGGCATACAGG - Intergenic
1057119823 9:92561193-92561215 CAAGGTGACCAAATGGAAGCTGG - Intronic
1058377056 9:104334679-104334701 CACCCAGAACAAAGGAAAGCAGG - Intergenic
1059329118 9:113524059-113524081 CAGCCTGACCACAGGGCGGTGGG + Intronic
1059585583 9:115602721-115602743 CAGCCTCACCAAATGGACGATGG - Intergenic
1060397983 9:123329471-123329493 ATGCCTAACCACAGGGAAGCCGG - Intergenic
1061369856 9:130192103-130192125 CTGCCTGGCTAAAGGGCAGCTGG - Intronic
1062028767 9:134352585-134352607 CAGTCCCACCAAAGGAAAGCGGG - Intronic
1188007355 X:25024591-25024613 AAGCCTGACCAATGGGATCCTGG - Intergenic
1188938144 X:36202681-36202703 CAGCCTGACCAATATGAAACCGG + Intergenic
1192558407 X:72108612-72108634 CAGCCTGAGCAAACTGCAGCAGG + Intergenic
1195060428 X:101189129-101189151 CACACTGACCAAACGGAAACTGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1197827746 X:130608492-130608514 CAGCCTGAGCAATTGGAAGGAGG - Intergenic
1198580588 X:138060023-138060045 CAACCTGTCCAAAGGGAAAATGG - Intergenic
1200758402 Y:7013459-7013481 CATACAGACCAAAGGAAAGCAGG - Intronic