ID: 1129231136

View in Genome Browser
Species Human (GRCh38)
Location 15:74197745-74197767
Sequence GACTCACTGACAGCGAGGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129231127_1129231136 26 Left 1129231127 15:74197696-74197718 CCACTGCCCAGGCTGGCAGCAGC 0: 1
1: 1
2: 9
3: 68
4: 617
Right 1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1129231129_1129231136 19 Left 1129231129 15:74197703-74197725 CCAGGCTGGCAGCAGCTTGCAAG 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1129231128_1129231136 20 Left 1129231128 15:74197702-74197724 CCCAGGCTGGCAGCAGCTTGCAA 0: 1
1: 0
2: 0
3: 10
4: 220
Right 1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1129231134_1129231136 -4 Left 1129231134 15:74197726-74197748 CCAGGTTCAACTTGGGTTGGACT 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 122
1129231126_1129231136 27 Left 1129231126 15:74197695-74197717 CCCACTGCCCAGGCTGGCAGCAG 0: 1
1: 0
2: 7
3: 55
4: 460
Right 1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129231136 Original CRISPR GACTCACTGACAGCGAGGCC AGG Exonic
901065440 1:6492015-6492037 GAGGCTCTGACAGAGAGGCCTGG + Intronic
902609771 1:17590144-17590166 GCCCCTCTGACACCGAGGCCAGG + Intronic
902678396 1:18025398-18025420 GAGTCAATGTCAGAGAGGCCTGG - Intergenic
904982950 1:34522115-34522137 CACTCACTCACAGCATGGCCTGG + Intergenic
905472781 1:38206083-38206105 GGCTCACTGCCAGTGAGGCTGGG - Intergenic
906673624 1:47677616-47677638 GACGCACAGAGAGGGAGGCCTGG + Intergenic
907695019 1:56716417-56716439 AACTCACTGACATATAGGCCAGG - Intergenic
910932309 1:92454690-92454712 GACTCAGTGTCAGCCAGGCGTGG - Intergenic
911728674 1:101269028-101269050 GAATTACTGACATCTAGGCCTGG + Intergenic
913210290 1:116576585-116576607 GCCTCCCTGACAGATAGGCCGGG + Exonic
920511391 1:206554918-206554940 GATTCACTGACAGCTGGGACAGG + Intronic
921314087 1:213874360-213874382 GACTCACTGTGAGCCAGCCCTGG - Intergenic
921366388 1:214378710-214378732 AACTCACTAACAGCAAAGCCTGG + Intronic
1065197333 10:23279189-23279211 GACTCACTGATAGCGAGACAGGG + Intronic
1066425150 10:35301656-35301678 GTCTCACTGTCACCCAGGCCTGG + Intronic
1067918889 10:50432419-50432441 AAGTCACTGAAAGCGAGGCTGGG - Intronic
1072732111 10:97853201-97853223 GAGTCACAGACAGCCAGGTCAGG - Intronic
1080028981 11:27641144-27641166 GTCTGTCTGACAGCCAGGCCTGG + Intergenic
1083271092 11:61573022-61573044 GACCCATTCACAGCGGGGCCTGG - Intronic
1084285442 11:68128103-68128125 GAGTGACTGACAGGGAGGCAGGG + Intergenic
1087836300 11:102878792-102878814 GACTCACTGAAAGCAAGAACTGG - Intergenic
1088607835 11:111548324-111548346 AACTCACTGATAGAGAGGCCAGG - Intronic
1092150138 12:6242244-6242266 GTTTCACTGACAGACAGGCCAGG + Intergenic
1096382761 12:51172890-51172912 GACTGACCGGAAGCGAGGCCTGG - Intronic
1096403159 12:51323991-51324013 GCCAGACAGACAGCGAGGCCCGG + Intronic
1097166486 12:57089027-57089049 GACGCACAGGGAGCGAGGCCCGG - Exonic
1099408550 12:82294231-82294253 GACTGACGGTCAGCAAGGCCAGG + Intronic
1101389884 12:104290666-104290688 GTCTCACTGTCACCTAGGCCAGG - Intronic
1102621075 12:114194872-114194894 GACTGTCTGACAGTGAGGCTGGG + Intergenic
1117237141 14:53790137-53790159 GACTCTCTGGGAGTGAGGCCTGG - Intergenic
1118205230 14:63716659-63716681 GACTCACTGTCACCCAGGCTGGG - Intronic
1123122373 14:105922823-105922845 GAAGCCCTGACAGCGATGCCTGG + Intronic
1125430974 15:39593212-39593234 TACTCACCTACAGCGAGTCCAGG - Exonic
1125771355 15:42168480-42168502 GACTCACTGACCCAGAGGCAGGG + Intronic
1126469711 15:48995437-48995459 CAATCACAGACAGGGAGGCCAGG + Intronic
1128624554 15:69186240-69186262 GACCCACTGTCAGAGAGGCTGGG + Intronic
1129231136 15:74197745-74197767 GACTCACTGACAGCGAGGCCAGG + Exonic
1129454723 15:75670555-75670577 GTCACACTGCCAGCCAGGCCTGG - Intergenic
1129600336 15:76994933-76994955 GGCCCACTGACAGTGTGGCCAGG - Intronic
1130961103 15:88659171-88659193 GACCCACTGAGAGCGGGGCTTGG - Intergenic
1131294311 15:91133784-91133806 GGCTCACTGACACCCAGGCAAGG - Intronic
1132502494 16:290726-290748 GACTCACTGACTGCACGGGCTGG + Intronic
1132932040 16:2463859-2463881 GACTCCCTGCCAGCAAGTCCAGG + Intronic
1133119036 16:3595141-3595163 AGCGCACTGACAGGGAGGCCAGG + Intronic
1135142218 16:19931651-19931673 CACTCACAGACAGCAAGGCAAGG - Intergenic
1136254607 16:29029651-29029673 GACTCTGTGACTGGGAGGCCTGG + Intergenic
1137780096 16:51090644-51090666 GATTAACTGACATCTAGGCCTGG + Intergenic
1142189084 16:88709339-88709361 GGCTCACTCACAGAGTGGCCTGG - Intronic
1142202906 16:88769679-88769701 GAAGCAGTGACAGCCAGGCCCGG - Intronic
1142342757 16:89534798-89534820 CAGTCACGGACAGCGTGGCCTGG - Intronic
1144295310 17:13869676-13869698 GCCATACTGACAGCGAGGCAGGG + Intergenic
1145774835 17:27520679-27520701 GGCTCACAGGCAGGGAGGCCAGG + Intronic
1146284335 17:31564419-31564441 GACTCAGTGCCAGCGAATCCAGG - Intergenic
1146982178 17:37174149-37174171 GACTAGCTGACAGCCAGGCGCGG - Intronic
1148355319 17:46971957-46971979 GTCACACTTACAGCCAGGCCTGG + Intronic
1152925305 17:83084905-83084927 GAGACACTGTCAGCCAGGCCCGG - Intronic
1156310651 18:35918871-35918893 GACTCAATGACAGTTAAGCCAGG + Intergenic
1160559844 18:79749367-79749389 GACTCCCTCACAGCGACGCTGGG - Intronic
1164096043 19:22010752-22010774 GACACACTGAGAGAGTGGCCCGG - Intronic
1164115538 19:22215592-22215614 GACACACTGAGAGAGTGGCCTGG - Intergenic
1165422625 19:35729894-35729916 GACTCAGTGACAGTGGTGCCTGG + Intronic
1165704343 19:37964879-37964901 GATTCTCTGAGAGTGAGGCCTGG + Intronic
1168315831 19:55484415-55484437 GACTCACTGCCAGCCGGGGCGGG + Exonic
1168724608 19:58573859-58573881 GACTCACAGACTGGGAGGACCGG + Intergenic
930177391 2:48314799-48314821 GACTCACCGTCAGCTCGGCCGGG - Exonic
933267781 2:80200822-80200844 CACTCACTCACAGCCAGGCATGG - Intronic
939240287 2:139549774-139549796 TACTCACTGACTGTAAGGCCGGG - Intergenic
941022174 2:160420601-160420623 TACTGACTGACAGTGAAGCCAGG - Intronic
942674795 2:178415338-178415360 AAGTCAGTGACAGCTAGGCCAGG + Intergenic
946271348 2:218596847-218596869 GTCCCACTGACAGCCAGGCATGG - Exonic
946397753 2:219451786-219451808 GCCTCACTGACCGTGAGACCCGG + Exonic
948768854 2:240237044-240237066 GACTGACTGACAAGTAGGCCTGG - Intergenic
1173840317 20:46152767-46152789 GTCTCACTGCCACCCAGGCCTGG + Intergenic
1174331806 20:49825798-49825820 GCCTGCCTGACAGCGAAGCCGGG - Intronic
1175268235 20:57715274-57715296 AACTCACAGACACCGAGTCCAGG - Intergenic
1179171914 21:38979807-38979829 CACTCACTGACTGCGTGGTCAGG - Intergenic
1179581490 21:42347368-42347390 GCCTCAGTGCCATCGAGGCCAGG - Intronic
1180617675 22:17139142-17139164 GCCTCCCTGCCAGCGAGGCGTGG + Intronic
1181339619 22:22167128-22167150 GACTCACTGACACCAGGGCAGGG - Intergenic
1182151614 22:28031168-28031190 GACACACGGACAGCCAGGCCAGG + Intronic
1183494613 22:38135493-38135515 GACTCACTGACAGTGTGGTAAGG - Intronic
1184269551 22:43371163-43371185 GACTCATTGAAAGCAAGGCCAGG - Intergenic
950273851 3:11641820-11641842 AACTTACGGACAGCGAGCCCAGG - Intronic
950678888 3:14571354-14571376 GCCTCAGTGACAGCCATGCCTGG - Intergenic
953461207 3:43082511-43082533 CACACACTGACAGAGAGGCCTGG + Intronic
953899855 3:46833869-46833891 GACTCACTGCGTGGGAGGCCCGG - Exonic
961360603 3:126364904-126364926 GGGCCACTGACAGCCAGGCCTGG + Intergenic
961412618 3:126733650-126733672 GACTCACAGACAGGGTGTCCAGG - Intronic
962024716 3:131535907-131535929 GAATCACAAACAGTGAGGCCAGG + Intronic
962929657 3:140024536-140024558 GACTAGCTGACACCAAGGCCAGG - Intronic
966091388 3:176142928-176142950 CACTCACTGAGAGCCAGGCATGG + Intergenic
966447668 3:180021410-180021432 GGCTCCCTGAGAACGAGGCCTGG - Intronic
969702126 4:8773518-8773540 GCCCCACTGTCACCGAGGCCTGG - Intergenic
972643601 4:40947259-40947281 GGCTCACAGACAGCGAGCTCTGG + Intronic
976215228 4:82709873-82709895 GACTCACTGACGGCCTGCCCTGG + Intronic
980178386 4:129374941-129374963 GACTCACAGGCAGGGAAGCCAGG - Intergenic
984919099 4:184748354-184748376 GGCCCACTGACAGCTGGGCCCGG + Intergenic
987369414 5:17179647-17179669 GCCTCGCGGACAGAGAGGCCAGG + Intronic
988479784 5:31620090-31620112 GACCCAGTGTCAGTGAGGCCAGG + Intergenic
997791527 5:136766623-136766645 GACTCACCGTCAGCCAGGCTGGG - Intergenic
1001527833 5:172441345-172441367 GACACACTGACTGCTCGGCCTGG + Intronic
1003076646 6:2988736-2988758 GAGTCACCGACAGCAAGGCATGG + Intronic
1007560873 6:42807212-42807234 GTCTCACTGTCACCGAGGCTGGG + Intronic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1015843729 6:137497205-137497227 GACTCCCTGGCTCCGAGGCCGGG + Intergenic
1016939841 6:149474695-149474717 GATTTCCTGACAGCTAGGCCGGG - Intronic
1017725694 6:157274783-157274805 GGCGACCTGACAGCGAGGCCCGG - Intergenic
1017763874 6:157591660-157591682 GACTCTCTGACAGCAGGACCAGG + Intronic
1018321067 6:162608974-162608996 GCCTCACTGGCAGAGAGGCGAGG - Intronic
1019055918 6:169223241-169223263 GACTCACCTACAGCGATGCCGGG + Exonic
1020326830 7:6980765-6980787 GACTCAGTGACCATGAGGCCAGG + Intergenic
1022105114 7:27191783-27191805 CACTCACTGAGGGAGAGGCCTGG + Intergenic
1024185669 7:46945857-46945879 GACTCAGTGACAGAGTGTCCAGG + Intergenic
1030358418 7:108569392-108569414 GACTCACTGGCAGAGCGGACAGG + Intronic
1030376970 7:108763343-108763365 GACTCTCTGATAGTGAGGCCTGG + Intergenic
1039875077 8:41578263-41578285 TACTCACCGACCGCGAGGCTAGG - Exonic
1042149565 8:65767552-65767574 GACTCACAGTCAGAAAGGCCAGG - Intronic
1046496307 8:115018988-115019010 GACTCACTGACACTGAAGCTAGG - Intergenic
1049214515 8:141401638-141401660 GACTTCCTGCCAGGGAGGCCAGG - Intronic
1049344536 8:142131510-142131532 TTTTCCCTGACAGCGAGGCCTGG - Intergenic
1050282629 9:4066912-4066934 GGCTCACTGACACCCAGGCAGGG + Intronic
1051632862 9:19156441-19156463 GAGTCATTGACAGCCAGGCGCGG + Intergenic
1057276021 9:93676379-93676401 CTCACACTGACAGGGAGGCCAGG + Intronic
1058943046 9:109832058-109832080 CACTCACAGACAGGGAGGCAAGG + Intronic
1059512798 9:114865003-114865025 GAATCTCTGACAGTGAGGTCTGG - Intergenic
1187853644 X:23615756-23615778 GATTCACTGACAGTGATACCAGG - Intergenic
1189217680 X:39341041-39341063 GACTCACATACAGCAAGGCATGG + Intergenic
1192436703 X:71147767-71147789 GGCTCAGGGACAGCGAGGGCGGG - Exonic
1194289347 X:92050063-92050085 AACACACTGACAGCTGGGCCTGG - Intronic
1200088674 X:153624358-153624380 AACTCACTGACTGCGAGGGCCGG + Intergenic
1200606862 Y:5274633-5274655 AACACACTGACAGCTGGGCCTGG - Intronic