ID: 1129232632

View in Genome Browser
Species Human (GRCh38)
Location 15:74205261-74205283
Sequence CTTCTAAGTTACCCAGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1815
Summary {0: 1, 1: 0, 2: 2, 3: 121, 4: 1691}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129232632_1129232638 -5 Left 1129232632 15:74205261-74205283 CCTGACTCTGGGTAACTTAGAAG 0: 1
1: 0
2: 2
3: 121
4: 1691
Right 1129232638 15:74205279-74205301 AGAAGGAAAGGGGGTTTATGTGG 0: 1
1: 0
2: 2
3: 33
4: 499
1129232632_1129232640 20 Left 1129232632 15:74205261-74205283 CCTGACTCTGGGTAACTTAGAAG 0: 1
1: 0
2: 2
3: 121
4: 1691
Right 1129232640 15:74205304-74205326 CACAGTTCTGCAGGCTGTGCAGG 0: 35
1: 700
2: 1424
3: 2775
4: 3506
1129232632_1129232639 11 Left 1129232632 15:74205261-74205283 CCTGACTCTGGGTAACTTAGAAG 0: 1
1: 0
2: 2
3: 121
4: 1691
Right 1129232639 15:74205295-74205317 TATGTGGCTCACAGTTCTGCAGG 0: 6
1: 286
2: 1429
3: 3323
4: 5745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129232632 Original CRISPR CTTCTAAGTTACCCAGAGTC AGG (reversed) Intronic
900422234 1:2560616-2560638 CTTCTCAGGCACCGAGAGTCAGG + Exonic
900840155 1:5042225-5042247 TTTCTAAATTACCCAGTCTCGGG - Intergenic
900907778 1:5572828-5572850 TTTATAAATTACCCAGTGTCTGG + Intergenic
900937422 1:5775329-5775351 CTTATAAATTACCCAGTCTCAGG - Intergenic
901276817 1:7998068-7998090 TTTATAAGTTACCCAGCCTCAGG + Intergenic
901906801 1:12419414-12419436 CTTATAAATTACCCAGTCTCAGG - Intronic
902063212 1:13662699-13662721 CATGTAAATTACACAGAGTCTGG - Intergenic
902102664 1:14005070-14005092 TTTATAAATTACCCAGTGTCAGG + Intergenic
902133766 1:14286382-14286404 ATTCTGAGTTCCCCAGGGTCAGG + Intergenic
902161074 1:14530782-14530804 CTTATAAATTACCCAGTCTCTGG + Intergenic
902246138 1:15122024-15122046 CTTATAAGTTACCCAGTGTCAGG + Intergenic
902655958 1:17868547-17868569 TTTCTATGTTATCCAGAGTTAGG + Intergenic
903062278 1:20678045-20678067 TTTATAAATTACCCAGTGTCGGG - Intronic
903321311 1:22544917-22544939 CTTCTCAGTGACCCGGAGCCAGG - Intergenic
903562770 1:24241035-24241057 CTTATAAATTACCCAGTCTCAGG - Intergenic
904314696 1:29652620-29652642 CTTGTAAATTACCCAGCCTCAGG - Intergenic
904358379 1:29956300-29956322 CTTATAAATTACCCAGTCTCGGG + Intergenic
904401773 1:30261577-30261599 CTTCTAAATTACCCAGTCTCAGG - Intergenic
905507759 1:38493650-38493672 TTTCTAAGTTACCCAGTCTCAGG + Intergenic
906134451 1:43486924-43486946 CTTATAAGTTACCCAGTCTCTGG - Intergenic
906575694 1:46887187-46887209 ATTATAAGTTACCCAGTCTCAGG + Intergenic
906596282 1:47080709-47080731 ATTATAAGTTACCCAGTCTCAGG - Intronic
906721896 1:48012494-48012516 CTTATAAATTACCCAGTCTCAGG + Intergenic
906829117 1:49013121-49013143 CTTATAAATTACCCAGTCTCAGG + Intronic
906995347 1:50787601-50787623 CTTATAAATTACCCAGTCTCAGG + Intronic
907253136 1:53156605-53156627 CTTGTAAATTACCCAGTCTCAGG + Intergenic
907330457 1:53667628-53667650 CTTATAAATTACCCAGTGTTAGG - Intronic
907568006 1:55455119-55455141 CTTATAAATTACCCAGTCTCAGG + Intergenic
907582609 1:55585431-55585453 CTTATAAATTACCCAGTCTCAGG - Intergenic
907598905 1:55746953-55746975 TTTATAAGTTACCCAGGCTCAGG - Intergenic
907796158 1:57719747-57719769 TTTATAAATTACCCAGTGTCAGG + Intronic
907900273 1:58734894-58734916 CTTATAAATTACCCAGTCTCAGG - Intergenic
907962054 1:59293289-59293311 TTTATAAGTTACCCAGCCTCTGG - Intergenic
908091184 1:60686875-60686897 TTTCTAAGTTACCCAATCTCAGG + Intergenic
908266507 1:62384581-62384603 TTTATAAATTACCCAGACTCAGG + Intergenic
908600479 1:65733767-65733789 TTTATAAGTTACCCAGCCTCAGG - Intergenic
908846123 1:68326040-68326062 TTTATAAATTACCCAGTGTCAGG + Intergenic
909016499 1:70385642-70385664 CTTGTAAATTACCCAGTTTCAGG - Intergenic
909241176 1:73215780-73215802 GTTATAAATTACCCAGATTCTGG - Intergenic
909259793 1:73472812-73472834 TTTATAAGTTACCCAGAGTCAGG - Intergenic
909344018 1:74564519-74564541 CTTATAAATTACCCAGTCTCAGG - Intergenic
909352267 1:74668109-74668131 TTTATAAATTACCCAGTGTCAGG + Intronic
909402027 1:75244132-75244154 TTTATAAATTACCCAGCGTCAGG + Intronic
909510916 1:76451213-76451235 TTTCTAAATTACCCAGTCTCAGG - Intronic
909528728 1:76657756-76657778 CTTATAAGTTACTCAGTCTCAGG + Intergenic
909557669 1:76972074-76972096 TTTATAAGTTACCCAGTCTCGGG - Intronic
909716755 1:78717709-78717731 TTTATAAATTACCCAGTGTCAGG - Intergenic
909866876 1:80685284-80685306 TTTCTAAATTACCCAGTCTCAGG - Intergenic
909870215 1:80729481-80729503 CTTGTAAATTACCCAGTTTCAGG - Intergenic
910087229 1:83418047-83418069 TTTATAAGTTACCCAGTATCGGG - Intergenic
910440628 1:87247993-87248015 CTTATAAATTACCCAGTCTCAGG - Intergenic
910512291 1:88020985-88021007 CTTATAAATTACCCAGTCTCAGG - Intergenic
910833646 1:91485799-91485821 CTTATAAGTTACCCAGTTTGTGG - Intergenic
910877978 1:91895462-91895484 CTTATAAATTACCCAGTATCAGG + Intronic
911020810 1:93386050-93386072 TTTCTAAATTACCCAGTCTCAGG + Intergenic
911032353 1:93503128-93503150 CTTATAAATTACCCAGTCTCAGG - Intronic
911172618 1:94785022-94785044 CTTATAAATTACCCAGTCTCAGG + Intergenic
911235022 1:95403261-95403283 TTTATAAATTACCCAGACTCAGG + Intergenic
911246495 1:95524297-95524319 TTTTTAAGTTACCAAGACTCAGG - Intergenic
911339723 1:96621798-96621820 CTTCTAAGTTACCCAATCTCAGG + Intergenic
911512651 1:98826728-98826750 CTTATAAATTACCCAGCCTCAGG + Intergenic
911571931 1:99528017-99528039 TTTCTAAGTTACCCAGTCTCAGG - Intergenic
911596665 1:99805658-99805680 TTTATAAATTACCCAGTGTCGGG - Intergenic
911855434 1:102870062-102870084 TTTATAAATTACCCAGTGTCAGG - Intergenic
912033247 1:105276454-105276476 TTTATAAATTACCCAGACTCAGG - Intergenic
912085540 1:105998205-105998227 CTTATAAATTACCCAGTCTCAGG - Intergenic
912731882 1:112114477-112114499 GTTGTAAATTACCCAGACTCAGG - Intergenic
913094632 1:115504375-115504397 TTTATAAGTTACCCAGTCTCAGG + Intergenic
913157317 1:116112624-116112646 CTTCTAAGTCTCCCACAGTAAGG - Exonic
913461990 1:119097446-119097468 CTTGTAAGTTAGCAAGAGTATGG - Intronic
913490510 1:119375649-119375671 TTTATAAGTTACCCAGTCTCAGG - Intronic
914694272 1:150061751-150061773 CTTCTGACTAACCCCGAGTCTGG + Intergenic
915077672 1:153323427-153323449 ATTATAAATTACCCAGTGTCAGG + Intergenic
915644880 1:157262970-157262992 CTTATAAATTACCCAGTCTCAGG - Intergenic
916062079 1:161106293-161106315 CTTATAAATTACCCAGTCTCAGG + Intronic
916272145 1:162954592-162954614 TTTATAAATTACCCAGACTCAGG + Intergenic
916481024 1:165214382-165214404 CTTATAAATTACCCAGTCTCCGG + Intronic
916693939 1:167218311-167218333 CTTGTAAGTTACCAAGTGTCAGG + Intergenic
916768419 1:167884182-167884204 CTTGTAAATTACCCAGTATCAGG - Intronic
916793431 1:168144282-168144304 TTTATAAGTTACCCAGGCTCAGG + Intergenic
917106567 1:171498253-171498275 TTTATAAGTTACCCAGTCTCAGG - Intronic
917352977 1:174097214-174097236 TTTATAAATTACCCAGTGTCAGG + Intergenic
917521520 1:175751761-175751783 TTTATAAGTTACTCAGACTCAGG + Intergenic
917700918 1:177580311-177580333 TTTATAAGTTACCCAGTTTCAGG - Intergenic
918039336 1:180903077-180903099 TTTATAAGTTACCCAGTCTCAGG - Intergenic
918053781 1:181000295-181000317 CTTATAAATTACCCAGTCTCGGG - Intronic
918266402 1:182846024-182846046 CTTCTCACTTCCCCAGAGGCTGG + Intronic
918331643 1:183466762-183466784 CTTATAAATTACCCAGTCTCGGG - Intergenic
918670609 1:187210777-187210799 TTTATAAGTTACCCAGTCTCAGG + Intergenic
918686460 1:187421781-187421803 CTTATAAGTTACCCAGTCTTTGG + Intergenic
918828203 1:189354677-189354699 TTTATAAGTTACCCAGTCTCGGG + Intergenic
918866754 1:189910220-189910242 CTTATAAATTACCCAGTCTCAGG + Intergenic
918978134 1:191517307-191517329 TTTCTAAATTACCCAGTCTCAGG + Intergenic
918984944 1:191613459-191613481 TTTATAAGTTACCCAGTCTCAGG + Intergenic
919254739 1:195106252-195106274 CTTATAAATTACCCAATGTCAGG - Intergenic
919536847 1:198797919-198797941 CTTATAAATTACCCAGTCTCAGG - Intergenic
919553970 1:199028727-199028749 CTCATAAATTACCCAGTGTCAGG + Intergenic
919588137 1:199464757-199464779 CTTATAAATTACCCAGTCTCGGG - Intergenic
919784331 1:201249788-201249810 CTTATAAATTACCCAGTTTCAGG - Intergenic
920274883 1:204797191-204797213 TTTATAAATTACCCAGTGTCAGG + Intergenic
920520811 1:206624158-206624180 CTTATAAATTACCCAGTCTCAGG + Intergenic
920607590 1:207404449-207404471 CTTATAAATTACCCAGTCTCAGG + Intergenic
920719280 1:208371934-208371956 CTTATAAATTACCCAGTCTCAGG - Intergenic
920974919 1:210776703-210776725 TTTATAAGTTACCCAGACTATGG + Intronic
921127911 1:212194545-212194567 CTTATAAATTACCCAGTCTCAGG + Intergenic
921197400 1:212772169-212772191 TTTATAAATTACCCAGTGTCAGG + Intronic
921375848 1:214472470-214472492 CTTGTAAGTTACCCAGTCTCAGG + Intronic
921405231 1:214771909-214771931 TTTATAAATTACCCAGTGTCAGG - Intergenic
921443913 1:215221884-215221906 CTTATAAATTACCCAGTCTCAGG - Intronic
921535999 1:216349922-216349944 TTTCTAAATTACCCAGCCTCAGG - Intronic
921572061 1:216791452-216791474 CTTATAAATTACCCAGTCTCAGG + Intronic
921699270 1:218248875-218248897 TTTATAAATTACCCAGTGTCGGG - Intergenic
921768652 1:219006671-219006693 CTTATAAATTACCCAGTCTCAGG - Intergenic
921812295 1:219528958-219528980 TTTGTAAATGACCCAGAGTCAGG - Intergenic
921981886 1:221267808-221267830 CTTATAAATTACCCAGTCTCAGG - Intergenic
922015013 1:221636443-221636465 TTTATAAGTTACCCAGTCTCAGG - Intergenic
922119497 1:222649781-222649803 CTTATAAATTACCCAGTATCAGG - Intronic
922189838 1:223308494-223308516 CTTATAAATTACCCAGTCTCAGG + Intronic
922203661 1:223428423-223428445 CTTATAAATTACCCAGTCTCTGG - Intergenic
922670186 1:227503834-227503856 TTTATAAGTTACCCAGCCTCAGG - Intergenic
922876751 1:228945772-228945794 TTTATAAATTACCCAGTGTCAGG - Intergenic
923021824 1:230170596-230170618 TTTCTAAATTACCCAGTCTCAGG - Intronic
923027497 1:230217579-230217601 TTTGTAAGTTACCCAGTCTCAGG - Intronic
923110959 1:230889682-230889704 TTTATAAATTACCCAGACTCAGG - Intergenic
923139620 1:231150381-231150403 CTTATAAATTACCCAGTCTCAGG - Intergenic
923297139 1:232604975-232604997 CTTATAAATTACCCAGTCTCAGG + Intergenic
923707610 1:236357494-236357516 CTTATAAATTACCCAGTCTCAGG - Intronic
923911728 1:238454074-238454096 ATTCTAAATTACCCAGTCTCGGG + Intergenic
924152273 1:241141434-241141456 TTTATAAGTTACCCAGTCTCAGG - Intronic
924683062 1:246258014-246258036 CTTATAAATTACCCAGTCTCAGG + Intronic
1063094704 10:2899190-2899212 TTTATAAGTTACCCAGCCTCAGG - Intergenic
1063153556 10:3357836-3357858 CTTTTAAATTACCCAGTCTCTGG - Intergenic
1063434048 10:6016391-6016413 TTTATAAGTTACCCAGTCTCAGG + Intronic
1063713060 10:8499515-8499537 CTTATAAATTACCCAGTCTCAGG - Intergenic
1063719392 10:8564585-8564607 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1063840389 10:10065232-10065254 CTTATAAATTACCCAGTCTCAGG - Intergenic
1064115578 10:12574694-12574716 CTTATAAGTTACCCAGTCTCAGG - Intronic
1064155500 10:12900170-12900192 TTTATAAGTTACCCAGTCTCAGG + Intronic
1064234631 10:13562915-13562937 TTTATAAATTATCCAGAGTCAGG - Intergenic
1064300123 10:14115838-14115860 CTTATAAATTACCCAGCCTCAGG + Intronic
1064577751 10:16763252-16763274 CTTGTAAGTTACCCAGCCTCAGG - Intronic
1064584065 10:16822156-16822178 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1064960932 10:20964329-20964351 TTTGTAAATTACCCAGTGTCAGG - Intronic
1065376630 10:25049896-25049918 CTTATAAATTACCCAGCCTCAGG - Intronic
1065376794 10:25051375-25051397 CTTATAAATTACCCAGTCTCAGG - Intronic
1065392019 10:25192345-25192367 TTTATAAGTTACCCAGTCTCGGG + Intronic
1065464069 10:26000815-26000837 TTTATAAGTTACCCAGTCTCAGG - Intronic
1065515512 10:26520302-26520324 CTTATAAATTACCCACTGTCTGG + Intronic
1065626621 10:27635745-27635767 CTTACAAGTTACCCAGTCTCAGG + Intergenic
1065772897 10:29094134-29094156 TTTATAAATTACCCAGACTCAGG - Intergenic
1065787148 10:29227200-29227222 TTTATAAGTTATCCAGATTCAGG - Intergenic
1065856079 10:29831431-29831453 CTTATAAATTACCCAGTCTCAGG - Intergenic
1066253041 10:33652715-33652737 CTTATAAATTACCCAGTCTCAGG - Intergenic
1066260351 10:33723850-33723872 TTTGTAAATTACCCAGTGTCGGG - Intergenic
1066346876 10:34596365-34596387 TTTATAAGTTACCCAGTCTCAGG - Intronic
1066461853 10:35619306-35619328 CTTATAAATTACCCAGCTTCAGG - Intergenic
1066483992 10:35826109-35826131 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1066507235 10:36058045-36058067 TTTATAAATTACCCAGTGTCAGG - Intergenic
1066540726 10:36444072-36444094 CTTTTAAATTACCCAGTCTCAGG + Intergenic
1067012438 10:42727070-42727092 CTTGTAAGTTACCTAGCCTCAGG + Intergenic
1067241593 10:44499711-44499733 CTTATAAATTACCCAGTCTCAGG + Intergenic
1067311154 10:45114822-45114844 CTTGTAAGTTACCTAGCCTCAGG - Intergenic
1067321910 10:45229191-45229213 CTTATAAATTACCCAGTCTCAGG + Intergenic
1067412634 10:46078267-46078289 TTTGTAAGTTACCCAGCCTCAGG + Intergenic
1067578476 10:47423341-47423363 CTTATAAATTACCCAGTTTCAGG - Intergenic
1067819328 10:49513510-49513532 CTTATAAATTACCCAGTCTCGGG - Intronic
1067895627 10:50176290-50176312 TTTTTAAGTTACCCAGTCTCAGG - Intergenic
1067953360 10:50765688-50765710 TTTTTAAGTTACCCAGTCTCAGG + Intronic
1068011220 10:51454542-51454564 CTTATAAATTACCCAGTCTCAGG - Intronic
1068059782 10:52052536-52052558 TTTCTAAGTTACCCAGTCTTAGG - Intronic
1068315212 10:55332880-55332902 TTTATAAATTACCCTGAGTCAGG + Intronic
1068487353 10:57677367-57677389 CTTTTAAATTACCCAGTCTCAGG - Intergenic
1068623494 10:59212255-59212277 TGTATAAGTTACCCAGTGTCAGG + Intronic
1068654594 10:59561833-59561855 CTTATAAGTTACCCAGTCTCGGG - Intergenic
1068712275 10:60147857-60147879 CTTATAAATTACCCAGTTTCAGG + Intronic
1068818162 10:61341726-61341748 CTTATAAATTACCCAGTCTCAGG + Intergenic
1068889324 10:62132447-62132469 CTTATAAATTACCCAGTCTCAGG + Intergenic
1069049865 10:63780953-63780975 TTTATAAATTACCCAGATTCAGG + Intergenic
1069106246 10:64386246-64386268 CTTATAAATTACCCAGCCTCAGG - Intergenic
1069235279 10:66064020-66064042 CTTATAAATTACCCAGTCTCGGG - Intronic
1069685257 10:70313926-70313948 TTTATAAGTTACCCAGCCTCTGG - Intronic
1069764344 10:70842437-70842459 TTTATAAATTACCCAGACTCAGG - Intronic
1069969742 10:72156363-72156385 TTTATAAGTTACCCAGTCTCTGG + Intronic
1070081557 10:73193835-73193857 CTTATAAATTACCCAGTTTCAGG - Intronic
1070224271 10:74484106-74484128 TTTCTAAGGTACCCAGTCTCAGG - Intronic
1070230261 10:74558646-74558668 TTTTTAAGTTACCCAGTCTCCGG + Intronic
1070350064 10:75583270-75583292 CTTGTAAATTACCCAGTCTCAGG - Intronic
1070424553 10:76272700-76272722 TTTATAAATTACCCAGACTCAGG - Intronic
1071028754 10:81146504-81146526 CTTATAAATTACCCAGTCTCAGG + Intergenic
1071279757 10:84089960-84089982 GTTATAAATTACCCAGTGTCAGG + Intergenic
1071338220 10:84619267-84619289 CTTGTAAATTACCCAGTCTCAGG + Intergenic
1071338592 10:84622104-84622126 CTTATACGTTACCCAGTCTCAGG + Intergenic
1071791795 10:88962759-88962781 TTTATAAGTTACCCAGTCTCAGG - Intronic
1071801062 10:89060777-89060799 CTTATAAATTACCCAGTCTCAGG + Intergenic
1071951449 10:90707499-90707521 CTTATAAATTACCCAGTCTCAGG + Intergenic
1071978043 10:90975199-90975221 TTTATAAATTACCCAGATTCAGG - Intergenic
1072266080 10:93729201-93729223 TTTATAAATTACCCAGTGTCAGG + Intergenic
1072296134 10:94011076-94011098 TTTGTAAGTTACCCAGCCTCAGG - Intronic
1072641836 10:97216798-97216820 CTTATAAATTACCCAGTCTCAGG + Intronic
1073148592 10:101296517-101296539 TTTATAAATTACCCAGTGTCAGG + Intergenic
1073159248 10:101375451-101375473 CTTATAAATTACCCAGTCTCAGG + Intronic
1074069399 10:110050808-110050830 TTTCTAAATTACCCAGTGTCAGG + Intronic
1074100228 10:110348856-110348878 TTTATAAATTACCCAGTGTCAGG - Intergenic
1074214213 10:111368641-111368663 CTTATAAATTACCCAGTCTCAGG - Intergenic
1074480465 10:113815669-113815691 CTTATAAATTACCCAGTCTCAGG + Intergenic
1074820920 10:117177819-117177841 TTTCTAAGTTACCCAGCCTCGGG - Intergenic
1074886241 10:117696039-117696061 CTTATAAATTACCCAGTCTCAGG + Intergenic
1074962986 10:118464499-118464521 TTTATAAGTTACCCAGTCTCTGG - Intergenic
1075013318 10:118892988-118893010 TTTATAAATTACCCAGACTCGGG - Intergenic
1075035621 10:119064679-119064701 TTTATAAATTACCCAGTGTCAGG + Intronic
1075076119 10:119351588-119351610 CTTATAAATTACCCAGTCTCGGG + Intronic
1075312941 10:121429974-121429996 TTTGTAAGTTACCCAGCCTCAGG - Intergenic
1075470543 10:122685973-122685995 CTTATAAATTACCCAGTCTCAGG - Intergenic
1075470685 10:122687214-122687236 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1075620128 10:123920988-123921010 CTTGTAAGTTACCCAGTTTGTGG + Intronic
1075720483 10:124583490-124583512 CTTATAAATTACCCAGGCTCAGG - Intronic
1075850577 10:125583261-125583283 CTTTTAAGTTACCCAGTCTCGGG - Intronic
1076118047 10:127914293-127914315 CTTATAAATTACCCAGCGTCAGG + Intronic
1076179011 10:128391500-128391522 CTTCTAAATTACCCAGTCTCAGG - Intergenic
1076276468 10:129203482-129203504 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1076287297 10:129312730-129312752 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1076473872 10:130739000-130739022 CTTATAAATTACCCAGTCTCAGG + Intergenic
1076493043 10:130876745-130876767 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1076830833 10:132993349-132993371 CTGCTACGTTCCCCAGAGTGGGG + Intergenic
1076944081 10:133632189-133632211 CTTATAAATTACCCAGTCTCAGG - Intergenic
1077349834 11:2087509-2087531 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1077371008 11:2181674-2181696 CTTGCAAGTTCCCCAGATTCTGG + Intergenic
1077654566 11:4006377-4006399 CTTATAAATTACCCAGTCTCAGG + Intronic
1077730182 11:4722157-4722179 TTTATAAGTTACCCAGTCTCAGG + Intronic
1078031312 11:7754244-7754266 CTTCTCCCTTACCAAGAGTCTGG + Intergenic
1078193091 11:9109565-9109587 TTTATAAGTTACCCAGTCTCGGG + Intronic
1078324404 11:10367946-10367968 CTTTTAAATTACCCAGTCTCAGG + Intronic
1078332474 11:10436703-10436725 CTTGTAAATTACCCAGTCTCTGG - Intronic
1078424482 11:11238244-11238266 TTTATAAGTTACCCAGTGTTAGG + Intergenic
1078601689 11:12737856-12737878 TTTGTAAGTTACCCAGTCTCAGG - Intronic
1079314737 11:19398079-19398101 CTTATAAATTACCCAGTCTCAGG - Intronic
1079409595 11:20174873-20174895 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1079465403 11:20724856-20724878 TTTATAAATTACCCAGTGTCAGG - Intronic
1079503055 11:21124482-21124504 TTTATAAGCTACCCAGTGTCAGG - Intronic
1079519913 11:21314163-21314185 CTTATAAATTACCCAGTGTCAGG + Intronic
1079664487 11:23087081-23087103 CTTCTAACTTACGCAGATACAGG + Intergenic
1079818617 11:25094879-25094901 TTTATAAATTACCCAGTGTCAGG - Intergenic
1079924662 11:26479393-26479415 TTTATAAGTTACCCAGTTTCAGG - Intronic
1079991708 11:27253266-27253288 CTTATAAATTACCCAGTCTCAGG + Intergenic
1080192879 11:29572035-29572057 CTTCTAAATTACCCAGTTTCTGG - Intergenic
1080247945 11:30200633-30200655 CTTGTAGGTTGCTCAGAGTCAGG - Intergenic
1080417011 11:32078323-32078345 CTTATAAGTTACCCAGTCTTGGG - Intronic
1080480718 11:32647122-32647144 CTTATAAATTACCCAGTCTCAGG - Intronic
1080859027 11:36137002-36137024 TTTATAAATTACCCAGACTCAGG + Intronic
1080967679 11:37232496-37232518 CTTTTAAATTACCCAGTCTCAGG + Intergenic
1080981508 11:37412482-37412504 TTTATAAATTACCCAGACTCAGG + Intergenic
1081043522 11:38242048-38242070 CTTTTAAATTACCCAGTCTCAGG - Intergenic
1081167525 11:39824000-39824022 TTTATAAATTACCCAGTGTCAGG - Intergenic
1081590188 11:44417339-44417361 CTTATAAATTACCCAGTCTCAGG - Intergenic
1082721385 11:56681155-56681177 CTTATAAATTACCCAGTGTCAGG + Intergenic
1082950374 11:58808684-58808706 CTTATAAATTACCCAGTCTCAGG - Intergenic
1083137572 11:60693330-60693352 CTTTTAAATTACCCAGTCTCAGG - Intergenic
1083189252 11:61037466-61037488 TTTCTAATTTATCCACAGTCAGG + Intergenic
1083500615 11:63104552-63104574 TTTATAAGTTACCCAGTCTCAGG - Intronic
1083808176 11:65087426-65087448 CTGCTAAGGTACACAGGGTCAGG + Exonic
1084071808 11:66741438-66741460 TTTATAAATTACCCAGTGTCGGG + Intergenic
1084842744 11:71869935-71869957 CTTATAAATTACCCAGTCTCTGG - Intronic
1085792749 11:79510097-79510119 CTTCTAAATTACCCAGTCTAAGG + Intergenic
1085976207 11:81659111-81659133 CTTATAAATTACCCAGTCTCAGG - Intergenic
1086248950 11:84790980-84791002 CTTATAAGTTACCCAGTCTCAGG - Intronic
1086334186 11:85783111-85783133 TTTATAAGTTACCCAGTCTCGGG - Intronic
1086347750 11:85914783-85914805 TTTCTAAATTACCCAGTCTCGGG - Intronic
1086925116 11:92631661-92631683 TTTATAAATTACCCAGTGTCAGG + Intronic
1087216395 11:95499768-95499790 CTTTTAAGGAACTCAGAGTCTGG - Intergenic
1087302942 11:96456815-96456837 CTTATAAATTACCCAGTCTCTGG + Intronic
1087393469 11:97568794-97568816 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1087570933 11:99927440-99927462 TTTCTAAATTACCCAGTCTCAGG - Intronic
1087706247 11:101495931-101495953 TTTCTAAATTACCCAGTCTCAGG - Intronic
1087807398 11:102569706-102569728 TTTATAAGTTACCCAGTCTCTGG - Intergenic
1087827497 11:102782392-102782414 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1087849349 11:103010431-103010453 CTTATAAATTACCCAGTATCAGG - Intergenic
1088040376 11:105374672-105374694 CTTGTAAATTACCCAGTTTCGGG - Intergenic
1088045879 11:105449723-105449745 TTTGTAAGTTACCCAGTCTCAGG + Intergenic
1088054725 11:105561066-105561088 CTTATAAATTACCCAGTCTCTGG - Intergenic
1088178414 11:107081339-107081361 CTTATAAATTACCCAGTCTCAGG - Intergenic
1088657399 11:112013805-112013827 CTCCTAAGTTACCTAGCCTCAGG - Intronic
1088942671 11:114476501-114476523 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1088951776 11:114579019-114579041 CTTATAAATTACCCAGCCTCAGG - Intronic
1088961590 11:114671898-114671920 CTTATAAATTACCCAGTCTCAGG - Intergenic
1089038838 11:115426374-115426396 CTTCCATGTCACCCAGAGTAGGG + Intronic
1089147666 11:116341777-116341799 CTTATAAATTACCCAGTCTCAGG + Intergenic
1089152146 11:116372527-116372549 TTTCTAAATTACCCAGTCTCGGG + Intergenic
1089238765 11:117055977-117055999 TTTATAAATTACCCAGTGTCAGG + Intronic
1089590703 11:119538797-119538819 CTTATAAGTTACCCAGTCTTAGG + Intergenic
1089669630 11:120044780-120044802 CTTATAAATTACCCAGTCTCGGG - Intergenic
1090058109 11:123440660-123440682 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1090106897 11:123863033-123863055 CTTATAAGTTACCCAGCTGCAGG - Intergenic
1090550791 11:127817602-127817624 GTTATAAGTTACCCAGTCTCAGG + Intergenic
1091666032 12:2419147-2419169 CTTATAAATTACCCAGCCTCAGG - Intronic
1091701829 12:2668488-2668510 CTTATAAATTACCCAGTCTCAGG - Intronic
1091766821 12:3126592-3126614 CTTATAAATTACCCAGTCTCAGG - Intronic
1091860274 12:3775065-3775087 CTTATAAATTACCCAGTCTCAGG + Intergenic
1091965534 12:4737941-4737963 ATTATAAGTTACCCAGTCTCAGG + Intronic
1091967519 12:4757182-4757204 CCTATAAGTTACCCAGTCTCAGG + Intronic
1092656248 12:10688138-10688160 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1092719045 12:11422476-11422498 TTTATAAATTACCCAGTGTCAGG + Intronic
1092798058 12:12133564-12133586 TTTATAAGTTACCCAGCCTCAGG + Intronic
1092811591 12:12275956-12275978 CTTGTAAATTACCCAGTCTCAGG - Intergenic
1093012984 12:14128085-14128107 TTTGTAAATTACCCAGACTCAGG - Intergenic
1093070685 12:14705049-14705071 CTTATAAATTACCCAGTCTCAGG - Intergenic
1093426150 12:19031679-19031701 CTTTTTAGTGACCCAAAGTCTGG + Intergenic
1093558955 12:20514900-20514922 TTTATAAGTTACCCAGTGTCAGG - Intronic
1093646164 12:21587638-21587660 CTTATAAATTACCCAGTCTCAGG + Intronic
1093855428 12:24095943-24095965 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1094234324 12:28146195-28146217 TTTATAAATTACCCAGAGTCGGG + Intronic
1094253815 12:28399147-28399169 TTTATAAATTACCCAGACTCAGG - Intronic
1094276717 12:28685370-28685392 TTTATAAATTACCCAGTGTCAGG - Intergenic
1094305575 12:29015891-29015913 CTTATAAATTACCCAGTGTTTGG - Intergenic
1094432815 12:30388639-30388661 CTTATAAATTACCCAGTCTCAGG - Intergenic
1094717257 12:33024833-33024855 CTTATAAATTACCCAGCCTCAGG + Intergenic
1095188970 12:39233892-39233914 TTTATAAATTACCCAGACTCGGG + Intergenic
1095344294 12:41131178-41131200 CTTATAAATTACCCAGTCTCAGG + Intergenic
1095540418 12:43303468-43303490 TTTATAAATTACCCAGTGTCAGG - Intergenic
1095763880 12:45872451-45872473 TTTATAAGTTACCCAGTCTCGGG - Intronic
1095873126 12:47052034-47052056 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1096544804 12:52330610-52330632 TTTGTAAATTACCCAGTGTCGGG + Intergenic
1096922616 12:55103721-55103743 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1096960073 12:55568865-55568887 CTTATAAATTACCCAGTCTCAGG + Intergenic
1097343487 12:58466147-58466169 CTTTAAAATTACCCAGTGTCAGG - Intergenic
1097385002 12:58940017-58940039 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1097401746 12:59135750-59135772 TTTATAAATTACCCAGTGTCAGG - Intergenic
1097461968 12:59873110-59873132 GTTCTAAATTACCCAGTCTCAGG + Intergenic
1097474526 12:60036899-60036921 CTTATAAATTACCCAGCCTCAGG + Intergenic
1097647155 12:62249992-62250014 ATTATAAATTACCCAGACTCAGG - Intronic
1097681158 12:62650585-62650607 CTTATAAATTACCCAGTCTCAGG - Intronic
1098108992 12:67101973-67101995 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1098146712 12:67504770-67504792 CTTATAAATTACCCAGTCTCAGG + Intergenic
1098177986 12:67813886-67813908 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1098194299 12:67983597-67983619 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1098246562 12:68525092-68525114 CTTATAAATTACCCAGTCTCAGG + Intergenic
1098306413 12:69107161-69107183 CTTATAAGTTACCCAGTCTTAGG - Intergenic
1098330210 12:69344958-69344980 CTTATAAATTACCCAGTGTCAGG + Intergenic
1098476297 12:70908336-70908358 TTTATAAGTTACCCAGTCTCTGG - Intronic
1098487739 12:71041192-71041214 CTTGTAAGTTACCCAATCTCAGG - Intergenic
1098614815 12:72509042-72509064 TTTCTAAATTACCCAGGTTCAGG + Intronic
1098620294 12:72588782-72588804 TTTATAAGTTACCCAGTCTCAGG - Intronic
1098633962 12:72757896-72757918 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1098713193 12:73793520-73793542 CTTATAAATTACCCAGTCTCGGG + Intergenic
1098768754 12:74524937-74524959 CTTATAAATTACCCAGTCTCAGG - Intergenic
1098887145 12:75971600-75971622 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1098939673 12:76519598-76519620 TTTATAAATTACCCAGATTCAGG - Intronic
1099062980 12:77935686-77935708 CTTACAAGTTACCCAGTCTCAGG - Intronic
1099254897 12:80303562-80303584 TTTATAAATTACCCAGTGTCAGG - Intronic
1099566023 12:84247110-84247132 TTTATAAATTACCCAGACTCAGG + Intergenic
1099586438 12:84522843-84522865 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1099669547 12:85673278-85673300 CTTATAAGTTACCCAGTCTCAGG - Intergenic
1099911288 12:88837918-88837940 TTTATAAATTACCCAGTGTCAGG - Intergenic
1099983949 12:89640932-89640954 CTTATAAGTTAGCCAGTCTCAGG + Intronic
1100055397 12:90503117-90503139 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1100221411 12:92508247-92508269 GCTCTAAGTCACCCAGAGCCAGG + Intergenic
1100293627 12:93239874-93239896 CTTATAAATTACCCAGTCTCAGG - Intergenic
1100435359 12:94566102-94566124 CTGCTAAGTGACTCACAGTCGGG - Intergenic
1100465007 12:94836667-94836689 TTTATAAATTACCCAGTGTCAGG - Intergenic
1100559059 12:95729074-95729096 CTTATAAGTTACCCAGTCTCAGG + Intronic
1100805847 12:98282801-98282823 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1100807800 12:98305404-98305426 CTTATAAATTACCCAGACTCAGG + Intergenic
1100906377 12:99304930-99304952 CTTATAAATTACCCAGTCTCAGG - Intronic
1101231635 12:102747509-102747531 CTTATAAATTACCCAGTCTCGGG - Intergenic
1101326540 12:103720749-103720771 CTTATAAGCTACCCAGTCTCAGG - Intronic
1101374883 12:104163044-104163066 TTTATAAATTACCCAGACTCGGG - Intergenic
1101696594 12:107132920-107132942 TTTATAAATTACCCAGGGTCAGG + Intergenic
1101817967 12:108160353-108160375 CTTATAAATTACCCAGTCTCAGG - Intronic
1101919938 12:108924270-108924292 TTTCTAAGTTACCCAGTCTAAGG + Intronic
1101932762 12:109028284-109028306 TTTATAAATTACCCAGTGTCAGG - Intronic
1102393312 12:112567200-112567222 CTTATAAATTACCCAGTCTCAGG + Intergenic
1102669608 12:114606476-114606498 CTTATAAATTACCCAGTCTCAGG - Intergenic
1102765399 12:115428555-115428577 CTTAAGAGTTACTCAGAGTCAGG - Intergenic
1102783831 12:115587824-115587846 CTTGTAAATTACCCAGCCTCAGG + Intergenic
1103008925 12:117442910-117442932 TTTCTAAATTACCCAGTCTCGGG - Intronic
1103158771 12:118710017-118710039 CTTTTAAGTTACCCAGCCTCGGG - Intergenic
1103221277 12:119247743-119247765 TTTATAAGTTACTCAGATTCAGG + Intergenic
1104037052 12:125104831-125104853 CTTATAAATTACCCAGTCTCAGG - Intronic
1104115819 12:125748128-125748150 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1104120338 12:125792953-125792975 CTTATAAATTACCCAGTCTCAGG - Intergenic
1104213975 12:126717777-126717799 TTTATAAGTTACCCAGTTTCAGG - Intergenic
1104318349 12:127725077-127725099 CTTATAAATTACCCAGTCTCAGG + Intergenic
1104331585 12:127852139-127852161 TTTATAAATTACCCAGTGTCAGG - Intergenic
1104349544 12:128033076-128033098 CTTATAAATTACCCAGTCTCAGG - Intergenic
1104381308 12:128310345-128310367 CTTATAAATTACCCAGCCTCAGG - Intronic
1104486840 12:129158786-129158808 TTTATAAATTACCCAGTGTCAGG - Intronic
1104755271 12:131265253-131265275 CTTTGAAGTTACCCAGTCTCAGG - Intergenic
1105405653 13:20130340-20130362 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1105529021 13:21201522-21201544 CTTATAAATTACCCAGTCTCAGG - Intergenic
1105712568 13:23026590-23026612 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1106009197 13:25801754-25801776 TTTGTAAGTTACCCAGTCTCAGG - Intronic
1106074174 13:26443234-26443256 CTTCCAAAGTTCCCAGAGTCTGG + Intergenic
1106093223 13:26618039-26618061 CTTCTAAATTACCCAGTCTTGGG + Intronic
1106161825 13:27208074-27208096 CTTATAAATTACCCAGTTTCAGG + Intergenic
1106350169 13:28922282-28922304 TTTATAAGTTACCCAGTCTCAGG + Intronic
1106360886 13:29029593-29029615 CTTATAATTTACCCAGCCTCAGG - Intronic
1106919829 13:34551690-34551712 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1106936497 13:34728195-34728217 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1107205209 13:37777214-37777236 CTTATAAATTACCCAGTCTCAGG - Intronic
1107287820 13:38815606-38815628 CTTATAAATTACCCAGCCTCGGG - Intronic
1107416256 13:40203528-40203550 CCTATAAGTTACCCAGCCTCAGG + Intergenic
1107447622 13:40482634-40482656 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1107515705 13:41126536-41126558 CTTATAAATTACCCAGTCTCTGG + Intergenic
1107666572 13:42696967-42696989 TTTCTAAATTACCCAGCCTCAGG - Intergenic
1108141870 13:47431972-47431994 CTTATAAATTACCCAGTCTCAGG + Intergenic
1108158303 13:47611255-47611277 CTTATAAATTACCCAGGCTCAGG - Intergenic
1108174442 13:47777782-47777804 CTTATAAATTACCCAGCCTCAGG + Intergenic
1108184442 13:47874257-47874279 CTTATAACTTACCCAGTCTCAGG - Intergenic
1108359691 13:49657941-49657963 CTTATAAATTACCCAGTCTCGGG - Intergenic
1108530124 13:51320726-51320748 GTTCTAAGTCACCCAGTGTGTGG - Intergenic
1108676765 13:52743816-52743838 CATCTAATTTACCCTGAGTGGGG + Intergenic
1108715898 13:53077565-53077587 CTTATAAATTACCCAGTCTCAGG - Intergenic
1108885818 13:55179470-55179492 CTTATAAATTACCCAGTCTCAGG + Intergenic
1108953951 13:56126981-56127003 CTTATAAATTACCCAGTCTCAGG - Intergenic
1109057154 13:57565149-57565171 CTTATAAATTACCCAGTCTCAGG + Intergenic
1109393516 13:61724588-61724610 TTTATAAATTACCCAGTGTCAGG - Intergenic
1109492943 13:63127176-63127198 CTTATAAATTACCCAGTCTCAGG - Intergenic
1109503708 13:63271109-63271131 CTTATAATTTACCCAGGCTCAGG - Intergenic
1109591646 13:64491615-64491637 CTTATAAGTGACCCAGTTTCAGG - Intergenic
1109672332 13:65625775-65625797 TTTATAAATTACCCAGACTCAGG - Intergenic
1109853588 13:68101133-68101155 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1109853838 13:68103053-68103075 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1110161951 13:72389050-72389072 TTTATAAGTTACCCAGACTAAGG + Intergenic
1110338390 13:74359684-74359706 CTTATAAATTACCCAGTCTCAGG + Intergenic
1110370556 13:74735196-74735218 CTTATAAATTACCCAGGATCAGG + Intergenic
1110379894 13:74838777-74838799 TTTATAAATTACCCAGTGTCAGG - Intergenic
1110500702 13:76224436-76224458 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1110520044 13:76464879-76464901 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1110901946 13:80835209-80835231 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1111226720 13:85283131-85283153 CCTATAAATTACCCAGACTCAGG + Intergenic
1111235805 13:85406079-85406101 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1111240171 13:85463629-85463651 CTTATAAATTACCCAGTCTCAGG - Intergenic
1111686446 13:91507344-91507366 TTTGTAAGTTACCCAGTCTCGGG - Intronic
1111756080 13:92397469-92397491 TTTATAAATTACCCAGACTCAGG + Intronic
1111804362 13:93021054-93021076 CTTGTAAATTACCCAGCCTCAGG - Intergenic
1111919813 13:94398110-94398132 TTTCTAAATTACCCAGTCTCAGG + Intronic
1112062159 13:95751747-95751769 TTTATAAATTACCCAGTGTCGGG - Intronic
1112084681 13:96017518-96017540 CTTATAAATTACCCAGCCTCAGG + Intronic
1112119012 13:96388923-96388945 CCTTTAAGTTACCCAGTCTCAGG + Intronic
1112159576 13:96853647-96853669 TTTCTAAATTTCCCAGTGTCAGG + Intergenic
1112162106 13:96878619-96878641 CTTATAAGCTACCCAGTGTATGG + Intergenic
1112351605 13:98639576-98639598 TTTTTAACTTATCCAGAGTCGGG - Intergenic
1112452827 13:99527285-99527307 TTTATAAGTTACCCAGCCTCTGG - Intronic
1112529210 13:100183996-100184018 CTTATAAATTACCCAGTCTCAGG - Intronic
1112586069 13:100719927-100719949 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1112586960 13:100727144-100727166 CTTATAAATTACCCAGTCTCGGG + Intergenic
1112694768 13:101935685-101935707 TTTATAAATTACCCAGTGTCAGG + Intronic
1113035811 13:106047476-106047498 CTTATAAATTACCCAGTCTCAGG + Intergenic
1113060929 13:106322067-106322089 TTTATAAATTACCCAGTGTCAGG + Intergenic
1113090240 13:106610361-106610383 TTTATAAATTACCCAGTGTCCGG + Intergenic
1113119438 13:106910784-106910806 TTTATAAATTACCCAGTGTCAGG - Intergenic
1113134886 13:107078320-107078342 TTTGTAAATTACCCAGTGTCAGG + Intergenic
1113173030 13:107527874-107527896 CTTTTAAATTACCCAGTCTCAGG + Intronic
1113825738 13:113251798-113251820 TTTATAAATTACCCAGTGTCAGG + Intronic
1113976558 13:114231769-114231791 CTTATAAATTACCCAGTCTCAGG + Intergenic
1113980413 13:114270107-114270129 CTTATAAATTACCCAGGCTCAGG - Intronic
1114638323 14:24201600-24201622 CTTATAAATTACCCAGTCTCAGG - Intronic
1114834332 14:26185602-26185624 CTTATAAATTACCCAGTCTCAGG + Intergenic
1114917257 14:27284516-27284538 CTTATAAATTACCCAGTCTCAGG + Intergenic
1114973163 14:28059736-28059758 TTTTTAAATTACCCAGACTCGGG + Intergenic
1114977014 14:28114521-28114543 CTTATAAATTACCCAGTCTCAGG - Intergenic
1114992021 14:28299123-28299145 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1115076810 14:29402955-29402977 CTTATAAATTACCCAGTCTCAGG - Intergenic
1115090248 14:29566438-29566460 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1115268373 14:31525482-31525504 CTTATAAATTACCCAGTCTCTGG - Intronic
1115658359 14:35465701-35465723 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1115715286 14:36096922-36096944 TTTATAAATTACCCAGTGTCAGG - Intergenic
1115716756 14:36114026-36114048 CTTCTCAGTCACCCTGGGTCAGG - Intergenic
1115887631 14:37991344-37991366 TTTATAAGTTACCCAGTCTCAGG + Intronic
1116071114 14:40047071-40047093 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1116146130 14:41071628-41071650 ATTATAAGTTACCCAGTCTCTGG - Intergenic
1116256639 14:42565030-42565052 CTTATAAATTACCCAGTCTCAGG + Intergenic
1116348453 14:43827613-43827635 TTTATAATTTACCCAGACTCAGG + Intergenic
1116746230 14:48822968-48822990 CTTATAAATTACCCAGTCTCAGG - Intergenic
1117070724 14:52053650-52053672 CTTCGAAGTTACCCTGCTTCAGG - Exonic
1117092157 14:52262209-52262231 CTTATAAATTACTCAGACTCAGG + Intergenic
1117106993 14:52407845-52407867 TTTATAAATTACCCAGTGTCTGG + Intergenic
1117150623 14:52884001-52884023 CTCCTAAGTTACCAAGTCTCAGG + Intronic
1117280169 14:54232870-54232892 CTACTAAGTTAAGCAGAGTATGG + Intergenic
1117735163 14:58761684-58761706 TTTATAAATTACCCAGTGTCGGG - Intergenic
1117762776 14:59049574-59049596 CTTATAAATTACCCAGTCTCAGG - Intergenic
1117800062 14:59434055-59434077 CTTATAAATTACCCAGTCTCGGG - Intronic
1117977387 14:61311666-61311688 TTTATAAATTACCCAGTGTCAGG - Intronic
1118261255 14:64248908-64248930 CTTCTAAGCTGCCCAAAGCCTGG + Intronic
1118322781 14:64763169-64763191 CTTCTGAGGCACCCAGAGCCTGG + Intronic
1118358953 14:65039693-65039715 TTTCTAAGTTACCCAGCCTCAGG - Intronic
1118468693 14:66055000-66055022 CTTGTAAATTACCCAGTCTCAGG + Intergenic
1118543110 14:66853430-66853452 TTTATAAGTTACCCAGTCTCAGG - Intronic
1118688485 14:68315061-68315083 CTTCTAAGTTTGCCAGACACAGG - Intronic
1118843736 14:69530633-69530655 CTTATAAATTACCCAGTCTCAGG - Exonic
1118928828 14:70220657-70220679 CTTATAAATTACCCAGTCTCAGG - Intergenic
1118996391 14:70840421-70840443 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1119007260 14:70943094-70943116 CTTATAAATTACCCAGTCTCGGG + Intronic
1119037964 14:71246503-71246525 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1119862527 14:77946877-77946899 TTTGTAAGTTACCCAGTCTCAGG + Intergenic
1120225752 14:81789425-81789447 TTCATAAGTTACCCAGACTCAGG + Intergenic
1120227621 14:81808872-81808894 TTTCTAAGTTACTCAGCCTCAGG + Intergenic
1120358195 14:83460387-83460409 TTTATAAATTACCCAGTGTCAGG - Intergenic
1120384280 14:83824683-83824705 TTTATAAATTACCCAGCGTCAGG - Intergenic
1120391198 14:83910509-83910531 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1120492569 14:85195400-85195422 CTTATAAATTACCCAGTCTCAGG + Intergenic
1120654265 14:87170169-87170191 CTTATAAATTACCCAGTCTCAGG - Intergenic
1120889423 14:89478327-89478349 CTTATAAATTACCCAGTCTCAGG + Intronic
1121211587 14:92211491-92211513 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1121215688 14:92245964-92245986 CTTATAAATTACCCAGCTTCAGG - Intergenic
1121300391 14:92866064-92866086 CTTCTAATTCTCCCAGAATCTGG - Intergenic
1121488279 14:94338281-94338303 TTTATAAATTACCCAGACTCGGG - Intergenic
1121615339 14:95310228-95310250 TTTATAAATTACCCAGACTCAGG + Intronic
1121656460 14:95600123-95600145 CTTATAAATTACCCAGTCTCAGG - Intergenic
1121870086 14:97399471-97399493 CTTATAAATTACCCAGTCTCAGG - Intergenic
1122004962 14:98695439-98695461 TTTATAAATTACCCAGTGTCAGG - Intergenic
1122039338 14:98972596-98972618 CTTATAAATTACCCAGTCTCAGG - Intergenic
1122440784 14:101730521-101730543 CTTATAATTTACCCAGTCTCGGG + Intronic
1122645489 14:103190497-103190519 CTTATAAATTACCCAGTCTCAGG + Intergenic
1122831720 14:104400908-104400930 TTTATAAATTACCCAGACTCAGG + Intergenic
1123102038 14:105810900-105810922 CTTATAAATTACCCAGCCTCAGG - Intergenic
1123198097 14:106636186-106636208 TTTATAAGTTACCCAAACTCAGG + Intergenic
1124029467 15:25996853-25996875 CTTTTAAATTACCCAGTCTCAGG - Intergenic
1124188676 15:27552267-27552289 CTTATAAATTACCCAGTCTCAGG + Intergenic
1124416854 15:29479392-29479414 CTTATAAATTACCCAGGGTCAGG + Intronic
1124571964 15:30872815-30872837 CTTATAAGTTGCCCAGCCTCAGG + Intergenic
1125386560 15:39142868-39142890 ATTATAAGTTACCCAGTTTCAGG + Intergenic
1125393951 15:39226777-39226799 CTTATAAATTACCCAGTCTCAGG + Intergenic
1126044447 15:44625643-44625665 TTTCTAAATTACCCAGTCTCAGG + Intronic
1126179771 15:45773817-45773839 CTTATAAATTACCCAGTCTCAGG - Intergenic
1126210980 15:46099859-46099881 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1126561725 15:50051338-50051360 TTTATAAGTTACCCAGTCTCAGG + Intronic
1126562834 15:50062469-50062491 CTTATAAATTACCCAGTCTCAGG + Intronic
1126697641 15:51339876-51339898 CTTGTAAGTTACCCAGTCTCGGG - Intergenic
1126814926 15:52445416-52445438 CTTATAACTTACCCAGTCTCAGG + Intronic
1126858496 15:52861626-52861648 TTTATAAATTACCCAGACTCAGG + Intergenic
1127060198 15:55174694-55174716 CTTGTAAATTACCCAGTCTCAGG - Intergenic
1127164799 15:56233129-56233151 CTTATAAATTACCCAGTCTCGGG - Intronic
1127263090 15:57339914-57339936 CTTATAAATTACCCAGTCTCAGG + Intergenic
1127344363 15:58079421-58079443 CCTTTAAGTTGCCCACAGTCTGG + Intronic
1127359938 15:58236554-58236576 TTTATAAGTTACCCAGTCTCAGG + Intronic
1127578416 15:60314679-60314701 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1127700310 15:61493117-61493139 CTTATAAATTACCCAGTTTCAGG + Intergenic
1127707954 15:61565926-61565948 CTTATAAATTACCCAGTCTCTGG - Intergenic
1128300399 15:66563299-66563321 TTTACAAGTTACCCAGACTCAGG + Intronic
1128476921 15:68005317-68005339 TTTATAAGTTACCCAGTATCAGG + Intergenic
1128596211 15:68952436-68952458 CTTATAAATTACCCAGCCTCAGG + Intronic
1128702356 15:69813749-69813771 CCTCAAAGTTACCCAGAAGCAGG - Intergenic
1128930963 15:71704569-71704591 CTTATAAATTACCCAGTCTCAGG + Intronic
1129232632 15:74205261-74205283 CTTCTAAGTTACCCAGAGTCAGG - Intronic
1129583924 15:76842573-76842595 CTTTTAAATTACCCAGTCTCAGG + Intronic
1129970946 15:79777467-79777489 CTTATAAATTACCCAGTCTCAGG - Intergenic
1130026421 15:80274665-80274687 TTTGTAAGTTACCCAGCCTCAGG + Intergenic
1130075695 15:80687492-80687514 CTTATAAATTACACAGTGTCAGG + Intronic
1130168809 15:81490941-81490963 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1130397548 15:83516447-83516469 CTTATAAATTACCCAGTCTCAGG - Intronic
1130422146 15:83758200-83758222 CTTATAAATTACCCAGTCTCAGG - Intronic
1131285402 15:91052736-91052758 TTTATAAATTACCCAGACTCAGG + Intergenic
1131327635 15:91463655-91463677 TTTATAAATTACCCAGTGTCAGG + Intergenic
1131350812 15:91698170-91698192 TTTCTAAATTACCCAGTCTCGGG + Intergenic
1131427192 15:92355206-92355228 CTTATAAATCACCCAGAGTCAGG + Intergenic
1131532352 15:93204744-93204766 TTTATAAGTTACCCAGTCTCCGG + Intergenic
1131545860 15:93314909-93314931 CTTCTAAGCCACCCAGATTGTGG - Intergenic
1131628012 15:94144780-94144802 CTTATAAATTACCCAGCCTCAGG + Intergenic
1131694976 15:94867329-94867351 CTTATAAATTACCCAGTCTCAGG - Intergenic
1131733875 15:95311674-95311696 CTTATAAATTACCCAGTCTCAGG + Intergenic
1131766468 15:95681122-95681144 CTTATAAATTACCCAGCGTCAGG + Intergenic
1131969709 15:97879660-97879682 CTTATAAATTACCCAGTCTCAGG - Intergenic
1132034898 15:98474293-98474315 CTTATAAATTACCCAGTTTCAGG - Intronic
1132230757 15:100182113-100182135 TTTATAAATTACCCAGACTCGGG - Intronic
1133066435 16:3210696-3210718 TTTATAAATTACCCAGAGTCAGG + Intergenic
1133404788 16:5514861-5514883 TTTATAAATTACCCAGAATCAGG - Intergenic
1133450250 16:5897995-5898017 CTTATAAATTACCCAGTTTCAGG - Intergenic
1133453711 16:5924233-5924255 TTTATAAATTACCCAGTGTCAGG + Intergenic
1133458592 16:5966261-5966283 CTTCTACTTTACCCAGTCTCAGG - Intergenic
1133599561 16:7326028-7326050 CTGGTCAGTTACCAAGAGTCAGG - Intronic
1133606130 16:7389928-7389950 TTTATAAATTACCCAGACTCAGG - Intronic
1133646889 16:7773113-7773135 CTTATGAGTTACCCAGTCTCCGG - Intergenic
1133703793 16:8334052-8334074 TTTATAAATTACCCAGACTCAGG + Intergenic
1133707556 16:8369521-8369543 CTTATAACTTACCCAGTCTCAGG + Intergenic
1133997699 16:10760900-10760922 CTTATAGGTTACCCAGTCTCAGG - Intronic
1134224062 16:12378142-12378164 CTCATAAATTACCCAGTGTCAGG - Intronic
1134360139 16:13523446-13523468 CTTATAAATTACCCAGTCTCAGG - Intergenic
1135037897 16:19093498-19093520 CTTGTAAATTACCCAGTTTCAGG + Intergenic
1135060706 16:19269121-19269143 TTTATAAGTTACCCAGTTTCAGG - Intergenic
1135530305 16:23247283-23247305 TTTCTAAGTTACCCAGCTACAGG + Intergenic
1135716164 16:24770064-24770086 CTTCTAAGATACGCCCAGTCTGG + Intronic
1135784457 16:25336129-25336151 TTTATAAATTACCCAGTGTCAGG + Intergenic
1135815315 16:25627299-25627321 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1135850689 16:25960322-25960344 TTTATAAGTTACCCAGCCTCAGG + Intronic
1135919503 16:26636110-26636132 TTTATAAATTACCCAGACTCAGG - Intergenic
1135985985 16:27184655-27184677 CTTATAAATTACCCAGTCTCAGG - Intergenic
1136075639 16:27815466-27815488 CTTATAAATTACCCAGCCTCAGG + Intronic
1136282855 16:29224073-29224095 CTTGAAAGTTCCCCAGAGTCTGG - Intergenic
1136527362 16:30840651-30840673 TTTCTAAATTACCCAGTCTCGGG - Intronic
1137382329 16:48011026-48011048 CTTATAAGTTACCCAGTTGCAGG - Intergenic
1137423435 16:48355494-48355516 CTTTTAAATTACCCAGTCTCAGG + Exonic
1137501007 16:49011749-49011771 CTTATAAATTACCCAGTCTCAGG - Intergenic
1138226241 16:55297767-55297789 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1138697656 16:58830435-58830457 CTTATAAATTACCCAGTCTCAGG + Intergenic
1138770787 16:59661182-59661204 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1138800223 16:60017642-60017664 TTTATAAATTACCCAGTGTCAGG - Intergenic
1139316321 16:66072603-66072625 CTTATAAATTACCCAGTGTCAGG - Intergenic
1139339388 16:66258126-66258148 CTTATAAATTACCCAGTCTCAGG + Intergenic
1139346298 16:66306062-66306084 CTTATAAATTACCCAGTCTCAGG + Intergenic
1139406641 16:66724410-66724432 GTTCTAAGAAACTCAGAGTCTGG - Intronic
1139543596 16:67637236-67637258 CTTCTAAGAAACTCAGGGTCAGG + Intronic
1139661411 16:68423591-68423613 TTTCTAAATTACCCAGTCTCAGG + Intronic
1140584147 16:76268710-76268732 CTTATAAATTACCCAGTCTCAGG + Intergenic
1141250693 16:82355660-82355682 CTTATAAATTACCCAGTCTCAGG - Intergenic
1141402984 16:83767023-83767045 CTTATAAATTACCCAGTCTCGGG + Intronic
1141890879 16:86925759-86925781 CCTCTAGGTTCCGCAGAGTCTGG + Intergenic
1141906754 16:87031779-87031801 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1142087232 16:88189969-88189991 CTTGAAAGTTCCCCAGAGTCTGG - Intergenic
1142576640 17:913368-913390 CTTGTCAGTTTTCCAGAGTCTGG + Intronic
1143717731 17:8786764-8786786 TTTCTAAATTACCCAGTTTCAGG - Intergenic
1143831724 17:9657533-9657555 CTTATAAATTACCCAGTCTCAGG - Intronic
1143832735 17:9665312-9665334 TTTGTAAGTTACCCAGTCTCAGG - Intronic
1144091188 17:11857982-11858004 CTTATAAATTACCCAGTCTCAGG + Intronic
1144174836 17:12695143-12695165 CTTATAAGTTACCCAGTTTATGG - Intronic
1144215627 17:13052624-13052646 TTTATAAGTTACCCAGTGTATGG + Intergenic
1144241582 17:13318020-13318042 CTTATAAATTACCCAGTCTCAGG - Intergenic
1144254546 17:13453679-13453701 TTTATAAATTACCCAGTGTCAGG + Intergenic
1144491745 17:15718771-15718793 TTTATAAGTTACCCAGTCTCAGG - Exonic
1144550927 17:16240325-16240347 CTTATAAATTACCCAGTCTCAGG + Intronic
1144908735 17:18660434-18660456 TTTATAAGTTACCCAGTCTCAGG + Exonic
1145187545 17:20808167-20808189 CTTCTAAATTACTCAGTCTCAGG + Intergenic
1146538839 17:33677097-33677119 CTTATAATTTACCCAGTCTCAGG + Intronic
1147037690 17:37694041-37694063 TTTTTAAGTTACCCAGCCTCAGG + Intronic
1147365398 17:39955659-39955681 CTTATAAATTACCCAGTCTCAGG - Intergenic
1147454405 17:40527644-40527666 CTTCTCAGTTATCCACACTCAGG + Intergenic
1147535635 17:41320715-41320737 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1147695308 17:42347926-42347948 CTTATAAATTACCCAGTCTCAGG + Intronic
1147894535 17:43741957-43741979 TTTATAAATTACCCAGACTCAGG - Intergenic
1148689369 17:49518090-49518112 TTTATAAATTACCCAGTGTCAGG + Intergenic
1149067990 17:52503169-52503191 TTTCTAAATTACCCAGTCTCGGG + Intergenic
1149140753 17:53429583-53429605 CTTATAATTTACCCAGTCTCAGG + Intergenic
1149310283 17:55386480-55386502 CTTATAAATTACCCAGTCTCAGG + Intergenic
1149339780 17:55673365-55673387 CTTATAAATTACCCAGTCTCAGG - Intergenic
1149370801 17:55992043-55992065 TTTATAAATTACCCAGTGTCAGG - Intergenic
1149723599 17:58869653-58869675 CTTATAAATTACCCAGTCTCAGG + Intronic
1150034986 17:61784909-61784931 TTTGTAAGTTACCCAGCCTCAGG + Intronic
1150171405 17:62999363-62999385 CTTATAAATTACCTAGACTCAGG + Intergenic
1150853790 17:68731384-68731406 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1151058431 17:71061094-71061116 TTTATAAATTACCCAGACTCGGG + Intergenic
1151136770 17:71954124-71954146 TTTATAAGTTACCCAGTTTCAGG - Intergenic
1151931869 17:77237521-77237543 TTTATAAATTACCCAGTGTCAGG + Intergenic
1152268470 17:79309917-79309939 TTTATAAGTTACCCAGTCTCAGG + Intronic
1152620559 17:81362345-81362367 TTTATAAGTTACCCAGACTCAGG + Intergenic
1152776159 17:82203349-82203371 TTTATAAATTACCCAGCGTCAGG + Intronic
1153376140 18:4381829-4381851 CTTATAAATTACCCAGTCTCAGG - Intronic
1153490430 18:5641335-5641357 TTTATAAATTACCCAGTGTCAGG + Intergenic
1153737566 18:8087373-8087395 TTTATAAGTTACCCAGTCTCGGG - Intronic
1153958611 18:10120991-10121013 CTTGTAAATTACCCAGCTTCAGG + Intergenic
1153967978 18:10199085-10199107 CTACTAAGTGACCCATGGTCTGG + Intergenic
1154178495 18:12108234-12108256 TTTATAAATTACCCAGTGTCAGG - Intronic
1155466955 18:26146826-26146848 TTTATAAGTTACCCAGTCTCAGG - Intronic
1155617342 18:27737560-27737582 CTTATAAATTACCCAGTCTCAGG - Intergenic
1155775174 18:29752550-29752572 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1155883790 18:31182985-31183007 TTTATAAATTACCCAGACTCAGG + Intergenic
1156042215 18:32835493-32835515 CTTGTAAGTTATCCAGTCTCAGG - Intergenic
1156068372 18:33174002-33174024 CTTATAAATTACCCAGTCTCAGG - Intronic
1156078578 18:33308925-33308947 TTTATAAATTACCCAGTGTCAGG + Intronic
1156508204 18:37612553-37612575 CCTTTTAGTTACCCAAAGTCAGG - Intergenic
1156749674 18:40436332-40436354 TTTGTAAGTTACCCAGTCTCGGG + Intergenic
1156832056 18:41503681-41503703 TTTATAAATTACCCAGACTCAGG - Intergenic
1156859166 18:41816370-41816392 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1157091709 18:44644434-44644456 CTTATAAGTTACCCAGCCTCAGG - Intergenic
1157183006 18:45514145-45514167 CTTGTAAATTACCCAGTCTCAGG - Intronic
1157525027 18:48374157-48374179 CTTATAACTTACCCAGTCTCAGG + Intronic
1157737707 18:50065349-50065371 CTTATAAGTTACCCAGGCTCTGG - Intronic
1157817690 18:50741974-50741996 TTTATAAATTACCCAGTGTCAGG - Intergenic
1157917384 18:51679234-51679256 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1158116687 18:54004021-54004043 CTCTTAAGTTACCCAGCCTCAGG + Intergenic
1158125176 18:54092909-54092931 CTTATAAATTACCCAGACTGTGG + Intergenic
1158297041 18:56009898-56009920 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1158317844 18:56231193-56231215 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1158328541 18:56336494-56336516 TTTATAAATTACCCAGACTCAGG + Intergenic
1158403507 18:57141376-57141398 CTTATAAATTACCCAGTCTCAGG + Intergenic
1158744918 18:60188727-60188749 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1158753776 18:60298255-60298277 CTTATAAGTTACCCAGTTTCAGG - Intergenic
1158806309 18:60977818-60977840 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1158863334 18:61614519-61614541 TTTATAAATTACCCAGTGTCAGG + Intergenic
1159069996 18:63612833-63612855 TTTTTAAATTACCCAGTGTCAGG - Intergenic
1159114860 18:64102597-64102619 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1159370442 18:67521347-67521369 ATTATAAATTACCCAGGGTCAGG - Intergenic
1159618889 18:70614348-70614370 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1159654823 18:71020375-71020397 ATTATAAGTTACCCAGTGTCAGG + Intergenic
1159705315 18:71678986-71679008 CTTATAAATTACCCAGTTTCAGG + Intergenic
1159760653 18:72421002-72421024 TTTCTAAATTACCCAGTCTCGGG + Intergenic
1159865538 18:73700243-73700265 CTTATAAATTACCCAGTCTCAGG - Intergenic
1159896148 18:73997579-73997601 TTTATAAGTTACCCAGTTTCAGG + Intergenic
1160012305 18:75115436-75115458 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1160372319 18:78384198-78384220 TTTATAAATTACCCAGTGTCGGG - Intergenic
1161997713 19:7724087-7724109 CTTCTAAATTACCCAGTCTCAGG - Intergenic
1162002907 19:7758792-7758814 TTTATAAATTACCCAGACTCGGG + Intergenic
1162217452 19:9148179-9148201 CTTATAAATTACCCAGTCTCAGG + Intronic
1162306794 19:9879613-9879635 TTTATAAATTACCCAGTGTCAGG + Intronic
1163010542 19:14422846-14422868 TTTATAAATTACCCAGACTCAGG + Intergenic
1163354795 19:16803284-16803306 CATCTCAGTTACCCAGCCTCAGG + Intronic
1164464235 19:28473865-28473887 CTTATAAATTACCCAGTCTCAGG + Intergenic
1164577237 19:29412664-29412686 CTTATAAATTACCCAGTCTCAGG + Intergenic
1164602368 19:29571073-29571095 TTTATAATTTACCCAGACTCAGG - Intergenic
1164785764 19:30929200-30929222 CTCTGAAGTTAACCAGAGTCAGG + Intergenic
1164801647 19:31081615-31081637 TTTATAAATTACCCAGACTCGGG + Intergenic
1165147718 19:33742288-33742310 CTTTTAAATTACCCAGTCTCAGG - Intronic
1165202862 19:34159383-34159405 CTTATAAATTACCCAGCCTCAGG + Intergenic
1165507181 19:36241073-36241095 CTTATACGTTAACCAGACTCAGG + Intronic
1165643978 19:37417560-37417582 TTTCTAAGTTACCCAGCTTGTGG + Intronic
1165667660 19:37647568-37647590 CTTATAAATTACCCAGTCTCAGG + Intronic
1166017652 19:39995014-39995036 CTTATAAGTTACCGAGTCTCGGG + Intronic
1166573312 19:43813467-43813489 CTTATAAATTACCTAGACTCCGG + Intronic
1166670201 19:44705113-44705135 GTTCTAAGATTCTCAGAGTCTGG - Intronic
1167138384 19:47632338-47632360 CTGCCAAGGTCCCCAGAGTCCGG - Intronic
1167237952 19:48326273-48326295 CCTGTATGTAACCCAGAGTCAGG + Intronic
1167769721 19:51507552-51507574 CTCCTAAGTGACCCAGATGCTGG - Intergenic
1168552606 19:57310138-57310160 TTTATAAATTACCCAGACTCAGG + Intergenic
925010671 2:483525-483547 CTTCTAAATTACCCAGTCTCAGG - Intergenic
925038892 2:714878-714900 CTTATAAATTACCCAGTCTCAGG - Intergenic
925248005 2:2402046-2402068 TTTATAAATTACCCAGTGTCGGG - Intergenic
925256918 2:2498284-2498306 TTTATAAGTTACCCAGTCTCAGG + Intergenic
925417908 2:3685292-3685314 TTTGTAAGTTACCCAGTCTCAGG - Intronic
925519684 2:4729908-4729930 TTTCTAAATTACCCAGTCTCAGG - Intergenic
925562182 2:5208757-5208779 TTTCTAAATTACCCAGTCTCGGG + Intergenic
925582567 2:5426278-5426300 TTTATAAGTTACCCAGTCTCAGG - Intergenic
925708722 2:6716168-6716190 TTTCTAAATTACCCAGTCTCAGG + Intergenic
926050551 2:9741729-9741751 TTTATAAGTTACCCAGGCTCAGG + Intergenic
926099404 2:10104683-10104705 TTTATAAATTACCCAGACTCAGG - Intergenic
926173833 2:10571409-10571431 CTTATAAATTACCCAGTTTCAGG + Intronic
926232306 2:11013485-11013507 CTTATAAATTACCCAGTCTCAGG + Intergenic
926240929 2:11084470-11084492 TTTATAAGTTACCCAGTCTCAGG - Intergenic
926306899 2:11643910-11643932 CTTATAAATTACCCAGTCTCAGG - Intergenic
926385174 2:12328642-12328664 TTTATAAGTTACCCAGTCTCAGG + Intergenic
926492685 2:13544278-13544300 TTTATAAGTTACCCAGTCTCAGG - Intergenic
926657141 2:15420380-15420402 CTTCTCATTTCCCCAGAGCCTGG - Intronic
926994035 2:18714667-18714689 TTTATAAATTACCCAGTGTCAGG - Intergenic
927025553 2:19065248-19065270 TTTATAAATTACCCAGTGTCGGG - Intergenic
927127151 2:20022369-20022391 TTTATAAGTTACCCAGTCTCGGG - Intergenic
927160293 2:20251784-20251806 CCTCTAAATTACCCAGAATTGGG - Intronic
927314285 2:21664146-21664168 CTTATAAATTACCCAGTCTCAGG - Intergenic
927341754 2:21991330-21991352 TTTATAAGTTACCCAGTCTCAGG - Intergenic
927347708 2:22065727-22065749 TTTATAAGTTACCCAGTCTCAGG + Intergenic
927395690 2:22648344-22648366 TTTATAAGTTACCCAGTCTCAGG + Intergenic
927881296 2:26691982-26692004 CTTCCAAGACAGCCAGAGTCTGG + Intergenic
927947264 2:27143387-27143409 CTTCTGACTAACCCTGAGTCTGG + Intergenic
928196537 2:29220416-29220438 TTTGTAAATTACTCAGAGTCAGG + Intronic
928235835 2:29538575-29538597 TTTATAAGTTACCCAGACTCAGG + Intronic
928463940 2:31502502-31502524 CTTGTAAATTACCCAGTCTCAGG - Intergenic
928478595 2:31656760-31656782 CTTATAAATTACCTAGACTCAGG + Intergenic
929466413 2:42148754-42148776 TTTATAAGTTACCCAGTCTCAGG - Intergenic
929668067 2:43849242-43849264 TTTATAAGTTACCCAGTCTCAGG - Intronic
930193427 2:48483778-48483800 CTTCTGACTAACCCTGAGTCTGG + Intronic
930276991 2:49323274-49323296 TCTATAAGTTACCCAGACTCGGG - Intergenic
930481206 2:51950922-51950944 CTTATAAATTACCCAGTCTCAGG - Intergenic
930507899 2:52306436-52306458 TTTATAAGTTACCCAGTCTCAGG + Intergenic
930639012 2:53836249-53836271 CTTATAAATTACCCAGCCTCAGG + Intergenic
931065294 2:58579229-58579251 CTTATAAATTACCCAGTCTCGGG - Intergenic
931580081 2:63762512-63762534 CTTATAAATTACCCAGTTTCAGG - Intronic
931622671 2:64226901-64226923 CTTATAAATTACCCAGTCTCAGG + Intergenic
931684840 2:64784419-64784441 CACCTAAGTAACCCAAAGTCTGG - Intergenic
931897214 2:66745402-66745424 TTTATAAGTTACCCAGTCTCAGG + Intergenic
931967234 2:67547281-67547303 TTTATAAATTACCCAGTGTCGGG - Intergenic
932471214 2:71960545-71960567 TTTATAAGTTACCCAGCGTAAGG - Intergenic
932474924 2:71998769-71998791 TTTATAAGTTACCCAGTCTCAGG + Intergenic
932659504 2:73640204-73640226 CTTATAAATTACCCAGTCTCAGG + Intergenic
932666069 2:73699875-73699897 CTTATAAATTACCCAGTCTCAGG + Intergenic
932923087 2:75940420-75940442 CTTATAAATTACCCAGCCTCAGG + Intergenic
932924917 2:75961926-75961948 ATTATAAGTTACCCAGTCTCAGG + Intergenic
932982556 2:76687255-76687277 TTTCTAAATTACCCAGCCTCAGG + Intergenic
933076019 2:77927520-77927542 CTTATAAATTACCCAGTCTCAGG + Intergenic
933167134 2:79088508-79088530 TTTTTAAGTTACCCAGTCTCTGG - Intergenic
933452714 2:82477304-82477326 TTTATAAGTTACCCAGTCTCTGG + Intergenic
933537027 2:83588669-83588691 CTTATAAATTACCCAGACTCTGG - Intergenic
933635216 2:84701474-84701496 CTTATAAATTACCCAGTCTCAGG - Intronic
933646658 2:84818622-84818644 CTGTTAAGTTTCCCAGAATCTGG - Intronic
933943829 2:87267314-87267336 TTTATAAGTTACCCAGTCTCAGG + Intergenic
934152439 2:89160357-89160379 CTTTTAAGATACCGAGAGGCAGG + Intergenic
934214808 2:90021557-90021579 CTTTTAAGATACCGAGAGGCAGG - Intergenic
934694192 2:96386893-96386915 TTTATAAGTTACCCAGCCTCAGG + Intergenic
934988692 2:98905497-98905519 TTTTTAAGTTACCCAGTCTCAGG + Intronic
935140128 2:100345482-100345504 TTTATAAGTTACCCAGTCTCAGG + Intergenic
935927182 2:108082179-108082201 TTTATAAGTTACCCAGTCTCAGG + Intergenic
936161689 2:110088135-110088157 CTTATAAATTACCCAGCCTCAGG + Intronic
936182974 2:110283219-110283241 CTTATAAATTACCCAGCCTCAGG - Intergenic
936257691 2:110930896-110930918 TTTATAAATTACCCAGTGTCAGG + Intronic
936336391 2:111594265-111594287 TTTATAAGTTACCCAGTCTCAGG - Intergenic
936586511 2:113763080-113763102 TTTATAAGTTACCCAGTCTCAGG - Intergenic
936638494 2:114286387-114286409 CTTATAAATTACCCAGGCTCAGG - Intergenic
936647087 2:114384546-114384568 TTTCTAAATTACCCAGTCTCTGG - Intergenic
936695932 2:114948758-114948780 TTTCTAAATTACCCAGTCTCAGG - Intronic
936721143 2:115254124-115254146 CTTATAAATTACCCAGTCTCAGG - Intronic
936738715 2:115477836-115477858 CTTATAAATTACCCAGCCTCAGG - Intronic
936751387 2:115646365-115646387 CTTTTTTTTTACCCAGAGTCAGG - Intronic
937281994 2:120724215-120724237 CTTGTAAATTACCCAGCCTCAGG - Intergenic
937328543 2:121007166-121007188 CTTATAAATTACCCAGCCTCAGG - Intergenic
937550352 2:123081359-123081381 CTTCTATGCTATCCAGATTCTGG + Intergenic
937561112 2:123224710-123224732 TTTATAAGTTACCCAGTCTCAGG - Intergenic
937681099 2:124645728-124645750 TTTCTAAATTACCCAGTTTCAGG - Intronic
937742213 2:125368681-125368703 TTTATAAGTTACCCAGTCTCAGG - Intergenic
938010743 2:127826979-127827001 TTTATAAGTTACCCAGCCTCTGG + Intergenic
938084944 2:128393398-128393420 CTTATAAATTACCCAGTCTCGGG + Intergenic
938231590 2:129666106-129666128 TTTCTAAGTTACCAAGTCTCAGG - Intergenic
938590945 2:132735548-132735570 CTTATAAATTACCTAGCGTCAGG + Intronic
938768694 2:134481575-134481597 CTTGTAAATTACCCAGTCTCCGG + Intronic
938862830 2:135388021-135388043 TTTATAAATTACCCAGACTCGGG - Intronic
938902984 2:135814313-135814335 CTTCTAAATTAGCCAGTGTCAGG + Intronic
939315644 2:140546388-140546410 TTTATAAGTTACCCAGTCTCAGG - Intronic
939407237 2:141774222-141774244 CTTGTAAATTACCCAGCCTCAGG - Intronic
939463446 2:142527129-142527151 TTTATAAGTTACCCAGCTTCAGG + Intergenic
939599258 2:144167745-144167767 CTTCTAAATTACCCAGCCTTCGG + Intronic
939607281 2:144268341-144268363 TTTCTAAATTACCCAGGCTCAGG + Intronic
939760120 2:146165432-146165454 TTTATAAGTTACCCAGTCTCAGG - Intergenic
939781926 2:146459751-146459773 TTTTTAAATTACCCAGACTCAGG - Intergenic
940086442 2:149864453-149864475 TTTATAAATTACCCAGACTCGGG + Intergenic
940122011 2:150277661-150277683 CTTATAAATTACCCAGTGTCAGG - Intergenic
940291435 2:152081052-152081074 TTTATAAGTTACCCAGTCTCAGG + Intronic
941033855 2:160544521-160544543 ATTCTAAGTTACCCAGTCTAAGG + Intergenic
941319610 2:164038830-164038852 TTTATAAGTTACCCAGTCTCAGG - Intergenic
941735934 2:168977632-168977654 TTTCTAAATTACCCAGTCTCAGG - Intronic
941738506 2:169007410-169007432 TTTATAAGTTACCCAGTCTCAGG - Intronic
941909479 2:170749680-170749702 CTTCTAAATTACCCAGTCTGGGG - Intergenic
941997612 2:171615452-171615474 CTTATAAATTACCCAGTCTCAGG + Intergenic
942108569 2:172657826-172657848 CTTATAAATTACCCAGCTTCAGG - Intergenic
942137408 2:172940638-172940660 CTTGTAAATTACCCAGTATCAGG + Intronic
942143467 2:173001617-173001639 CTTATAAATTACCCAGCCTCGGG - Intronic
942283550 2:174390949-174390971 CTTATAAATTACCCAGTCTCAGG + Intronic
942519300 2:176786350-176786372 TTTATAAATTACCCAGACTCAGG + Intergenic
942867843 2:180698021-180698043 TTTATAAGTTACCCAGTCTCAGG - Intergenic
942871192 2:180736265-180736287 CTTGTAAATTACCCAGCCTCAGG + Intergenic
942885381 2:180916931-180916953 CTTATAAATTACCCAGTCTCTGG + Intergenic
942949368 2:181704687-181704709 CTTTTAAATTACCCAGTCTCAGG - Intergenic
943124663 2:183781814-183781836 TTTATAAGTTACCCAGTCTCAGG + Intergenic
943142693 2:184002505-184002527 CTTGTACGTTACCCAGTCTCAGG - Intergenic
943251927 2:185533925-185533947 CTTTTAAATTACCCAGTCTCAGG - Intergenic
943306840 2:186273361-186273383 TTTGTAAGTAACCCAGACTCAGG + Intergenic
943512118 2:188839242-188839264 TTTCTAAGTTACCCAGTCTCAGG - Intergenic
943702671 2:191003733-191003755 CTTATAAATTACCCAGTCTCAGG + Intronic
943715598 2:191149017-191149039 CTTCTAAATTGGCCAGAGTGGGG - Intronic
943957269 2:194208110-194208132 CTTATAAATTACCCAGTCTCTGG - Intergenic
944294610 2:198048428-198048450 CTTATAAATTACCCAGTCTCAGG - Intronic
944418669 2:199505084-199505106 CTTATAAATTACCCAGTGTCAGG - Intergenic
944491403 2:200261926-200261948 CTTATAAATTACCCAGTCTCAGG + Intergenic
945358462 2:208866865-208866887 CTTATAAATTACCCAGCCTCGGG - Intergenic
945368036 2:208980164-208980186 TTTCTAAATTACCCAGCCTCAGG + Intergenic
945552770 2:211241488-211241510 ATTCTAAGTTCTCCACAGTCTGG - Intergenic
945572084 2:211480597-211480619 TTTATAAGTTACCCAGGCTCAGG + Intronic
945676915 2:212866398-212866420 CTTATAAATTACCCAGTCTCAGG - Intergenic
945716395 2:213362780-213362802 CTTATAAATTACCCAGTCTCGGG - Intronic
945805823 2:214488669-214488691 TTTCTAAATTACCCAGTCTCAGG - Intronic
945828740 2:214757155-214757177 CTTATAAATTACCCAGTCTCAGG + Intronic
946466086 2:219913448-219913470 TTTATAAATTACCCAGACTCAGG - Intergenic
946805566 2:223468306-223468328 TTTATAAGTTACCCAGTTTCAGG - Intergenic
946973498 2:225121985-225122007 CTTATAAATTACCCAGTCTCAGG - Intergenic
946986007 2:225274041-225274063 TTTATAAATTACCCAGTGTCAGG + Intergenic
947049613 2:226027506-226027528 GTTATAAGTTACCCAGTCTCAGG - Intergenic
947063831 2:226197739-226197761 CTTATAAGTTACTCAGTCTCAGG - Intergenic
947128560 2:226897480-226897502 TTTATAAATTACCCAGATTCAGG - Intronic
947289043 2:228551178-228551200 CTTATAAATTACCCAGTCTCAGG + Intergenic
947527660 2:230889094-230889116 TTTCTAAATTACCCAGTCTCAGG - Intergenic
947719601 2:232362487-232362509 CTTATAAATTACCCAGTTTCAGG + Intergenic
947805874 2:232967613-232967635 CTTGTAAGTTACCCAGCCTCGGG + Intronic
947942182 2:234067479-234067501 CTTAAAAGTTACCAAGAGGCCGG + Intronic
947947286 2:234116251-234116273 CTTCTAACTAACCCCAAGTCTGG - Intergenic
948224780 2:236300338-236300360 CTTATAAATTACCCAGTCTCGGG + Intergenic
949061125 2:241958088-241958110 CTTATAAGTTACCCAGTCTTGGG - Intergenic
1168943771 20:1734923-1734945 TTTATAAATTACCCAGTGTCAGG - Intergenic
1169083568 20:2813524-2813546 CTTATAAATTACCCAGTCTCAGG + Intergenic
1169291345 20:4355699-4355721 CTTATAAATTACCCAGTCTCAGG + Intergenic
1169745536 20:8938974-8938996 CTTTTAAATTACCCAGACTCAGG - Intronic
1169918139 20:10704151-10704173 CTTATAAATTACCCAGACTCAGG + Intergenic
1170048025 20:12108392-12108414 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1170105229 20:12748148-12748170 CTTCTAAGTATCCCACAGTCTGG + Intergenic
1170318789 20:15070781-15070803 TTTATAAGTTACCCAGTCTCAGG + Intronic
1170331042 20:15210909-15210931 TTTATAAGTTACCCAGTCTCAGG + Intronic
1170387983 20:15841352-15841374 CTTTTAAATTACCCAGTCTCAGG - Intronic
1170456640 20:16539706-16539728 CTTATAAATTACCCAGTCTCAGG + Intronic
1170495516 20:16920233-16920255 TTTATAAATTACCCAGACTCAGG + Intergenic
1170830114 20:19832624-19832646 TTTCTAAGTTACCCAGTCTGGGG - Intergenic
1170872400 20:20218432-20218454 TTTATAAGTTACCCAGTCTCGGG + Intronic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1171724759 20:28606333-28606355 CTTATAAATTACCCAGTCTCAGG - Intergenic
1171753305 20:29076718-29076740 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1171858579 20:30373656-30373678 CTTATAAATTACCCAGTCTCAGG + Intergenic
1172291296 20:33779037-33779059 CTTATAAATTACCCAGTCTCAGG - Intronic
1172719540 20:36989013-36989035 CTTATAAATTACCCAGTTTCAGG + Intergenic
1173295438 20:41751250-41751272 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1173491742 20:43488205-43488227 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1173565809 20:44037753-44037775 CTTTTAAATTACTCAGTGTCAGG + Intronic
1173573708 20:44096265-44096287 CTTGTAAATTACCCAGTCTCAGG - Intergenic
1173710929 20:45155039-45155061 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1173956177 20:47034707-47034729 CTTCAAAGTGACCCAGATTGTGG - Intronic
1174046678 20:47738787-47738809 TTTCTAAATTACCCAGTCTCGGG + Intronic
1174050155 20:47762099-47762121 CTTTTAAATTACCCAGTCTCGGG + Intronic
1174121776 20:48271245-48271267 CTTATAAATTACCCAGGCTCTGG - Intergenic
1174534868 20:51243543-51243565 CTTATAAATTACCCAGTCTCAGG - Intergenic
1174697409 20:52574162-52574184 CTTATAAGTTACCCAGTTTCGGG - Intergenic
1174786516 20:53437996-53438018 TTTCTAAATTACCCAGTCTCGGG + Intronic
1174851360 20:53998308-53998330 TTTATAAATTACCCAGAATCAGG - Intronic
1174872790 20:54199180-54199202 TTTCTAAATTACCCAGTGTTGGG + Intergenic
1175012430 20:55753135-55753157 ATTATAAGTTACCCAGTCTCAGG - Intergenic
1175250008 20:57603563-57603585 CTTATAAATTACCCAGGGTGAGG - Intergenic
1175546606 20:59782187-59782209 CTTATAAATTACCCAGTCTCAGG - Intronic
1175552138 20:59824452-59824474 CTTTTATCTTCCCCAGAGTCTGG + Intronic
1175788592 20:61727523-61727545 CTTATAAATTACCCAGCCTCAGG - Intronic
1176334062 21:5579323-5579345 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1176393695 21:6241629-6241651 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1176467724 21:7074545-7074567 TTTATAAGTTACCCAGTCTCAGG - Intronic
1176491285 21:7456323-7456345 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1176509357 21:7682060-7682082 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1177089416 21:16748302-16748324 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1177170076 21:17645156-17645178 CTTATAAATTACCCAGTCTCAGG + Intergenic
1177243252 21:18489464-18489486 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1177499469 21:21933633-21933655 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1177532260 21:22375239-22375261 CTTCTAAATTACCCAGTCTCAGG - Intergenic
1177619352 21:23566907-23566929 TTTATAAATTACCCAGTGTCAGG + Intergenic
1177683984 21:24412764-24412786 CTTATAAATTACCCAGTCTCAGG + Intergenic
1177855746 21:26398659-26398681 TTTATAAATTACCCAGACTCAGG - Intergenic
1177897649 21:26873523-26873545 CTTATAAATTACCCAGTCTCAGG - Intergenic
1177970567 21:27784583-27784605 ATTTTAAGTTACCCAGGCTCAGG - Intergenic
1178188342 21:30250943-30250965 CTTGTAAATTACCCAGTCTCGGG + Intergenic
1178276345 21:31241159-31241181 CTTATAAATTACCCAGTCTCGGG + Intronic
1178289040 21:31350773-31350795 TTTATAAATTACCCAGTGTCAGG + Intronic
1178291224 21:31370155-31370177 TATCTAAGTTACCCAGATTAGGG + Intronic
1178303815 21:31473896-31473918 TTTGTAAGTTACCCAGTCTCTGG - Intronic
1178379701 21:32097488-32097510 CTTATAAATTACCCAGTCTCAGG - Intergenic
1178805805 21:35838041-35838063 TTTATAAATTACCCAGACTCAGG + Intronic
1179161134 21:38900341-38900363 CTTATAAATTACCCAGTCTCAGG + Intergenic
1179330629 21:40397555-40397577 TTTCTAAATTACCCAGTCTCAGG + Intronic
1179357468 21:40673907-40673929 CTTATAAATTACCCAGCCTCAGG + Intronic
1179527805 21:41995056-41995078 CTTGTAAGTTACCCAGTCTTGGG + Intronic
1179642171 21:42754881-42754903 TTTATAAGTTACCCAGTCTCAGG + Intronic
1180044441 21:45297755-45297777 CTTATAAATTACCCAGTCTCAGG + Intergenic
1180298313 22:10965023-10965045 CTTATAAATTACCCAGTCTCAGG - Intergenic
1180410100 22:12598777-12598799 CTTATAAGTTACCTAGTCTCAGG + Intergenic
1181642398 22:24209925-24209947 CTTCTAACTAACCCTGAGTCTGG - Intergenic
1182401836 22:30084156-30084178 CTTTTTAGTTACCCAGCCTCAGG - Intronic
1182619051 22:31608381-31608403 CTTCTAAGGGACCCAGACACAGG - Intronic
1182753966 22:32663612-32663634 TTTATAAGTTACCCAGTCTCGGG + Intronic
1182891669 22:33824226-33824248 CTTATAAATTACCCAGTCTCAGG - Intronic
1183488136 22:38100749-38100771 CTTATAAATTACCCAGTCTCAGG + Intronic
1184174767 22:42782109-42782131 CTTATAAATTACCCAGTCTCAGG + Intergenic
1184982860 22:48106627-48106649 CTTATAAATTACCCAGGCTCAGG - Intergenic
1184999074 22:48231469-48231491 CTTGCAATTTACCCAGAATCTGG - Intergenic
1185016932 22:48349748-48349770 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1185197105 22:49478547-49478569 TTTATAAGTTACCCAGTCTCAGG - Intronic
1185364487 22:50431039-50431061 CTTCCTAGCTACCCAGAGACTGG + Intronic
949191969 3:1260896-1260918 TTTATAAATTACCCAGTGTCAGG + Intronic
949214577 3:1550389-1550411 CTTATAAATTACCCAGTCTCAGG + Intergenic
949435813 3:4028095-4028117 TTTCTAACTTACCCAAATTCAGG - Intronic
949534003 3:4981388-4981410 TTTCCAAGTGACCCAAAGTCTGG - Exonic
949692226 3:6653861-6653883 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
949693686 3:6668836-6668858 CTTATAAATTACCCAGTCTCAGG + Intergenic
949706054 3:6818140-6818162 TTTATAAGTTACCCAGTCTCAGG - Intronic
949739344 3:7212450-7212472 CTTCAAAGTTTCCCACAGACTGG - Intronic
949756381 3:7415808-7415830 CCTCTATGTTGCCCAGAGTCTGG + Intronic
949850882 3:8419083-8419105 TTTATAAGTTACCCAGTCTCTGG + Intergenic
950211283 3:11125439-11125461 CTTATAAATTACCCAGTCTCAGG - Intergenic
950244598 3:11404652-11404674 CTTATAAATTACCCAGTCTCAGG - Intronic
950249080 3:11448933-11448955 CTTTTAGGTTCCACAGAGTCTGG - Intronic
950310951 3:11957220-11957242 CTTATAAATTACCCAGTCTCAGG + Intergenic
950412371 3:12847449-12847471 ATTCTAAGTTACCCAGTCTCAGG + Intronic
951010280 3:17669306-17669328 CTTATAAATTACCCAGTCTCAGG + Intronic
951177407 3:19618125-19618147 CTTATAAATTACCCAGTCTCAGG - Intergenic
951181544 3:19664851-19664873 TTTCTAAGTTACCCAGGTTCAGG + Intergenic
951272973 3:20650113-20650135 CTTTTAAATTACCCAGTGTCAGG + Intergenic
951507764 3:23467740-23467762 CTTATAAATTACCCAGTCTCAGG - Intronic
951772535 3:26274645-26274667 TTTATAAGTTACCCAGTTTCAGG + Intergenic
951860733 3:27249277-27249299 TTTATAAGTTACCCAGTCTCAGG + Intronic
952346072 3:32487018-32487040 TTTATAAGTTACCCAGTGTCAGG + Intronic
952523405 3:34184874-34184896 TTTATAAGTTACCCAGTCTCGGG + Intergenic
952660062 3:35834821-35834843 TTTCTAAGTTACCAACAGTGAGG + Intergenic
952908115 3:38157169-38157191 TTTCTCAGTTTCCCAGAGTTAGG + Intergenic
952973007 3:38666784-38666806 CTTATAAGTTACCCAGTCTCAGG + Intergenic
953210003 3:40867327-40867349 TTTGTAAGTTACCCAGTCTCAGG + Intergenic
953409106 3:42679221-42679243 TTTCTAAATTACCCAGTCTCAGG - Intergenic
953526781 3:43697597-43697619 CTTATAAATTACCCAGTCTCAGG - Intronic
953835286 3:46338114-46338136 TTTATAAGTTACCCAGTCTCAGG - Intergenic
954029882 3:47811563-47811585 CTTATAAATTACCCAGTCTCAGG - Intronic
954602783 3:51883761-51883783 TTTATAAGTTACCCAGTCTCAGG - Intergenic
954948708 3:54449847-54449869 CTTATAACTTACCCAGTGTCAGG + Intronic
955092046 3:55762100-55762122 CTTATAAATTACCCAGTCTCAGG + Intronic
955384071 3:58464867-58464889 CTTATAAATTACCCAGTCTCAGG - Intergenic
955459917 3:59170474-59170496 CTTGTAAATTACCCAGTCTCGGG + Intergenic
955570070 3:60295284-60295306 TTTGTAAGTTACCCAGTTTCAGG - Intronic
955644834 3:61126350-61126372 TTTATAAATTACCCAGTGTCAGG - Intronic
956354795 3:68378964-68378986 TTTCTAAATTACCCAGTCTCGGG + Intronic
956489039 3:69752156-69752178 TTTATAAGTTACCCAGCCTCCGG + Intronic
956713727 3:72060463-72060485 TTTATAAATTACCCAGTGTCAGG - Intergenic
956916077 3:73872362-73872384 TTTATAAGTTACCCAGTTTCAGG + Intergenic
956967160 3:74475055-74475077 CTTATAAATTACCCAGTCTCAGG + Intronic
956972584 3:74544288-74544310 CTTCAAAGTTTCTCAGAGTCAGG - Intergenic
957016569 3:75070536-75070558 CTTATAAATTACCCAGAATTTGG + Intergenic
957133699 3:76256746-76256768 CTTATAAATTACCCAGTCTCGGG - Intronic
957214287 3:77299390-77299412 TTTATAAGTTACCCAGTCTCAGG - Intronic
957221702 3:77390613-77390635 TTTCTAAATTACCCAGTCTCTGG + Intronic
957317941 3:78592368-78592390 TTTATAAATTACCCAGCGTCAGG + Intergenic
957349094 3:79000076-79000098 TTTATAAGTTACCCAGTCTCAGG - Intronic
957396076 3:79640430-79640452 TTTGTAAATTACCCAGTGTCGGG + Intronic
957476894 3:80737359-80737381 CTTATAAATTACCCAGTGTCAGG - Intergenic
957576363 3:82013831-82013853 CTTATAAATTACCCAGTCTCAGG + Intergenic
957711159 3:83860950-83860972 TTTATAAGTTACCCAGTCTCAGG - Intergenic
957817262 3:85317468-85317490 CTTATAAATTATCCAGTGTCAGG - Intronic
958050152 3:88334770-88334792 TTTATAAGTTACCCAGTCTCAGG - Intergenic
958175466 3:89990681-89990703 CTTATAAATTACCCAGTTTCAGG + Intergenic
958176568 3:90002761-90002783 CTTATAAATTACCCAGTCTCAGG + Intergenic
958583807 3:96060720-96060742 CTTATAAATTACCCAGTCTCGGG + Intergenic
958770110 3:98415563-98415585 CTTTTAAATTACCCAGTCTCAGG + Intergenic
958864866 3:99487711-99487733 ATTCAAAATTACCCAGTGTCAGG + Intergenic
959010845 3:101074252-101074274 CTTATAAATTACCTAGTGTCAGG - Intergenic
959110723 3:102119302-102119324 TTTATAAGTTACCCAGTCTCAGG - Intronic
959223525 3:103552840-103552862 TTTATAAATTACCCAGACTCAGG - Intergenic
959468205 3:106716074-106716096 TTTCTAAATTACCCAGTCTCAGG + Intergenic
959804441 3:110533937-110533959 CTTATAAGTTACCCAGTCTCAGG + Intergenic
959919364 3:111853995-111854017 TTTATAAGTTACCCAGTCTCAGG - Intronic
959935188 3:112021817-112021839 CTTATAAATTACCCAGTCTCAGG + Intergenic
960134103 3:114088588-114088610 CTTATAAATTACCCAGCCTCTGG - Intergenic
960143377 3:114172787-114172809 TTTATAAATTACCCAGACTCAGG - Intronic
960256321 3:115515252-115515274 CTTATAAATTACCCAGTCTCAGG - Intergenic
960362782 3:116734568-116734590 CTTGTAAATTACCCAGTTTCAGG + Intronic
960403760 3:117235140-117235162 CTTCTTTGATACCCATAGTCAGG + Intergenic
960563695 3:119112833-119112855 TTTATAAATTACCCAGACTCAGG - Intronic
960610587 3:119551631-119551653 TTTCTAAATTACCCAATGTCAGG + Intronic
960619379 3:119624082-119624104 TTTGTAAGTTACCCAGTCTCAGG - Intronic
960724907 3:120660214-120660236 TTTGTAAGTTACCCAGTCTCAGG + Intronic
960820330 3:121724006-121724028 CTTATAAATTACCCAGTTTCAGG + Intronic
960972349 3:123148949-123148971 CATCTCAGTTACCCACAGCCTGG - Intronic
961008097 3:123418372-123418394 TTTCTAAATTACCCAGTCTCAGG - Intronic
961114154 3:124314515-124314537 TTTATAAATTACCCAGATTCAGG - Intronic
961338911 3:126204187-126204209 CTTATAAGTTACCCAGTCTCAGG - Intergenic
961695930 3:128704497-128704519 CTTATAAGTTACCCAATCTCAGG + Intergenic
962047072 3:131771683-131771705 TTTGTAAGTTACCCAGCCTCAGG + Intronic
962947366 3:140184289-140184311 TTTATAAGTTACCCAGTCTCAGG - Intronic
963239693 3:142990969-142990991 TTTATAAATTACCCAGTGTCAGG + Intronic
963354003 3:144187430-144187452 TTTATAAGTTACCCAGTTTCAGG + Intergenic
963443540 3:145373129-145373151 TTTATAAGTTACCCAGTCTCCGG - Intergenic
963474968 3:145793484-145793506 TTTCTAAGTTGCCCAGATTTGGG - Intergenic
963511703 3:146255815-146255837 CTTTTAAATTACCCAGCCTCAGG - Intergenic
963517338 3:146324893-146324915 TTTATAAGTTACCCAGTCTCAGG + Intergenic
963574660 3:147045215-147045237 CTTATAAATTACCCAGTCTCAGG - Intergenic
963834515 3:150043171-150043193 TTTATAAGTTACCCAGCCTCAGG + Intronic
963860087 3:150300541-150300563 CTACTAAGTGACCCACAGGCAGG + Intergenic
963878117 3:150499870-150499892 TTTCTAAATTACCCAGTCTCGGG - Intergenic
964078900 3:152726984-152727006 TTTATAATTTACCCAGAATCAGG - Intergenic
964390601 3:156193500-156193522 CTTATAAATTACCCAGCCTCGGG - Intronic
964417341 3:156461194-156461216 ATTTTAAGTTACCCAGTTTCTGG - Intronic
964547400 3:157849417-157849439 CTTCTAAATTACCCAGTCTCAGG - Intergenic
964605921 3:158559855-158559877 TTTCTAAATTACCCAGTCTCAGG + Intergenic
964789527 3:160439768-160439790 CTTATAAATTACCCAGTCTCAGG + Intronic
965083550 3:164065712-164065734 CTTATAAATTACCCAGTCTCAGG + Intergenic
965127289 3:164647811-164647833 TTTCTAAATTACCCAGTCTCAGG - Intergenic
965141483 3:164841650-164841672 CTTTTAAATTATCCAGACTCAGG + Intergenic
965232710 3:166073356-166073378 CTTATAAGTTACTCAGTCTCAGG + Intergenic
965349279 3:167594050-167594072 TTTATAAGTTACCCAGTCTCAGG + Intronic
965627843 3:170699725-170699747 CTTATAAATTACCCAGTCTCAGG - Intronic
965647461 3:170898630-170898652 CTTATAAGTTACTCAGTTTCAGG + Intronic
965652606 3:170948875-170948897 CTTATAAATTACCCAGTTTCAGG - Intergenic
965653251 3:170955544-170955566 CTTATAAGTTACCCAGTCTCAGG + Intergenic
965884317 3:173424964-173424986 TTTATAAGTTACCCAGTCTCAGG - Intronic
965898097 3:173603083-173603105 CTTTTAAGTAACACAAAGTCAGG + Intronic
966256964 3:177927917-177927939 CTAATAAGTTACCCAGTCTCAGG + Intergenic
966320194 3:178694036-178694058 TTTATAAATTACCCAGTGTCGGG - Intronic
966343334 3:178949911-178949933 TTTATAAATTACCCAGACTCAGG + Intergenic
966408755 3:179626956-179626978 TTTATAAATTACCCAGACTCAGG - Intronic
966619031 3:181944503-181944525 TTTATAAATTACCCAGACTCTGG - Intergenic
966641197 3:182192313-182192335 CTTATAAATTACCCAGTCTCAGG + Intergenic
966709854 3:182960077-182960099 TTTGTAAGTTACCCAGTCTCAGG + Intronic
966832811 3:184025328-184025350 TTTATAAGTTACCCAGTCTCAGG - Intergenic
967048167 3:185756355-185756377 CTTATAAATTACCCAGTCTCGGG + Intronic
967239325 3:187421851-187421873 CTTATAAATTACCCTGACTCAGG - Intergenic
967313765 3:188131326-188131348 TTTCTAAATTACCCAGTTTCAGG - Intergenic
967386869 3:188920574-188920596 CTTATAAATTACCCAGCCTCAGG + Intergenic
967526731 3:190503888-190503910 CTTATAAATTACCCAGTCTCAGG - Intergenic
967618264 3:191600147-191600169 CTTATAAATTACCCAGTCTCAGG + Intergenic
967776847 3:193394271-193394293 TTTATAAATTACCCAGTGTCAGG - Intergenic
967777134 3:193396216-193396238 TTTATAAGTTACCCAGTCTCAGG - Intergenic
967919988 3:194607335-194607357 TTTCTAAATTACCCAGCCTCAGG + Intronic
968009376 3:195263644-195263666 TTTCTAAATTACCCAGTCTCGGG + Intronic
968373644 4:18641-18663 CTTATAAGTTACCCAGCCTCAGG + Intergenic
968789746 4:2651360-2651382 TTTATAAATTACCCAGAATCAGG - Intronic
969146437 4:5128043-5128065 TTTATAAATTACCCAGTGTCAGG + Intronic
969245253 4:5927767-5927789 TTTATAAGTTACCCAGTCTCAGG + Intronic
969535051 4:7751454-7751476 CTTATAAGTTACACAGTCTCAGG - Intergenic
969783843 4:9435990-9436012 CTTATAAATTACCCAGTCTCTGG - Intergenic
970071508 4:12164835-12164857 CTTGTAAGTCACCCAGCCTCAGG - Intergenic
970104088 4:12560645-12560667 CTTATAAATTACCCAGTCTCAGG - Intergenic
970293192 4:14599398-14599420 TTTATAAGTTACCCAGCCTCAGG + Intergenic
970417570 4:15874426-15874448 TTTATAAGTTACCCAGTCTCAGG + Intergenic
970700360 4:18729930-18729952 TTTATAAATTACCCAGACTCGGG - Intergenic
970809208 4:20071917-20071939 TTTATAAGTTACCCAGCCTCAGG - Intergenic
970964246 4:21909690-21909712 TTTATAAGTTACCCAGTATCAGG - Intronic
971331953 4:25688940-25688962 CTTATAAATTACCCAGTTTCAGG + Intergenic
971538169 4:27780608-27780630 TTTCTAAGTTACCCATTCTCAGG + Intergenic
971620061 4:28844615-28844637 GTTATAAGTTACCCAGCCTCAGG + Intergenic
971627535 4:28941753-28941775 TTTATAAGTTACCCAGTCTCAGG - Intergenic
971662128 4:29432405-29432427 TTTATAAATTACCCAGCGTCAGG + Intergenic
971696772 4:29915072-29915094 CTTCTTTGTTACTCAGAGTGGGG - Intergenic
971827949 4:31651965-31651987 TTTATAAGTTACCCAGTCTCAGG - Intergenic
971900423 4:32651020-32651042 TTTCTAAATTACCCAGTCTCTGG - Intergenic
971929992 4:33069179-33069201 CTTTTAAGTTACCCAGTCTCTGG - Intergenic
971933724 4:33119172-33119194 TTTATAAATTACCCAGACTCAGG - Intergenic
972051538 4:34742018-34742040 TTTATAAGTTACCCAGTCTCAGG - Intergenic
972059758 4:34854734-34854756 CTTTAAACTTACCCAGTGTCAGG + Intergenic
972082470 4:35171100-35171122 CTTATAAATTACCCAGTCTCAGG + Intergenic
972326435 4:38021045-38021067 TTTATAAATTACCCAGTGTCAGG - Intronic
972384602 4:38552966-38552988 CTTCTAAATTACCTAGTCTCTGG - Intergenic
972395873 4:38659541-38659563 TTTATAAGTTACCCAGCCTCAGG - Intergenic
972517288 4:39820259-39820281 TTTCTAAATTACCCAGTCTCAGG - Intergenic
972743728 4:41912864-41912886 CTTATAAGTTACCCAGTCTCAGG + Intergenic
972774437 4:42228260-42228282 TTTCTAAGTTATCCAGTCTCAGG + Intergenic
972920318 4:43931457-43931479 CTTTTAAATTACCCAGTCTCGGG + Intergenic
972930402 4:44064754-44064776 TTTGTAAGTTACTCAGACTCAGG + Intergenic
973152111 4:46900875-46900897 CTTATAAGCTACCCAGATTATGG + Intronic
973277217 4:48322746-48322768 TTTATAAATTACCCAGTGTCAGG + Intergenic
973851327 4:54964203-54964225 CTTATAAATTACCCAGTCTCAGG + Intergenic
973884576 4:55307317-55307339 CTTATAAGTTACCCGGTCTCAGG + Intergenic
974014855 4:56639583-56639605 CTTATAAATTACCCAGTCTCAGG + Intergenic
974062427 4:57047384-57047406 CTTATAAGTTACTCAGTCTCGGG + Intronic
974079732 4:57199691-57199713 CTTATAAATTACCCAGTCTCAGG - Intergenic
974087386 4:57276073-57276095 CTTATAAATTACCCAGTCTCAGG - Intergenic
974248173 4:59349710-59349732 ATTCCAAGTTACACAGAGCCAGG + Intergenic
974348570 4:60714930-60714952 TTTATAAATTACCCAGTGTCAGG - Intergenic
974376627 4:61086336-61086358 TTTATAAATTACCCAGTGTCAGG - Intergenic
974457301 4:62144772-62144794 CTTATAAATTACCCAGTGTTGGG + Intergenic
974488585 4:62534859-62534881 CTTTTAAGTTACCCAGTCTCAGG - Intergenic
974556582 4:63459433-63459455 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
974735228 4:65921654-65921676 CTTATAAGTTACCCAGTATCAGG + Intergenic
974787106 4:66632920-66632942 CTTATAAGTTACCCAGCCTCAGG - Intergenic
974815561 4:66999618-66999640 CTTATAAATTACCCAGCCTCAGG - Intergenic
975000475 4:69219536-69219558 CTTTTAAATTACCCAGTCTCGGG - Intergenic
975013711 4:69384655-69384677 CTTATAAATTACCCAGTCTCGGG + Intronic
975143719 4:70944573-70944595 CTTATAAATTACCCAGTCTCAGG - Intronic
975417517 4:74122208-74122230 CTTATAAATTACCCAGCCTCAGG - Intronic
975434105 4:74331278-74331300 TTTATAAGTTACCCAGTTTCAGG - Intergenic
975937755 4:79601823-79601845 CTTTTAAGTTACCCAGCCTCAGG + Intergenic
976248793 4:83029759-83029781 TTTATAAGTTACCCAGTTTCAGG + Intergenic
976255910 4:83100517-83100539 TTTATAAGTTACCCAGCCTCAGG + Intronic
976715535 4:88119284-88119306 CTTATAAATTACCCAGCCTCAGG + Intronic
977053527 4:92161288-92161310 ATTATAAGTTACCCAGTCTCAGG - Intergenic
977132317 4:93255831-93255853 CTTATAAATTACCCAGTCTCAGG + Intronic
977206836 4:94172827-94172849 CTTGTAAATTACCCAGCCTCAGG + Intergenic
977226413 4:94397530-94397552 CTTGTAAATTACCCAGTCTCAGG - Intergenic
977318308 4:95479083-95479105 CTTATAAATTACCCAGCCTCAGG + Intronic
977325183 4:95565595-95565617 CTTATAAGTTACCCAGTCTCAGG + Intergenic
977491830 4:97723657-97723679 CTTATAAATTACCCAGTCTCAGG - Intronic
977712025 4:100137416-100137438 CTTATAAATTACCCAGTCTCAGG + Intergenic
977720020 4:100229142-100229164 CTTATAAATTACCCAGCCTCAGG + Intergenic
977919771 4:102630040-102630062 CTTATAAATTACCCAGTCTCAGG + Intergenic
977952684 4:102992795-102992817 TTTATAAATTACCCAGACTCAGG - Intronic
978145251 4:105365023-105365045 TTTATAAGTTACCCAGGCTCAGG + Intergenic
978240134 4:106505157-106505179 CTTGTAAATTACCCAGTCTCGGG + Intergenic
978255889 4:106692420-106692442 TTTATAAGTTACCCAGCCTCAGG + Intergenic
978492187 4:109321329-109321351 TTTATAAGTTACCCAGTCTCAGG - Intergenic
978528752 4:109693262-109693284 CTTATAAATTACCCAGTCTCAGG + Intronic
978738540 4:112112143-112112165 TTTATAAATTACCCAGATTCAGG - Intergenic
978769677 4:112441954-112441976 TTTCTAAATTACCCAGTCTCAGG - Exonic
979027840 4:115598864-115598886 TTTATAAATTACCCAGACTCAGG + Intergenic
979122400 4:116920218-116920240 TTTATAAGTTACCCAGTCTCAGG - Intergenic
979203289 4:118005063-118005085 TTTCTAAGTTACCCAGTCTCAGG - Intergenic
979398499 4:120218686-120218708 CTTTTAAATTACCCAGTATCAGG + Intergenic
979558907 4:122080161-122080183 TTTATAAGTTACCCAGTCTCAGG + Intergenic
979603020 4:122606764-122606786 CTTATAAATTACCCAGCCTCAGG + Intergenic
979867555 4:125775737-125775759 CTTGTAAATTACCCAGTCTCAGG + Intergenic
979952643 4:126913588-126913610 CTTATAAATTACCCAGCCTCAGG - Intergenic
980013118 4:127618782-127618804 TTTATAAGTTACCCAGCCTCAGG - Intergenic
980266077 4:130517634-130517656 CTTATAAATTACCCAGCCTCAGG + Intergenic
980318649 4:131239102-131239124 TTTGTAAATTACCCAGTGTCAGG - Intergenic
980460647 4:133106997-133107019 CTTATAAATTACCCAGTCTCAGG + Intergenic
980649594 4:135695546-135695568 CTTATAAATTACCCAGTTTCAGG - Intergenic
980760548 4:137227714-137227736 GTTCTAAGTTACACACTGTCAGG - Intergenic
980766945 4:137320069-137320091 TTTATAAGTTACCCAGACTTGGG - Intergenic
980811095 4:137881739-137881761 CTTATAAATTACCCAGTCTCAGG - Intergenic
980973569 4:139589176-139589198 CTTGTAAATTACCCAGTCTCAGG - Intronic
981266283 4:142787498-142787520 TTTGTAAGTTACCCAGTCTCTGG + Intronic
981285222 4:143009752-143009774 CTTATAAATTACCCAGTATCTGG - Intergenic
981836977 4:149065471-149065493 TTTATAAGTTACCCAGTCTCAGG + Intergenic
981884338 4:149654598-149654620 CTTATAAATTACCCAGTCTCAGG + Intergenic
982093280 4:151898355-151898377 CTTATAAATTACCCAGTCTCAGG - Intergenic
982210314 4:153029412-153029434 TTTATAAGTTACCCAGCTTCAGG - Intergenic
982234115 4:153236209-153236231 TTTATAAATTACCCAGTGTCGGG + Intronic
982307084 4:153944031-153944053 CTTATAAATTACCCAGGCTCAGG - Intergenic
982866498 4:160519186-160519208 CTTATAAATTACCCAGCCTCAGG + Intergenic
983011700 4:162555312-162555334 CTTCTAAATTACCCAGTTTTGGG + Intergenic
983022723 4:162699502-162699524 TTTATAAGTTACCCAGCCTCAGG + Intergenic
983105528 4:163681753-163681775 TTTATAAGTTACCCAGTCTCAGG + Intronic
983154497 4:164329563-164329585 CTTATAAATTACCCAGTCTCAGG - Intronic
983283960 4:165715856-165715878 CTTTTAAATTACCCAGTTTCAGG + Intergenic
983351634 4:166597617-166597639 CTTATAAATTACCCAGGCTCAGG + Intergenic
983358977 4:166703672-166703694 CTTATAAATTGCCCAGTGTCAGG - Intergenic
983626235 4:169804574-169804596 CTTATAAATTACCCAGTCTCAGG + Intergenic
983747455 4:171219304-171219326 CTTATAAATTACCCAGTCTCAGG + Intergenic
983830633 4:172322485-172322507 TTTATAAGTTACCCAGTCTCAGG - Intronic
984009962 4:174358604-174358626 TTTATAAGTTACCCAGTTTCAGG + Intergenic
984213220 4:176876224-176876246 CTTATAAATTACCCAGTCTCAGG + Intergenic
984405156 4:179319954-179319976 CTTATAAATTACCCAGTCTCAGG - Intergenic
984559559 4:181252549-181252571 CTTCTAAGCTACCCAGTTTATGG - Intergenic
985056092 4:186036739-186036761 CTTATAAATTACCCAGTCTCAGG + Intergenic
985220154 4:187695769-187695791 TTTATAAATTACCCAGACTCAGG + Intergenic
985436723 4:189937367-189937389 CTTATAAATTACCCAGCCTCAGG + Intergenic
985447437 4:190032646-190032668 CTTATAAATTACCCAGTCTCAGG - Intergenic
985461745 4:190113910-190113932 CTTATAAATTACCCAGCCTCAGG - Intergenic
985468082 5:16416-16438 CTTATAAATTACCCAGCCTCAGG + Intergenic
985819581 5:2150566-2150588 CTTATAAATTACCCAGTCTCAGG - Intergenic
986003714 5:3650162-3650184 TTTATAAGTTACCCAGTCTCAGG + Intergenic
986211662 5:5679264-5679286 TTTATAAATTATCCAGAGTCAGG - Intergenic
986251575 5:6062941-6062963 TTTCTAAATTACCCAGTCTCAGG + Intergenic
986476439 5:8138949-8138971 TTTATAAGTTACCCAGTCTCAGG - Intergenic
986742331 5:10714974-10714996 CTTATAAATTACCCAGTCTCAGG + Intronic
986802857 5:11279648-11279670 CTTATAAATTACCCAGTCTCAGG - Intronic
986892544 5:12327088-12327110 TTTATAAGTTACCCAGTCTCGGG - Intergenic
986907442 5:12512410-12512432 TTTATAAGTTACCCAGTCTCAGG - Intergenic
986975290 5:13387060-13387082 TTTATAAGTTACCCAGTCTCAGG + Intergenic
987238172 5:15964783-15964805 CTTATAAATTACCCAGTCTCAGG + Intergenic
987275349 5:16356437-16356459 TTTCTAAGTTACCCAGTCTCTGG - Intergenic
987324278 5:16798198-16798220 CTTATAAATTACCCAGTGTGTGG + Intronic
987344108 5:16963685-16963707 CTTATAAATTACCCAGTCTCAGG + Intergenic
987432892 5:17858097-17858119 CTTATAAATTACCCAGTCTCTGG + Intergenic
987475541 5:18387999-18388021 CTTATAAATTACCCAGTCTCAGG - Intergenic
987477427 5:18408739-18408761 TTTATAAGTTACCCAGTCTCAGG - Intergenic
987483022 5:18483406-18483428 CTTCTAAAATATCCAGAGTGGGG + Intergenic
987639831 5:20598673-20598695 TTTTTAAGTTACCCAGTCTCAGG + Intergenic
987650529 5:20734351-20734373 TTTATAAGTTACCCAGTCTCAGG - Intergenic
987650752 5:20737124-20737146 CTTATAAGTTACCTAGTCTCAGG + Intergenic
987712281 5:21516587-21516609 CTTATAAATTACCCAGTCTCGGG - Intergenic
987791120 5:22569487-22569509 ATTATAAGTTACCCAGTCTCAGG + Intronic
987796297 5:22631639-22631661 TTTATAAGTTACCCAGTCTCAGG - Intronic
987796374 5:22632293-22632315 TTTATAAGTTACCCAGTCTCAGG + Intronic
988004932 5:25397429-25397451 CTTATAAATTACCCAGTCTCAGG - Intergenic
988159778 5:27503969-27503991 TTTATAAATTACCCAGACTCAGG - Intergenic
988358988 5:30211468-30211490 CTTATAAATTACCCAGTCTCAGG + Intergenic
988379539 5:30482006-30482028 TTTATAAATTACCCAGTGTCAGG - Intergenic
988412635 5:30907037-30907059 GTTATAAGTTACCCGGTGTCTGG - Intergenic
988618812 5:32801696-32801718 TTTATAAGTTACCCAGTCTCAGG - Intergenic
988647175 5:33107530-33107552 CTTATAAATTACCCAGTTTCAGG + Intergenic
988647445 5:33109570-33109592 CTTATAAATTACCCAGTCTCAGG + Intergenic
988742368 5:34089615-34089637 TTTATAAGTTACCCAGTGTATGG + Intronic
988744802 5:34124339-34124361 CTTATAAGTTACCTAGTCTCAGG - Intronic
988745021 5:34127106-34127128 TTTATAAGTTACCCAGTCTCAGG + Intergenic
988930471 5:36031581-36031603 CTTATAAGTTACCCAGTCTCAGG + Intergenic
989030469 5:37113443-37113465 CTTTTAAATTACCCAGTTTCAGG + Intronic
989197151 5:38726816-38726838 TTTATAAGTTACCCAGTCTCGGG - Intergenic
989279606 5:39625946-39625968 CTTATAAATTACCCAGTCTCGGG - Intergenic
989351764 5:40494810-40494832 TTTCTAAATTACCCAGTCTCAGG + Intergenic
989445699 5:41525860-41525882 ATTCTGAGTTACCCAGGGTTAGG - Intergenic
989484631 5:41975831-41975853 TTTATAAATTACCCAGATTCAGG - Intergenic
989540014 5:42607222-42607244 TTTTTAAGTTACCCAGTCTCAGG + Intronic
989640189 5:43576656-43576678 CTTATAAATTACCCAGTCTCAGG + Intergenic
989677154 5:43985339-43985361 CTTATAAATTACCCAGTCTCAGG - Intergenic
990291408 5:54355347-54355369 TTTTTAAATTACCCAGTGTCAGG + Intergenic
990619094 5:57540587-57540609 CTTATAAATTACCCAGTCTCAGG + Intergenic
990630326 5:57661801-57661823 CTTCTATGTTACTCTGAGTCAGG + Intergenic
990706114 5:58531537-58531559 CTTATAAATTACCCAGCCTCAGG + Intergenic
990895424 5:60695193-60695215 TTTATAAATTACCCAGTGTCAGG - Intronic
990976159 5:61563775-61563797 CTTGTAAGTTACCCGGTCTCAGG - Intergenic
991126226 5:63072617-63072639 CTTATAAATTACCCAGTCTCGGG + Intergenic
991185674 5:63803990-63804012 CTTTTAAATTACCCAGTTTCAGG - Intergenic
991762640 5:69935733-69935755 CTTATAAATTACCCAGTCTCGGG - Intergenic
991784686 5:70182388-70182410 CTTATAAATTACCCAGTCTCGGG + Intergenic
991841868 5:70810773-70810795 CTTATAAATTACCCAGTCTCGGG - Intergenic
991877132 5:71182768-71182790 CTTATAAATTACCCAGTCTCGGG + Intergenic
992131481 5:73697387-73697409 CTTATAAATTACCCAGTTTCAGG - Intronic
992157283 5:73967756-73967778 TTTATAAGTTACCCAGTGTCAGG + Intergenic
992278811 5:75151615-75151637 TTTATAAGTTACCCAGTCTCAGG + Intronic
992388070 5:76304887-76304909 CTTATAAATTACCCAGTCTCAGG - Intronic
992523348 5:77580199-77580221 CTTATAAATTACCCAGTCTCGGG - Intronic
992535994 5:77704107-77704129 TTTATAAGTTACCCAGTCTCAGG + Intronic
992556565 5:77909352-77909374 TTTCTAAATTACCCAGTCTCAGG - Intergenic
992557392 5:77916826-77916848 CTTATAAATTACCCAGTTTCAGG + Intergenic
992596365 5:78351447-78351469 CTTATAAGTTATCCAGTCTCAGG + Intergenic
992870964 5:81005189-81005211 CTTCTAAATTGCCCAGTCTCAGG - Intronic
993037130 5:82770372-82770394 CTTATAAATTACCCAGTCTCAGG + Intergenic
993388771 5:87291864-87291886 CTTATAAATTACCCAGGCTCAGG + Intronic
993468867 5:88282130-88282152 TTTATAAATTACCCAGCGTCAGG + Intergenic
993555133 5:89327595-89327617 CTTTTAAGTAAACCAGAGTATGG - Intergenic
993664089 5:90673501-90673523 TTTATAAGTTACCCAGTGTAAGG - Intronic
993876270 5:93310923-93310945 TTTATAAATTACCCAGTGTCAGG - Intergenic
994018856 5:95001212-95001234 TTTATAAATTACCCAGTGTCGGG + Intronic
994019971 5:95011747-95011769 TTCCTAAGTTACCCAGTCTCAGG + Intronic
994077348 5:95668085-95668107 TTTATAAATTACCCAGACTCAGG + Intronic
994142089 5:96352987-96353009 CTTATAAATTACCCAGTCTCAGG + Intergenic
994209148 5:97068804-97068826 CTTATAAATTACCCAGCCTCAGG + Intergenic
994474385 5:100248893-100248915 CTTATAAATTACCCAGTCTCAGG + Intergenic
994518732 5:100802228-100802250 CTTATAAATTACCCAGTCTCAGG - Intergenic
994667194 5:102719805-102719827 CTTATAAGTTACCCAGTGTAAGG - Intergenic
994766182 5:103921024-103921046 TTTATAAATTACCCAGCGTCAGG + Intergenic
994858565 5:105158374-105158396 CTTATAAATTACCCAGTCTCAGG - Intergenic
994941820 5:106333567-106333589 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
994992881 5:107019781-107019803 TTTATAAATTACCCAGTGTCAGG - Intergenic
995535991 5:113137061-113137083 TTTATAAGTTACCCAGTCTCAGG - Intronic
995561696 5:113388735-113388757 CTTATAAATTACCCAGCCTCAGG + Intronic
995686422 5:114777310-114777332 CTTATAAATTACCCAGTCTCCGG - Intergenic
995701526 5:114940242-114940264 TTTATAAGTTACCCAGTCTCAGG + Intergenic
995702983 5:114956272-114956294 TTTATAAATTACCCAGTGTCAGG + Intergenic
996177766 5:120379930-120379952 TTTCTAAATTACCCAGTCTCAGG + Intergenic
996372940 5:122772535-122772557 CTTCTGAGAGACCCTGAGTCAGG + Intergenic
996485599 5:124030293-124030315 GTTCTACATTATCCAGAGTCAGG + Intergenic
996486398 5:124040530-124040552 TTTATAAGTTACCCAGTTTCAGG + Intergenic
996511390 5:124320106-124320128 TTTCTAAATTACCCAGTCTCAGG + Intergenic
996577158 5:124988086-124988108 CTTATAAATTACCCAGTCTCAGG + Intergenic
996647330 5:125831846-125831868 TTTATAAATTACCCAGTGTCAGG + Intergenic
996857948 5:128030920-128030942 TTTATAAGTTACCCAGTCTCAGG + Intergenic
996911258 5:128659731-128659753 TTTATAAGTTACCCAGTCTCAGG + Intronic
997273792 5:132565270-132565292 ATTATAAGTTACCCAGTTTCAGG + Intronic
997366704 5:133330268-133330290 CTTATAAATTACCCAGACTCAGG - Intronic
997592057 5:135080282-135080304 TTTATAAGTTACCCAGTCTCAGG - Intronic
997779782 5:136644886-136644908 TTTATAAGTTACCCAGTCTCAGG + Intergenic
997802871 5:136884278-136884300 TTTCTAAATTACCCAGTCTCAGG + Intergenic
998219319 5:140263609-140263631 TTTATAAATTACCCAGTGTCAGG - Intronic
998455910 5:142272891-142272913 TTTATAAGTTACCCAGACTCAGG + Intergenic
998569610 5:143245390-143245412 CTTATAAATTACCCAGTCTCTGG + Intergenic
998601608 5:143590917-143590939 CTTATAAATTACCCAGTCTCAGG - Intergenic
998781206 5:145658763-145658785 CTTATAAATTACCCAGTCTCAGG + Intronic
998880095 5:146636671-146636693 CTTATATTATACCCAGAGTCTGG - Intronic
999317616 5:150594375-150594397 CCTCTGAGCTACTCAGAGTCTGG - Intergenic
999818010 5:155197296-155197318 CTTATAAATTACCCAGCCTCAGG + Intergenic
1000151405 5:158505076-158505098 ATTATAAGTTACCCAGCCTCAGG - Intergenic
1000256426 5:159542759-159542781 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1000418178 5:161006050-161006072 CTTATAAATTACCCAGCCTCAGG + Intergenic
1000511014 5:162183071-162183093 TTTATAAATTACCCAGTGTCAGG + Intergenic
1000514886 5:162227431-162227453 TTTATAAGTTACCCAGTATCAGG - Intergenic
1000577067 5:162987879-162987901 CTTATAAATTACCCAGTCTCAGG - Intergenic
1000686408 5:164255066-164255088 TTTCTAAATTACCCAGTCTCTGG + Intergenic
1000859385 5:166438329-166438351 TTTATAAATTACCCAGACTCAGG + Intergenic
1000934488 5:167291895-167291917 CTTATAAATTACCCAGTCTCAGG - Intronic
1000949860 5:167467386-167467408 CTTATAAATTACCCAGTCTCAGG + Intronic
1000988054 5:167882506-167882528 TTTATAAATTACCCAGTGTCGGG - Intronic
1001665273 5:173428155-173428177 TTTATAAATTACCCAGTGTCAGG - Intergenic
1001764148 5:174232038-174232060 CTTCTACGTTTCCCACAGTCTGG + Intronic
1001830836 5:174788093-174788115 CTTATAAATTACCCAGTCTCTGG - Intergenic
1002208954 5:177584444-177584466 CTTATAAATTACCCAGGCTCAGG + Intergenic
1002212042 5:177604926-177604948 CTTTAAAGTTGCCCACAGTCTGG + Intronic
1002679871 5:180953019-180953041 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1003323098 6:5070215-5070237 TTTGTAAGTTTCCTAGAGTCTGG - Intergenic
1003579009 6:7322527-7322549 TTTATAAGTTACCCAGTCTCAGG + Intronic
1003896105 6:10609176-10609198 CTTATAAATTACCCAGTCTCAGG - Intronic
1004004439 6:11626267-11626289 CTTATAAATTACCCAGTCTCAGG - Intergenic
1004031238 6:11871511-11871533 TTTGTAAGTTACCCAGTCTCGGG - Intergenic
1004455233 6:15785785-15785807 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1004477016 6:15982637-15982659 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1004733735 6:18384253-18384275 TTTATAAGTTACCCAGTTTCAGG + Intergenic
1005167711 6:22944155-22944177 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1005221386 6:23592476-23592498 CTTATAAATTACCCAGTCTCAGG + Intergenic
1005234625 6:23745351-23745373 CTTCTAAGCTACCCAGGCTATGG + Intergenic
1005676108 6:28157056-28157078 TTTATAAATTACCCAGTGTCAGG - Exonic
1005683188 6:28226817-28226839 CTTTTAAGTTACCCAGATATGGG - Intronic
1005757104 6:28934698-28934720 CTTATAAATTACCCAGTCTCAGG - Intergenic
1005982824 6:30850523-30850545 TTTATAAATTACCCAGTGTCAGG + Intergenic
1006308168 6:33237606-33237628 TTTATAAGTTACCCAGTTTCAGG + Intergenic
1006749660 6:36368929-36368951 CTTGTGATTTCCCCAGAGTCTGG + Exonic
1007283119 6:40726792-40726814 CTTATAAATTACCCAGCCTCAGG + Intergenic
1007526858 6:42503615-42503637 TTTATAAATTACCCAGATTCAGG - Intergenic
1007529051 6:42524502-42524524 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1007880569 6:45161204-45161226 CTTATAAATTACCCAGTCTCAGG + Intronic
1008013511 6:46491885-46491907 TTCCTCAGTTAGCCAGAGTCGGG - Intronic
1008242704 6:49131077-49131099 TTTATAAATTACCCAGGGTCAGG + Intergenic
1008471271 6:51887791-51887813 TTTATAAGTTACCCAGCCTCAGG + Intronic
1008553411 6:52654942-52654964 CCTCTAAATTACCCAGTCTCAGG + Intergenic
1008653086 6:53583414-53583436 CTTATAAATTACCCAGTCTCAGG + Intronic
1008768638 6:54951279-54951301 CTTATAAGCTACCCAGCCTCAGG + Intergenic
1009005376 6:57779796-57779818 CTTATAAATTACCCAGTCTCGGG + Intergenic
1009013968 6:57877020-57877042 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1009242345 6:61197927-61197949 TTTGTAAGTTACCCAGTCTCAGG + Intergenic
1009377664 6:62991787-62991809 TTTATAAGTTACCCAGTCTCTGG - Intergenic
1009460997 6:63912922-63912944 TTTATAAATTACCCAGTGTCAGG + Intronic
1009569646 6:65367948-65367970 CTTATAAATTACCCAGTCTCAGG - Intronic
1009773314 6:68173460-68173482 TTTATAAATTACCCAGACTCAGG + Intergenic
1009796907 6:68480976-68480998 CTTCTAAATTACCCAGTCTCAGG - Intergenic
1009838980 6:69042235-69042257 TTTATAAATTACCCAGTGTCAGG + Intronic
1009842804 6:69098444-69098466 CTCATAAGTTACCCAGTCTCAGG - Intronic
1009924567 6:70104237-70104259 TTTATAAGTTACCCAGTCTCAGG - Intronic
1009983091 6:70749047-70749069 CTTATAAATTACCCAGTCTCAGG - Intronic
1010046421 6:71449296-71449318 CTTATAAATTACCCAGTCTCAGG - Intergenic
1010249301 6:73691836-73691858 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1010259540 6:73799425-73799447 CTTATAAATTACCCAGACTCGGG - Intronic
1010473474 6:76258932-76258954 CTTATAAATTACCCAGCCTCAGG - Intergenic
1010524878 6:76888600-76888622 CTTATAAATTACCCAGCCTCAGG - Intergenic
1010525193 6:76893309-76893331 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1010810660 6:80295252-80295274 CTTATAAATTACCCAGTTTCAGG - Intronic
1010891178 6:81312732-81312754 CTTCTATGATACCCAGAGGGAGG - Intergenic
1010946291 6:81976859-81976881 CTTATAAATTACCCAGTCTCAGG + Intergenic
1010946299 6:81976948-81976970 CTTATAAATTACCCAGTCTCAGG + Intergenic
1011000336 6:82581633-82581655 TTTATAACTTACCCAGAGTTTGG - Intergenic
1011134197 6:84081989-84082011 TTTATAAATTACCCAGACTCAGG + Intronic
1011230412 6:85154972-85154994 TTTTTAAATTACCCAGATTCAGG + Intergenic
1011245743 6:85319232-85319254 CTTATAAATTACCCAGTCTCAGG + Intergenic
1011355321 6:86467335-86467357 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1011434368 6:87321699-87321721 TTTATAAGTTACCCAGCCTCAGG - Intronic
1011504774 6:88029358-88029380 CTTATAAATTACCCAGTCTCAGG - Intergenic
1011792605 6:90914778-90914800 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1011876426 6:91967078-91967100 TTTATAAATTACCCAGGGTCAGG + Intergenic
1012068083 6:94576287-94576309 TTTATAAATTACCCAGCGTCAGG - Intergenic
1012179789 6:96139083-96139105 CTTATAAATTACCCAGTCTCTGG - Intronic
1012316486 6:97787340-97787362 CTTATAAGTTACCCAGTCTCAGG - Intergenic
1012514085 6:100038667-100038689 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1012653205 6:101783443-101783465 TTTCTAAATTACCCAGTCTCAGG + Intronic
1013090174 6:106893409-106893431 CTTATGAATTACCCAGTGTCAGG - Intergenic
1013798540 6:113912079-113912101 CTTATAAATTACCCAGTCTCAGG + Intergenic
1013827488 6:114231457-114231479 TTTATAAGTTACCCAGTCTCAGG + Intronic
1013879324 6:114876216-114876238 CTTGTAAGTTACCCAATCTCAGG - Intergenic
1014075410 6:117229505-117229527 CTTATAAATTACCCAGTCTCAGG - Intergenic
1014077562 6:117253454-117253476 CTTATAAATTACCCAGTCTCGGG + Intergenic
1014135565 6:117884810-117884832 CTTATAAATTACCCAGTCTCAGG - Intergenic
1014147526 6:118015194-118015216 CTTATAAATTACCCAGTCTCAGG + Intronic
1014330644 6:120059730-120059752 CTTATAAATTACCCAGCCTCAGG - Intergenic
1014403025 6:121014760-121014782 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1014740223 6:125140613-125140635 CTTATAATTTACCCAGTCTCAGG + Intronic
1014853086 6:126365307-126365329 CTTATAAATTACCCAGTTTCAGG - Intergenic
1015213794 6:130726910-130726932 TTTCTAAATTACCCAGTATCAGG - Intergenic
1015239774 6:131009365-131009387 CTTATAAATTACCCAGTCTCGGG + Intronic
1015256785 6:131186405-131186427 CTTATAAGTTATCCAGTCTCAGG + Intronic
1015286269 6:131489676-131489698 CTTATAAATTACCCAGTCTCAGG - Intergenic
1015298250 6:131623820-131623842 TTTATAAGTTACCCAGTCTCGGG + Intronic
1015483288 6:133740106-133740128 TTTATAAATTACCCAGTGTCAGG - Intergenic
1015555074 6:134452450-134452472 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1015594721 6:134855605-134855627 TTTATAAGTTACCCAGTCTCCGG - Intergenic
1016154972 6:140794839-140794861 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1016175118 6:141070766-141070788 TTTATAAATTACCCAGTGTCAGG + Intergenic
1016185401 6:141192543-141192565 CTTATAAATTACCCAGTCTCAGG - Intergenic
1016231457 6:141810287-141810309 GTTCTAAGCTACCCAGTGTGTGG + Intergenic
1016342092 6:143073622-143073644 CTTATAAATTACCCAGTCTCAGG - Intronic
1016389686 6:143562212-143562234 TTTCTAAATTACCCAGTCTCAGG - Intronic
1016643088 6:146373254-146373276 CTTATAAATTACCCAGTGGCAGG - Intronic
1016716498 6:147238125-147238147 TTTATAAATTACCCAGACTCAGG - Intronic
1016727709 6:147394615-147394637 TTTCTAAATTACCCAGTCTCTGG - Intergenic
1016783775 6:147988380-147988402 CTTATAAATTACCCAGTCTCGGG - Intergenic
1016888471 6:148981891-148981913 TTTATAAATTACCCAGTGTCAGG - Intronic
1017109496 6:150919177-150919199 TTTCTAAGTTAACCAGTCTCAGG - Intronic
1017295209 6:152785748-152785770 TTTATAAATTACCCAGTGTCAGG - Intergenic
1017350268 6:153432643-153432665 CTTGTAAATTACCCAGTATCAGG + Intergenic
1017353452 6:153472895-153472917 CTTATAAGTTACTCAGTCTCAGG - Intergenic
1017353457 6:153472970-153472992 CTTATAAGTTACTCAGTCTCAGG - Intergenic
1017574402 6:155786250-155786272 CTTGTAAGTTACCCAGACTTAGG + Intergenic
1017589079 6:155959226-155959248 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1017984077 6:159427185-159427207 TTTATAAATTACCCAGACTCTGG + Intergenic
1018075176 6:160206378-160206400 TTTATAAATTACCCAGACTCAGG - Intronic
1018219689 6:161565692-161565714 TTTATAAGTTACCCAGTCTCAGG + Intronic
1018276462 6:162137543-162137565 TTCCTAATTTACCCAGTGTCAGG - Intronic
1018479934 6:164180138-164180160 TTTCTAAGTTACCCAGCTTACGG + Intergenic
1018502324 6:164424037-164424059 TTTATAAATTACCCAGACTCAGG + Intergenic
1018511300 6:164527177-164527199 TTTATAAATTACCCAGGGTCAGG + Intergenic
1018805243 6:167254264-167254286 CTTATAAATTACCCAGTCTCAGG + Intergenic
1018868506 6:167763630-167763652 CTTATAAATTACCCAGTGTTGGG + Intergenic
1019150707 6:170003782-170003804 CTTATAAATTACCCAGTCTCAGG - Intergenic
1019234550 6:170599364-170599386 CTTATAAATTACCCAGCCTCAGG - Intergenic
1020738895 7:11987976-11987998 CTTATAAATTACCCAGTTTCAGG + Intergenic
1020866791 7:13574311-13574333 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1020869201 7:13606707-13606729 CTTATAAATTACCCACTGTCAGG + Intergenic
1020920530 7:14258045-14258067 TTTATAAGTTACCCAGTCTCAGG + Intronic
1020988163 7:15162238-15162260 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1020989804 7:15182767-15182789 CTTATAAATTACCCAGTTTCAGG - Intergenic
1021543958 7:21791891-21791913 TTTGTAAGTTACCCAGTATCAGG - Intronic
1021770749 7:23998277-23998299 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1022671083 7:32456898-32456920 TTTGTAAATTACCCAGTGTCGGG + Intergenic
1022862093 7:34377749-34377771 TTTATAAGTTACCCAGCTTCTGG + Intergenic
1022971444 7:35521056-35521078 CTTATAAGTTCCCCAGTTTCAGG - Intergenic
1023001117 7:35808499-35808521 CTTATAAATTACCCAGTCTCAGG - Intronic
1023086775 7:36578841-36578863 CTTATAAATTACCCAGTCTCAGG - Intronic
1023267238 7:38419907-38419929 CTTCTAAGAAACCCAGACTCTGG - Intronic
1023389269 7:39692728-39692750 CTACTAAGCTACTCTGAGTCAGG - Intronic
1023681188 7:42689197-42689219 CTTCTAAGCTACCCAGCCTATGG + Intergenic
1023709667 7:42978049-42978071 CTTATAAATTACCCAGTCTCAGG + Intergenic
1023828636 7:44026374-44026396 CTGCAAAATGACCCAGAGTCAGG - Intergenic
1024145866 7:46515724-46515746 CTTATAAATTACCCAGTCTCAGG + Intergenic
1024384434 7:48735402-48735424 ATTATAAATTACCCAGTGTCAGG + Intergenic
1024589212 7:50866794-50866816 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1024673339 7:51616436-51616458 CTTATAAATTACCCAGTTTCAGG - Intergenic
1024717453 7:52096287-52096309 CTTATAAATTACCCAGTCTCAGG - Intergenic
1024797744 7:53038035-53038057 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1024822725 7:53352452-53352474 CTTGTAAGTTACCCAGTTTCAGG - Intergenic
1024857738 7:53801150-53801172 TTTCTAAGTTACCCAGTCTATGG + Intergenic
1024865677 7:53903301-53903323 CTTATAAATTACCCAGTATCAGG - Intergenic
1026292165 7:69017624-69017646 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1026307407 7:69154056-69154078 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1026432298 7:70359396-70359418 TTTATAAATTACCCAGTGTCAGG - Intronic
1026486499 7:70826098-70826120 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1026606781 7:71823401-71823423 TTTATAAATTACCCAGGGTCGGG - Intronic
1026818519 7:73530865-73530887 CTTGTACATTACCCAGACTCAGG - Intergenic
1026860177 7:73781480-73781502 CTTATAAATTACCCAGTCTCAGG - Intergenic
1027304103 7:76874531-76874553 TTTATAAGTTACCCAGTATCGGG - Intergenic
1027342126 7:77220889-77220911 TTTGTAAGTTACCCAGTCTCAGG - Intronic
1027594714 7:80158675-80158697 TTTATAAGTTACCCAGTCTCAGG + Intronic
1027606718 7:80309350-80309372 CTTATAAGTTACCCAGTCTCAGG - Intergenic
1027611023 7:80360678-80360700 CTTATAAATTACCCAGTATCAGG + Intergenic
1027785396 7:82573744-82573766 TTTATAAATTACCCAGACTCCGG - Intergenic
1027941803 7:84691635-84691657 CTTATAAATTACCCAGCCTCAGG + Intergenic
1028030110 7:85901074-85901096 CCTCTGAGCTACCCAGATTCTGG + Intergenic
1028063240 7:86348239-86348261 TTTATAAATTACCCAGTGTCAGG - Intergenic
1028972185 7:96871511-96871533 TTTCTAAATTACCCAGCCTCAGG - Intergenic
1029789278 7:102825520-102825542 CTTATAAATTACCCAGTTTCAGG + Intronic
1030088396 7:105836744-105836766 CTTATAAATTACCCAGCCTCGGG - Intronic
1030196101 7:106855333-106855355 CATCTAATTTAGGCAGAGTCAGG + Intergenic
1030344505 7:108417245-108417267 CTTATAAGTTACCCAGTCTCAGG - Intronic
1030356719 7:108551518-108551540 TTTGTAAATTACCCAGCGTCAGG + Intronic
1030380331 7:108803727-108803749 TTTATAAATTACCCAGTGTCGGG + Intergenic
1030446100 7:109647852-109647874 CTTATAAATTACCCAGTCTCAGG - Intergenic
1030586984 7:111433053-111433075 TTTATAAATTACCCAGTGTCAGG - Intronic
1030695070 7:112576308-112576330 TTTATAAGTTACCCAGTTTCAGG - Intergenic
1030699925 7:112627085-112627107 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1030722518 7:112885909-112885931 TTTATAAGTTACCCAGTCTCGGG - Intronic
1030780029 7:113589169-113589191 CTTGTAAGTTACCCAGTCTCAGG - Intergenic
1030784611 7:113644691-113644713 CTTATAAATTACCCAGTCTCAGG - Intergenic
1030786985 7:113674562-113674584 TTTCTAAGTTACCCTGTATCAGG + Intergenic
1030788934 7:113699194-113699216 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1030856390 7:114562912-114562934 TTTGTAAGTTACCCAGTCTCAGG - Intronic
1031041277 7:116840663-116840685 TTTATAAGTTACCCAGTCTCAGG + Intronic
1031271250 7:119652483-119652505 TTTATAAATTACCCAGTGTCGGG - Intergenic
1031287384 7:119886900-119886922 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1031477063 7:122236187-122236209 TTTATAAATTACCCAGTGTCAGG + Intergenic
1031793450 7:126139825-126139847 CTTATAAATTACCCAGTCTCGGG - Intergenic
1031878094 7:127164306-127164328 TTTATAAATTACCCAGAGTCAGG + Intronic
1031990087 7:128191842-128191864 TTTCTAAATTACCCAGTCTCGGG + Intergenic
1031992047 7:128204888-128204910 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1032419592 7:131767421-131767443 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1032543820 7:132725745-132725767 CTTATAAATTACCCAGTCTCTGG - Intronic
1032669276 7:134068530-134068552 ATTATAAATTACCCAGTGTCAGG + Intergenic
1032759366 7:134925036-134925058 TTTATAAGTTACCCAGTCTCGGG + Intronic
1033046286 7:137965007-137965029 TTTATAAATTACCCAGACTCAGG + Intronic
1033234304 7:139625979-139626001 CTGCACAGATACCCAGAGTCAGG + Intronic
1033247855 7:139733227-139733249 TTTATAAATTACCCAGACTCAGG + Intronic
1033542041 7:142366109-142366131 CTTATAAATTACCCAGTCTCAGG - Intergenic
1033910856 7:146261202-146261224 TTTGTAAATTACCCAGTGTCAGG + Intronic
1034017109 7:147598991-147599013 CTTATAAATTACCCAGACTCAGG + Intronic
1034108477 7:148513158-148513180 CTTATAAATTACCCAATGTCAGG - Intergenic
1034501626 7:151454512-151454534 CTTCTAAATTACCCAGTCTCAGG - Intergenic
1034751170 7:153570238-153570260 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1034880860 7:154761494-154761516 TTTCTAAATTACCCAGTCTCGGG - Intronic
1034884832 7:154791296-154791318 TTTCTAAATTACCCAGTCTCAGG - Intronic
1035178678 7:157073450-157073472 GTTGTAAATTACCCAGACTCGGG - Intergenic
1035415977 7:158686785-158686807 TTTCTAAATTTCCCAGTGTCAGG - Intronic
1035430639 7:158817992-158818014 GTTTTAAGTTTCCCAGAGTAAGG - Intronic
1035452232 7:158984901-158984923 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1035864842 8:3070882-3070904 CTTATAAATTACCCAGTCTCAGG - Intronic
1036390921 8:8323763-8323785 CTTGTAAATTACCCAGTCTCAGG + Intronic
1036632482 8:10525286-10525308 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1036709493 8:11069010-11069032 CTTGTAAGTTAGCCACAATCAGG - Intronic
1036935430 8:12997483-12997505 CTTATAAATTACCCAGGCTCAGG + Intronic
1037057324 8:14458052-14458074 CTTCTAAACTACCCAGTCTCAGG + Intronic
1037068391 8:14612464-14612486 TTTATAACTTACCCAGACTCAGG + Intronic
1037072981 8:14675251-14675273 CTTATAAATTACCCAGTCTCAGG + Intronic
1037105897 8:15107671-15107693 GTTTTAAGTTACCCAGCCTCAGG + Intronic
1037119494 8:15266244-15266266 CTTTTAAATTACCCAGTCTCAGG - Intergenic
1037141628 8:15526704-15526726 TTTATAAGTTACCCAGTCTCAGG + Intronic
1037177633 8:15965933-15965955 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1037199164 8:16229613-16229635 TTTCTAAATTACCCAGTCTCAGG + Intronic
1037199179 8:16229772-16229794 CATTTAAATTACCCAGTGTCAGG + Intronic
1037238475 8:16749771-16749793 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1037333896 8:17773477-17773499 CTTATAAGTTACCCAGTCTATGG - Intronic
1037366221 8:18124980-18125002 TTTATAAATTACCCAGCGTCAGG - Intergenic
1037380763 8:18283260-18283282 CTTATAAGTGACCCAGTCTCAGG - Intergenic
1037411559 8:18603957-18603979 CTTATAAATTACCCAGTCTCAGG + Intronic
1037701963 8:21283492-21283514 TTTCTAAGTTACCCAGTCTCAGG - Intergenic
1037746722 8:21651362-21651384 CTTATAAATTACCCAGTCTCAGG - Intergenic
1037776027 8:21836173-21836195 GTTCTAAGTCACCCAGTGTGGGG - Intergenic
1038015501 8:23511021-23511043 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1038073509 8:24045276-24045298 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1038188199 8:25294700-25294722 CTTATAAATTACCCAGTCTCAGG - Intronic
1038719009 8:30016600-30016622 CTTATAAATTACCCAGTTTCAGG - Intergenic
1038857311 8:31347887-31347909 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1039072704 8:33660886-33660908 TTTCTAAATTACCCAGCCTCAGG + Intergenic
1039091736 8:33836863-33836885 CTTTTAAATTACCCAGTCTCAGG + Intergenic
1039120985 8:34146051-34146073 CTTATAAATTACCCAGTCTCGGG + Intergenic
1039148525 8:34478082-34478104 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1039273017 8:35903583-35903605 TTTATAAATTACCCAGTGTCAGG + Intergenic
1039350667 8:36760328-36760350 CTTCTAAATTACCCAGTCTCGGG + Intergenic
1039710337 8:40049761-40049783 CTTATAAATTACCCAGTCTCAGG + Intergenic
1039736730 8:40340461-40340483 ATTATAAATTACCCAGAATCAGG + Intergenic
1039777460 8:40751223-40751245 CTTATAAATTACCCAGTCTCAGG - Intronic
1039853031 8:41387718-41387740 TTTGTAAGTTACCCAGCTTCAGG + Intergenic
1040009184 8:42647183-42647205 CTTATAAATTACCCAGTCTCAGG - Intergenic
1040365289 8:46709134-46709156 TTTATAAGTTACCCAGTGTCAGG + Intergenic
1040454740 8:47585583-47585605 TTTATAAGTTACCCAGTTTCAGG - Intronic
1040713513 8:50219462-50219484 ATTATAAGTTACCCAGTCTCAGG - Intronic
1041166469 8:55097376-55097398 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1041253934 8:55962756-55962778 TTTATAAGTTACCCAGTCTCGGG - Intronic
1041308497 8:56489274-56489296 CTTATAAGTTACGCAGTTTCAGG + Intergenic
1041549233 8:59080868-59080890 CTTATAAATTACCCAGTCTCAGG + Intronic
1041735882 8:61109966-61109988 CTTATAAATTACCCAGTGCCAGG + Intronic
1041927730 8:63253528-63253550 CTTGTAAATTACCCAGTCTCAGG - Intergenic
1042072442 8:64950513-64950535 TTTATAAATTACCCAGAGTCAGG - Intergenic
1042101831 8:65282511-65282533 CTTATAAATTACCCAGTCTCAGG + Intergenic
1042180904 8:66087078-66087100 CTTATAAATTACCCATACTCTGG - Intronic
1042203645 8:66306386-66306408 CTTGTAAGTTACCCAGTCTATGG - Intergenic
1042207880 8:66347096-66347118 TTTATAAATTACCCAGTGTCAGG + Intergenic
1042248067 8:66727790-66727812 TTTATAAATTACCCAGTGTCAGG + Intronic
1042249903 8:66745682-66745704 CTTATAAATTACCCAGTCTCAGG - Intronic
1042412833 8:68483992-68484014 CTTATAAATTACTCAGACTCAGG - Intronic
1042618448 8:70676009-70676031 CTTATAAATTACCCAGTCTCAGG - Intronic
1042761400 8:72275596-72275618 CTTATAAATTACCCAGTCTCAGG + Intergenic
1042763745 8:72298445-72298467 TTTATAAGTTACTCAGTGTCAGG - Intergenic
1043030602 8:75129698-75129720 ATTATAAGTTACCCAGTCTCAGG + Intergenic
1043129729 8:76446431-76446453 TTTATAAATTACCCAGACTCAGG - Intergenic
1043138413 8:76557297-76557319 CTTATAATTTACCCAGTCTCAGG + Intergenic
1043221760 8:77674379-77674401 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1043222833 8:77688040-77688062 CTTTTAAATTACCCAGCCTCAGG + Intergenic
1043303006 8:78758082-78758104 TTTATAAGTTACCCAGTCTCAGG + Intronic
1043563057 8:81517370-81517392 CTTATAAATTACCCAGTTTCAGG - Intergenic
1043615211 8:82116467-82116489 TTTCTAAGTTATCCAGTCTCAGG + Intergenic
1043779558 8:84313975-84313997 CTTATAAATTACCCAGTTTCAGG - Intronic
1043825024 8:84916664-84916686 CTTATAAATTACCCAGTCTCAGG + Intronic
1043839945 8:85090763-85090785 TTTATAAATTACCCAGTGTCAGG + Intergenic
1044068636 8:87727673-87727695 TTTGTAAATTACCCAGTGTCAGG + Intergenic
1044157182 8:88862193-88862215 CTTATAAATTACCCAGTCTCAGG - Intergenic
1044243484 8:89913638-89913660 CTTCTAAGTTAATCAGTTTCTGG - Intronic
1044542028 8:93418953-93418975 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1044550829 8:93510641-93510663 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1044551505 8:93517799-93517821 CTTATAAGTTACTCAGTCTCAGG - Intergenic
1044738737 8:95304332-95304354 CATTTAAGATAACCAGAGTCTGG + Intergenic
1044945196 8:97382847-97382869 CTTATAAATTACCCAGTCTCAGG - Intergenic
1045090175 8:98733898-98733920 CTTCTAAATTACCCAGTCTCAGG - Intronic
1045418979 8:101995386-101995408 CTTATAAATTACCCAGGCTCAGG - Intronic
1045548536 8:103149993-103150015 CTTATAAATTACCCAGTCTCAGG - Intronic
1045863595 8:106839959-106839981 TTTTTAAGTTACCGAGTGTCAGG + Intergenic
1045930538 8:107620599-107620621 CTTATAAATTACCCAGTCTCAGG + Intergenic
1046270905 8:111896894-111896916 CTTATAAATTACCCAGTCTCAGG + Intergenic
1046367897 8:113260145-113260167 TTTATAAGTTACCCAGTCTCAGG + Intronic
1046431220 8:114131477-114131499 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1046438657 8:114230078-114230100 TTTCTAAATTACCCAGTCTCTGG + Intergenic
1046652170 8:116848109-116848131 TTTATAAATTACCCAGACTCAGG + Intronic
1046809297 8:118515465-118515487 CTTATAAATTACCCAGTTTCAGG + Intronic
1047077000 8:121415476-121415498 CTTATAAATTACCCAGCCTCAGG - Intergenic
1047200707 8:122763493-122763515 TTTGTAAATTACCCAGACTCAGG + Intergenic
1047316493 8:123739446-123739468 CTTATAAATTACCCAGCCTCCGG - Intergenic
1047329314 8:123871958-123871980 TTTATAAGTTACCCAGTCTCAGG - Intronic
1047356672 8:124128852-124128874 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1047426084 8:124748300-124748322 CTTATAAATTACCCAGCCTCGGG - Intergenic
1047563741 8:126017724-126017746 CTTATAAATTACCCAGTCTCAGG + Intergenic
1048014808 8:130487909-130487931 CTTATAAATTACCCAGTCTCGGG - Intergenic
1048103627 8:131383001-131383023 CTCATAAGTTACCCAGTCTCAGG - Intergenic
1048113799 8:131497384-131497406 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1048373275 8:133799058-133799080 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1048388207 8:133933491-133933513 TTTATAAATTACCCAGTGTCAGG - Intergenic
1048393170 8:133987284-133987306 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1048629611 8:136227631-136227653 CTTATAGGTTACCCAGTCTCGGG + Intergenic
1048691683 8:136972023-136972045 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1048803863 8:138221125-138221147 TTTCTAAATTACCCAGTCTCAGG - Intronic
1048917937 8:139202336-139202358 TTTATAAGTTACCCAGCCTCAGG - Intergenic
1049730900 8:144177933-144177955 TTTGTAAGTTACCCAGTCTCCGG + Intronic
1050317589 9:4419313-4419335 TTTTTAAGTTACCCAGTCTCAGG - Intergenic
1050328827 9:4524547-4524569 TTTATAAGTTACCCAGTCTCAGG - Intronic
1050602276 9:7265112-7265134 TTTCTAAGTTACCCAGTCTGTGG + Intergenic
1050801968 9:9626601-9626623 CTTAAAAGTTTCACAGAGTCAGG + Intronic
1050819458 9:9859253-9859275 CTTATAAATTACCCAGTCTCAGG + Intronic
1051247507 9:15126601-15126623 TTTATAAATTACCCAGTGTCAGG + Intergenic
1051838806 9:21371432-21371454 TTTCTAAGTTACCCAGTCTCAGG - Intergenic
1051844441 9:21435404-21435426 TTTCTAAATTACCCAGCCTCAGG + Intronic
1051873946 9:21770494-21770516 TTTATAAGTTGCCCAGACTCAGG + Intergenic
1051920594 9:22259362-22259384 CTTATAAATTACCCAGTCTCAGG + Intergenic
1051937810 9:22465750-22465772 TTTCTAAATTACCCAGCCTCAGG + Intergenic
1051940552 9:22500748-22500770 CTTATAAATTACCCAGTTTCGGG + Intergenic
1051957598 9:22714289-22714311 TTTGTAAGTTGCCCAGACTCAGG + Intergenic
1052140615 9:24978161-24978183 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1052193300 9:25682879-25682901 CTTCAAAATTACCCAGTCTCTGG + Intergenic
1052323883 9:27196542-27196564 CTTCCAAATTACCCAGTGTCAGG - Intronic
1052465807 9:28828629-28828651 TGTCTAATTAACCCAGAGTCTGG - Intergenic
1052502382 9:29308193-29308215 TTTATAAGTTACCCAGTCTCGGG - Intergenic
1052556358 9:30023225-30023247 CTTATAAGTTACCCAGTCTCAGG - Intergenic
1052579317 9:30333545-30333567 CTTATAAATTACCCAGTTTCAGG + Intergenic
1052660481 9:31422735-31422757 CTTATAAATTACCCAGTCTCAGG - Intergenic
1053018299 9:34676648-34676670 CTTATAAATTACCCAGTTTCAGG - Intergenic
1054723663 9:68628431-68628453 ATTCTTAGTGACCCATAGTCTGG - Intergenic
1054834478 9:69661957-69661979 TTTGTAAGTTACCCAGCCTCAGG + Intronic
1054837420 9:69692566-69692588 TTTCTAAATGACCCAGTGTCAGG - Intergenic
1055093612 9:72387863-72387885 TTTATAAATTACCCAGATTCAGG - Intergenic
1055139448 9:72859442-72859464 TTTATAAATTACCCAGTGTCAGG - Intergenic
1055307274 9:74942896-74942918 CTTATAAATTACCCAGTCTCAGG - Intergenic
1055435104 9:76284844-76284866 CTTTTAAATTACCCAGTCTCAGG + Intronic
1055729179 9:79263101-79263123 TTTATAAATTACCCAGTGTCTGG + Intergenic
1055813524 9:80178984-80179006 TTTATAAGTTACCCAGCCTCAGG - Intergenic
1055856062 9:80690267-80690289 CTTATAAATTACCCAGTGTCAGG + Intergenic
1055885838 9:81062474-81062496 CTTTTAAGTTACCCAGTCTTGGG + Intergenic
1056109201 9:83377777-83377799 CTTATAAATTACCCAGTCTCAGG + Intronic
1056240571 9:84642383-84642405 CTTATAAATTACCCAGTCTCGGG + Intergenic
1056360854 9:85856050-85856072 TTTCTAAATTACCCAGTCTCTGG + Intergenic
1056444618 9:86653792-86653814 CTTATAAATTACCCAGTTTCAGG - Intergenic
1056468198 9:86879466-86879488 CTTATAATTTACCCAGTCTCAGG - Intergenic
1056481970 9:87015231-87015253 TTTCTAAATTACCCAGTCTCTGG - Intergenic
1056734380 9:89194478-89194500 TTTATAAATTACCCAGACTCAGG - Intergenic
1056886915 9:90451647-90451669 TTTATAAATTACCCAGTGTCGGG + Intergenic
1057063050 9:92022462-92022484 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1057109117 9:92449890-92449912 TTTATAAATTACCCAGTGTCAGG + Intronic
1057285465 9:93750026-93750048 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1057300103 9:93873181-93873203 CTTATAAATTACCCAGTTTCAGG - Intergenic
1057300201 9:93873953-93873975 CTTATAAATTACCCAGTCTCAGG + Intergenic
1057506060 9:95634439-95634461 CTTATAAATTACCCAGTCTCAGG + Intergenic
1057557891 9:96102166-96102188 CTTGTAAGTTTCCCAGCCTCAGG - Intergenic
1057927458 9:99165978-99166000 TTTATAAGTTACCCAGTCTCGGG + Intergenic
1057937473 9:99253007-99253029 CTTATAAATTACCCAGTCTCAGG - Intergenic
1057956213 9:99410093-99410115 CTTATAAATTACCCAGTCTCTGG + Intergenic
1058098231 9:100887801-100887823 CTTCTTACTCACACAGAGTCTGG + Intergenic
1058179557 9:101779950-101779972 CTTATAAATTACCCAGTCTCAGG + Intergenic
1058275395 9:103035672-103035694 TTTATAAGTTACCCAGTTTCAGG - Intergenic
1058328491 9:103728018-103728040 CTTATAAATTACCCAGTCTCAGG + Intergenic
1058335488 9:103823247-103823269 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1058388503 9:104466547-104466569 ATTCCAAGTTCCCCAAAGTCTGG + Intergenic
1058625659 9:106930521-106930543 CTTCTAAGTGACCAAAAGGCTGG - Exonic
1058937820 9:109785496-109785518 CTTATAAATTACCCAGTCTCGGG - Intronic
1059043967 9:110844006-110844028 CTTATAAATTACCCAGTTTCAGG + Intergenic
1059064986 9:111074367-111074389 CTTATAAATTACCCAGTCTCAGG - Intergenic
1059162329 9:112047058-112047080 CTTTTAAATTACCCAGTCTCAGG - Intronic
1059261710 9:112983418-112983440 CTTATAAATTACCCAGTCTCAGG - Intergenic
1059838041 9:118179200-118179222 CTTATAAGGTACCCAGTCTCAGG + Intergenic
1060178723 9:121516845-121516867 CTTATAAGTTATCCAGACTCAGG + Intergenic
1060379081 9:123148407-123148429 CTTATAAGTTACCCAGTCTAAGG + Intronic
1060505349 9:124193598-124193620 CTTATAAATTACCCAGTCTCAGG + Intergenic
1060755813 9:126212590-126212612 CTTATAAATTACCCAGTCTCAGG + Intergenic
1060789044 9:126473424-126473446 CTTATAAATTACCCAGTCTCAGG - Intronic
1062470990 9:136704337-136704359 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1062603840 9:137333800-137333822 CTTATAAGTTACCCAGTCCCAGG + Intronic
1062669709 9:137700877-137700899 CTTATAAATTACCCAGCCTCAGG - Intronic
1203427631 Un_GL000195v1:55897-55919 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1203449968 Un_GL000219v1:103147-103169 CTTATAATTTACCCAGTCTCAGG - Intergenic
1185676970 X:1857123-1857145 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1185922994 X:4114693-4114715 TTCCTAAGTTACCCAGTCTCTGG - Intergenic
1185952344 X:4451020-4451042 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1186124884 X:6402487-6402509 CTTATAAATTACCCAGTCTCAGG - Intergenic
1186135403 X:6515218-6515240 TTTATAAATTACCCAGTGTCAGG - Intergenic
1186145913 X:6623323-6623345 CTTATAAATTACCCAGTCTCAGG + Intergenic
1186216163 X:7303297-7303319 TTTATAAGTTACCCAGTCTCGGG + Intronic
1186310084 X:8308347-8308369 CTTATAAGTTACCCAGTCTCGGG - Intergenic
1186332586 X:8551155-8551177 CTTATAAATTACCCAGTCTCAGG + Intronic
1186388344 X:9132847-9132869 CTTATAAATTACCCAGTCTCAGG - Intronic
1186413251 X:9361913-9361935 CTTATAAATTACCCAGTCTCAGG + Intergenic
1186415085 X:9376375-9376397 CTTATAAATTACCCAGGCTCGGG - Intergenic
1186432108 X:9513754-9513776 CCTCTAAATTACCCAGTCTCAGG - Intronic
1186879464 X:13850449-13850471 CTTATAAATTACCCAGCCTCAGG + Intronic
1187165563 X:16801158-16801180 CTTATAAATTACCCAGTCTCGGG + Intronic
1187387079 X:18858810-18858832 CTTATAAATTACCCAGTCTCGGG - Intergenic
1187643526 X:21320214-21320236 TTTCTAAGTTACCCAGTCTTGGG - Intergenic
1187654381 X:21453687-21453709 TTTATAAATTACCCAGACTCAGG - Intronic
1187742362 X:22369796-22369818 TTTATAAATTACCCAGACTCAGG + Intergenic
1187810474 X:23171007-23171029 TTTATAAGTTACCCAGCCTCAGG + Intergenic
1187843316 X:23510506-23510528 CTTATAAATTACCCAGTCTCAGG + Intergenic
1188124989 X:26356289-26356311 TTTATAAGTTACCCAGCCTCAGG - Intergenic
1188148016 X:26638401-26638423 TTTATAAATTACCCAGTGTCAGG - Intergenic
1188204997 X:27344856-27344878 CTTATAAATTACCCAGTCTCAGG + Intergenic
1188435977 X:30159147-30159169 CTTATAAATTACCCAGTCTCAGG - Intergenic
1188557439 X:31428465-31428487 CTTATAAATTACCCAGCCTCAGG + Intronic
1188662182 X:32774456-32774478 TTTCTAAATTACCCAGTCTCAGG - Intronic
1189394047 X:40604283-40604305 TTTATAAATTACCCAGTGTCAGG - Intronic
1189540223 X:41979827-41979849 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1189577032 X:42364995-42365017 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1189594534 X:42549797-42549819 CTTATAAGTTACCCAGTCTCAGG - Intergenic
1189652914 X:43209212-43209234 TTTATAAGTTACCCAGTTTCAGG + Intergenic
1189707436 X:43773006-43773028 TTTATAAGTTCCCCAGACTCAGG + Intronic
1189845459 X:45132352-45132374 TTTCTAAATTACCCAGCCTCAGG - Intergenic
1189916991 X:45865062-45865084 TTTGTAAGTTACCCAGCCTCAGG + Intergenic
1190087404 X:47407965-47407987 TTTATAAGTTACCCAGTCTCAGG - Intronic
1190537549 X:51445140-51445162 CTTTTAAATTACCCAGTATCGGG - Intergenic
1190539615 X:51463695-51463717 TTTTTAAGTTACCCAGTCTCAGG - Intergenic
1190750096 X:53354523-53354545 TTTATAAATTACCCAGATTCTGG + Intergenic
1191802029 X:65092242-65092264 TTTATAAATTACCCAGTGTCAGG + Intergenic
1191826756 X:65374678-65374700 TTTCTAAATTACCCAGTATCGGG - Intronic
1191842984 X:65526225-65526247 CTTCAAAATTACCCAGCCTCAGG + Intronic
1192081804 X:68055176-68055198 CTTCTAAGTGAGACAGAGTCTGG + Intronic
1192137381 X:68616478-68616500 CTTATAAATTACCCAGCCTCAGG - Intergenic
1192565551 X:72160566-72160588 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1192604331 X:72499187-72499209 TTTATAAATTACCCAGACTCAGG + Intronic
1192769143 X:74168860-74168882 CTTATAAGTTACCCAGGCTCAGG + Intergenic
1193143642 X:78055240-78055262 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1193283357 X:79682837-79682859 TTTATAAATTACCCAGTGTCGGG + Intergenic
1193394945 X:80972289-80972311 CTTGTAAATTACCCAGCCTCAGG + Intergenic
1193439681 X:81524318-81524340 CCTATAAATTACCCAGACTCAGG - Intergenic
1193448775 X:81640873-81640895 TTTGTAAGTTACCCAGTCTCAGG - Intergenic
1193489565 X:82133006-82133028 CTTATAAATTACCCAGTGTCAGG - Intergenic
1193506392 X:82349416-82349438 CTTATAAATTACCCAGTCTCTGG - Intergenic
1193686122 X:84579239-84579261 CTTATAAATTACCCAGTCTCAGG + Intergenic
1193724649 X:85024990-85025012 CTTATAAATTACCCAGTCTCAGG - Intronic
1193724934 X:85027029-85027051 TTTATAAATTACCCAGTGTCAGG - Intronic
1193758274 X:85435446-85435468 TTTCTAAATTACCCAGTCTCAGG + Intergenic
1193814003 X:86084237-86084259 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1193900363 X:87168677-87168699 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1193984362 X:88221943-88221965 TTTATAAGTTACCCAGACTCAGG - Intergenic
1194064073 X:89240665-89240687 CTTATAAATTACCCAGTCTCAGG + Intergenic
1194206408 X:91016368-91016390 TTTATAAATTACCCAGTGTCAGG - Intergenic
1194280089 X:91940297-91940319 CTTTTAAATTACCCAGTTTCAGG + Intronic
1194339497 X:92691781-92691803 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1194373180 X:93099380-93099402 CTTATAAATTACCCAGTCTCAGG + Intergenic
1194495724 X:94615018-94615040 CTTATAAATTACCCAGTCTCAGG - Intergenic
1194558828 X:95395780-95395802 CTTTTAAATTACCCAGTCTCAGG + Intergenic
1194843779 X:98777140-98777162 CTTATAAATTACCCAGTCTCAGG + Intergenic
1195115993 X:101698103-101698125 CTTATAAATTCCCCAGACTCAGG + Intergenic
1195281931 X:103344622-103344644 TTTATAAATTACCCAGTGTCAGG - Intergenic
1195305027 X:103573642-103573664 CTTATAAATTACCCAGTCTCAGG - Intergenic
1195436600 X:104851709-104851731 CTTGTAAATTACCCAGTCTCAGG - Intronic
1195531962 X:105967919-105967941 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1195570901 X:106397599-106397621 TTTATAAATTACCCAGACTCAGG + Intergenic
1195741402 X:108068409-108068431 CTTATAAATTACCCAGTCTCAGG - Intronic
1196210330 X:112988826-112988848 CTTATAAGTTACCTAGTCTCAGG - Intergenic
1196223398 X:113138346-113138368 TTTATAAATTACCCAGTGTCAGG - Intergenic
1196263097 X:113608825-113608847 CTTATAAGTTACTCAGTGTCAGG - Intergenic
1196367046 X:114934986-114935008 CTTATAAATTACCCAGTCTCAGG - Intergenic
1196416861 X:115480236-115480258 CTTATAAATTACCCAGTCTCAGG + Intergenic
1196554208 X:117067763-117067785 CTTATAAATTACCCAGTCTCAGG + Intergenic
1196625555 X:117873328-117873350 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1196726309 X:118899158-118899180 CTTGTAAATTACCCAGCCTCAGG - Intergenic
1196782147 X:119393180-119393202 TTTCTAAGTTGCCCAGTCTCAGG - Intergenic
1197250419 X:124209879-124209901 TTCCTAAGTTAGCCAGAGTTGGG + Intronic
1197258288 X:124288143-124288165 TTTATAAATTACCCAGACTCAGG - Intronic
1197401888 X:126003063-126003085 TTTATAAGTTACCCAGTCTCAGG - Intergenic
1197679433 X:129366521-129366543 CTTATAATTTACCCAGTGTCAGG - Intergenic
1197719489 X:129735471-129735493 CTTTTAAGTTCCCCAGACCCAGG + Intergenic
1198274548 X:135088637-135088659 TTTATAAATTACCCAGACTCGGG + Intergenic
1198314275 X:135450958-135450980 TTTATAAATTACCCAGCGTCAGG - Intergenic
1198911844 X:141623674-141623696 TTTCTAACTTACCCAGTCTCAGG + Intronic
1199054595 X:143278310-143278332 TTTATAAATTACCCAGTGTCAGG + Intergenic
1199083591 X:143605011-143605033 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1199091947 X:143702894-143702916 CTTATAAGTTACCCAGTCTCAGG + Intergenic
1199117515 X:144009679-144009701 TTTCTAAATTACCCAGTCTCAGG - Intergenic
1199338075 X:146642837-146642859 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1199420948 X:147644029-147644051 TTTATAAGTTACCCATTGTCTGG + Intergenic
1199435694 X:147810158-147810180 CTTTTAAATTACCCAGTCTCGGG + Intergenic
1199733414 X:150660645-150660667 TTTGTAAGTTACCCAGCCTCAGG - Intronic
1199741550 X:150740673-150740695 TTTCTAAATTACCCAGCCTCAGG - Intronic
1199929904 X:152507439-152507461 CTTATAAATTACCCAGCTTCAGG - Intergenic
1200364892 X:155651879-155651901 TTTATAAGTTACCCAGTCTCAGG - Intronic
1200380367 X:155830949-155830971 CTTATAAATTACCCAGTCTCGGG - Intergenic
1200515867 Y:4143044-4143066 TTTATAAGTTACCCAGTCTCAGG + Intergenic
1200552161 Y:4591189-4591211 TTTATAAATTACCCAGTGTCAGG - Intergenic
1200597564 Y:5163798-5163820 CTTTTAAATTACCCAGTTTCAGG + Intronic
1200647882 Y:5808562-5808584 TTTATAAGTTACCCAGTCTCTGG + Intergenic
1200718248 Y:6574764-6574786 CTTATAAATTACCCAGTCTCAGG + Intergenic
1201695417 Y:16818739-16818761 TTTATAAGTTACCCAGCTTCTGG + Intergenic