ID: 1129233218

View in Genome Browser
Species Human (GRCh38)
Location 15:74208334-74208356
Sequence AACGTGGGGCTCTTATAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129233218_1129233224 4 Left 1129233218 15:74208334-74208356 CCCAGCTATAAGAGCCCCACGTT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1129233224 15:74208361-74208383 GTTCCCAGCACGTTCCTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 173
1129233218_1129233228 9 Left 1129233218 15:74208334-74208356 CCCAGCTATAAGAGCCCCACGTT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1129233228 15:74208366-74208388 CAGCACGTTCCTCCCTGGGCTGG 0: 1
1: 0
2: 1
3: 14
4: 205
1129233218_1129233230 18 Left 1129233218 15:74208334-74208356 CCCAGCTATAAGAGCCCCACGTT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1129233230 15:74208375-74208397 CCTCCCTGGGCTGGCCACCGTGG 0: 1
1: 0
2: 7
3: 58
4: 504
1129233218_1129233233 23 Left 1129233218 15:74208334-74208356 CCCAGCTATAAGAGCCCCACGTT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1129233233 15:74208380-74208402 CTGGGCTGGCCACCGTGGTGTGG 0: 1
1: 0
2: 3
3: 28
4: 228
1129233218_1129233225 5 Left 1129233218 15:74208334-74208356 CCCAGCTATAAGAGCCCCACGTT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1129233225 15:74208362-74208384 TTCCCAGCACGTTCCTCCCTGGG 0: 1
1: 0
2: 3
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129233218 Original CRISPR AACGTGGGGCTCTTATAGCT GGG (reversed) Intronic
901035891 1:6335780-6335802 AACGTGGGGCTCCCAGTGCTTGG + Intronic
907884470 1:58580209-58580231 CATGTGGGGCTGTTCTAGCTTGG - Intergenic
913278505 1:117162718-117162740 AAAGTGGGGCTGTTAAAGCAGGG + Intronic
916822804 1:168416214-168416236 AGGGTGGAGCTCTTATAGATGGG + Intergenic
918602588 1:186381104-186381126 AATGTGGGGCTCTTTTTGTTAGG + Intronic
1064576647 10:16752576-16752598 AATGTGGAGCTCTTTAAGCTGGG + Exonic
1067013477 10:42737097-42737119 AATGTGGAGCTCTTTAAGCTGGG - Intergenic
1067310302 10:45106653-45106675 AATGTGGAGCTCTTTAAGCTGGG + Intergenic
1073151146 10:101312473-101312495 AAGGTGCAGTTCTTATAGCTAGG - Intergenic
1073995349 10:109309323-109309345 ATCGTGGGCCTCTTCAAGCTGGG - Intergenic
1089851155 11:121497748-121497770 CAGGTGGGGCTCTTATTTCTGGG + Intronic
1095420718 12:42021119-42021141 AATGTGGGGCTCTCTGAGCTGGG + Intergenic
1103378699 12:120477266-120477288 AACCCTGGGCTCTTAAAGCTGGG - Intronic
1103433718 12:120908307-120908329 CACCTGGGGCTGCTATAGCTTGG - Intergenic
1105771127 13:23612957-23612979 AACGCAGGGCTCTTATAGCACGG + Intronic
1111669089 13:91305641-91305663 AACTAGGGGCTCATATAGCAGGG - Intergenic
1113850163 13:113413375-113413397 ACCGTGGGGCTCACAGAGCTGGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1120528708 14:85607173-85607195 AACATGGTGCTCTGATGGCTTGG - Intronic
1129233218 15:74208334-74208356 AACGTGGGGCTCTTATAGCTGGG - Intronic
1132250173 15:100330155-100330177 AACCTGGGGCTCTTATACTCTGG - Intronic
1133450222 16:5897633-5897655 AAGGTGGGCCTCTCTTAGCTGGG + Intergenic
1135409105 16:22219801-22219823 AACCTGGGTCTCTTATACCATGG - Intronic
1142186795 16:88698551-88698573 AAGTTGGCGCTCTTGTAGCTGGG + Exonic
1142263549 16:89053447-89053469 AACATGGGGCTCTTCAAGCAAGG - Intergenic
1142410357 16:89912866-89912888 AGCGTGGGGCTATCACAGCTGGG - Intronic
1145111387 17:20165144-20165166 CACGTGGGGCTTTAATACCTAGG - Intronic
1151222167 17:72621164-72621186 ACAGTGGGGCTATGATAGCTTGG - Intergenic
1157151682 18:45224485-45224507 AACATGGGGCTCTGAGGGCTGGG + Intronic
1163809600 19:19422422-19422444 GACGTGGGGCTCTGCCAGCTAGG - Intronic
932152817 2:69387956-69387978 AACGCGCGGCTGTTAAAGCTAGG - Intergenic
934974327 2:98789904-98789926 AACGTGGGGCTCCTATTTCCAGG + Intergenic
942526101 2:176854609-176854631 AACTAGGGGCTCTTAAATCTGGG + Intergenic
1168977876 20:1981552-1981574 AACGTGGTGCTCTTTGAGATTGG + Intronic
1172491589 20:35343265-35343287 AACTTGGGGCTCATGTAGTTAGG + Intronic
1175176516 20:57115607-57115629 AGGGTGGGGCTCTCATAGATGGG - Intergenic
1175752553 20:61509241-61509263 ACGGTGGGGCTCTGAGAGCTGGG - Intronic
1184346581 22:43917324-43917346 AAAGTGATGCTCTTCTAGCTGGG + Intergenic
954160622 3:48719015-48719037 AATGAGGGGCTCTGAGAGCTGGG - Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
963706989 3:148699417-148699439 CAGGTGGGGCCTTTATAGCTAGG - Intronic
963730863 3:148970705-148970727 AACCTGGTGGTCTTATAACTTGG + Intergenic
969376447 4:6766622-6766644 AACTGGGGGCTCATATATCTTGG - Intergenic
989113031 5:37925872-37925894 AAAGTGGGGCTTATATACCTTGG + Intergenic
999706183 5:154274275-154274297 AACCTGGGGCTTTGATAGGTAGG + Intronic
1006168687 6:32080900-32080922 AACGTGGTGCTCTTGTCACTTGG + Intronic
1016750472 6:147625865-147625887 AAAGTGGGGTTCTTTTAGCAAGG - Intronic
1022178715 7:27897652-27897674 AGCGTGGTGATCTTGTAGCTGGG + Intronic
1028699335 7:93758976-93758998 CTGGTGGGGCTCTTATATCTTGG - Intronic
1029283925 7:99453394-99453416 AACCTGGGGGTTTTCTAGCTCGG + Intronic
1039217517 8:35289100-35289122 AAGGTGAGGCTCTTGTAGGTAGG - Intronic
1044852131 8:96439264-96439286 AACGTGGTACTTTTATACCTTGG + Intergenic
1049790435 8:144469889-144469911 AATGAGGGGCCCTCATAGCTGGG - Intronic
1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG + Intergenic
1199249995 X:145649917-145649939 AACTTGGGGCTGGTACAGCTTGG - Intergenic