ID: 1129233652

View in Genome Browser
Species Human (GRCh38)
Location 15:74210663-74210685
Sequence CTGTGAGTAAGGAGCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129233652 Original CRISPR CTGTGAGTAAGGAGCTGTGA AGG Intronic
901065547 1:6492493-6492515 CTGTGTGCAAGAAGCTGGGATGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902216938 1:14940167-14940189 CTGTGGGAAAGTAGCTGTGGTGG + Intronic
902405137 1:16178657-16178679 CTGTGTCTCAGGACCTGTGATGG + Intergenic
902989083 1:20173565-20173587 CTGTGAGTCAGGCACTGTAACGG + Intronic
904371104 1:30047874-30047896 CTGTGTGTCAGGCACTGTGAAGG - Intergenic
905098716 1:35499157-35499179 CAGTTAGTAAGGAGTTGTTAAGG + Intronic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
906128749 1:43443315-43443337 CAGTGAGCATGGAGCAGTGACGG - Intronic
906779498 1:48559883-48559905 CTGTGTGTCAGGTCCTGTGAGGG - Intronic
908961384 1:69700512-69700534 CTGTGAGGAAGGAGACATGAAGG - Intronic
909477266 1:76094878-76094900 CAGTGAGTAAGGAACGGTGGGGG - Intronic
909919120 1:81358289-81358311 ATGTGAATAAGGTGCAGTGAAGG + Intronic
912055077 1:105585935-105585957 CTGAGATTAAGGAGCACTGAAGG - Intergenic
912454637 1:109789291-109789313 CTGAGAGTAAGGGGTAGTGAGGG - Intergenic
913501743 1:119478131-119478153 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913513499 1:119583257-119583279 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
913517125 1:119614200-119614222 TGGTGAATAAGGAGCTGGGAAGG - Intergenic
915291682 1:154888371-154888393 CTGCGAGCTAGGAGCAGTGATGG + Intergenic
915740581 1:158115717-158115739 CAGGGAGCAAGGAGCTGGGAGGG + Intergenic
916764097 1:167843687-167843709 CTGTGGGAAAGGATGTGTGAGGG - Intronic
917118648 1:171626529-171626551 CTGTGAGGTAGGTCCTGTGAGGG - Intergenic
917672073 1:177282221-177282243 CTGTTGGAAAGGAGCTCTGAAGG - Exonic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920511396 1:206554977-206554999 TTGAAAGTAATGAGCTGTGATGG + Intronic
920576928 1:207068308-207068330 CTGTGAGTAGGAAGCTCTGAAGG + Exonic
921131972 1:212227752-212227774 CTGTGTGTTAGGTGCTGTGGAGG - Intergenic
921778104 1:219126416-219126438 GAGTGAGGAAGGAGCTGTTAAGG - Intergenic
922433066 1:225575129-225575151 CTGTGTGTGTGGAGCAGTGAGGG - Intronic
922618886 1:226978794-226978816 GGGTGTGTAAGGAGCTGTGCGGG - Intronic
922979564 1:229814170-229814192 GAGTGAGAAAGGGGCTGTGAGGG + Intergenic
923100395 1:230809623-230809645 CTGTGGGTCAGAAGCTGTGCTGG - Intergenic
923514301 1:234681615-234681637 CTGCGAGTAGGTAGCTGTGTGGG + Intergenic
1063105410 10:2987822-2987844 CTGTGAGCCAGGAGCAGGGAGGG - Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1063768221 10:9167599-9167621 CTGTGGGTAAGGCTCTGTGCTGG + Intergenic
1064359634 10:14652247-14652269 CTGTCAGGAAGGAGCTCTGCAGG - Intronic
1064577381 10:16760040-16760062 CTTTGAGAAAGGAGCTAAGATGG - Intronic
1067435131 10:46271270-46271292 CTGTGAGTCAGGAACTGCAATGG + Intergenic
1067438617 10:46295714-46295736 CTGTGAGTCAGGAACTGCAATGG - Intronic
1069358303 10:67613191-67613213 CTACGAACAAGGAGCTGTGAGGG - Intronic
1070030886 10:72676286-72676308 CTGTTAGTAAGGTGTTGTGTTGG - Intergenic
1071429341 10:85594198-85594220 CTGAAAGTCAGGAGCTGAGAGGG + Intergenic
1072323465 10:94273380-94273402 CTTTCAGTAAGAAACTGTGAAGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1073791310 10:106942977-106942999 CTCTCAAGAAGGAGCTGTGAAGG - Intronic
1075253152 10:120900319-120900341 GGGTCAGTGAGGAGCTGTGAGGG + Intronic
1076299150 10:129411591-129411613 CTGTCAGGATGGAGCTGGGATGG + Intergenic
1077062391 11:623638-623660 CGGTGAGAAAGGAGCCGTGGAGG + Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1079387024 11:19989471-19989493 CTGTGAGTCAGAAGCTGACATGG - Intronic
1083050409 11:59771460-59771482 AGGTGAGTAAAGGGCTGTGATGG + Intronic
1083293004 11:61700133-61700155 CTGTCAGTAAGGAGCTGGAGAGG + Intronic
1083334123 11:61912997-61913019 CTGGGAGTGAGGAACTGGGAGGG + Intronic
1083489084 11:63001601-63001623 CAGAGAGAAACGAGCTGTGAAGG - Intronic
1085947631 11:81290985-81291007 TTGTGAGAAATGAACTGTGATGG - Intergenic
1087225679 11:95595765-95595787 CTGTAATTACGGAGCTGAGAAGG + Intergenic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1089057509 11:115598209-115598231 CTTTGACTAATGAGCAGTGATGG - Intergenic
1089857710 11:121561321-121561343 CTGTGACTGAGGAGCAGTGCGGG + Intronic
1090251648 11:125255872-125255894 CTGTGGGCAAGGGGCTGGGAAGG - Intronic
1090838038 11:130467578-130467600 ATGTGAGTTAGGCACTGTGAGGG + Intronic
1091183102 11:133625265-133625287 CAGTGAGGAAGGAGCACTGATGG + Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1093726383 12:22515137-22515159 CTGTGGGTAAGGTGCTGTGGAGG + Intronic
1094070923 12:26412231-26412253 CTGTGACTAATCAGCTGAGATGG + Intronic
1094487012 12:30933480-30933502 CTGAGAGGAAGGAGCTGGAAGGG - Intronic
1095858713 12:46890719-46890741 TGGTGAATAAGGAGCTGTCAGGG + Intergenic
1098366266 12:69706428-69706450 CTGTGAGGAGGGAGGTGTGCAGG - Intergenic
1101395933 12:104347595-104347617 CTGTGTGCAAGGAGATGTGCTGG + Intronic
1103034509 12:117645663-117645685 CTGTTTGGAAGGGGCTGTGATGG + Intronic
1103715841 12:122944922-122944944 CCGTGAAGAAGGGGCTGTGATGG + Intronic
1106598911 13:31170675-31170697 TTGTGTGTAAGGAGATGTGAGGG + Intergenic
1108559043 13:51625161-51625183 CTGTGACCAAGGTGATGTGATGG + Intronic
1112592053 13:100772573-100772595 CTGTGTGTCAAGAACTGTGAAGG - Intergenic
1112613381 13:100978022-100978044 CTGTGAGGAGGTAACTGTGATGG - Intergenic
1113337392 13:109390336-109390358 CTGTGAGCAAGGTGCTGTGTTGG + Intergenic
1113795552 13:113055762-113055784 GTGTGGGTAAGATGCTGTGACGG - Intronic
1115304187 14:31916978-31917000 GTGTGAGTAAGGTGTTGTGGAGG - Intergenic
1117727858 14:58692042-58692064 ATGAGAGTAAGTACCTGTGAGGG + Intergenic
1118556804 14:67032552-67032574 CTGAGAATAAGGAACAGTGATGG + Intronic
1119779320 14:77267710-77267732 CCTTGAGGAAGGAGCTGTGTTGG - Intronic
1120937084 14:89908014-89908036 CAGTGAGTAAATAGATGTGAGGG - Intronic
1121763105 14:96462224-96462246 ATGTGGGTGAGGAGCTTTGAGGG - Intronic
1123809341 15:23907602-23907624 CTGTGAACAGGGAGCTGTGTGGG - Intergenic
1123844118 15:24279993-24280015 CTGTGAACAGGGAGCTGTGTTGG - Intergenic
1123859200 15:24446276-24446298 CTGTGAACAAGGAGCTGTGTTGG - Intergenic
1123894732 15:24817321-24817343 CTGTGAATAGGCAGCTGTGCAGG - Intergenic
1123989644 15:25673919-25673941 CTGTGAGTGTGTAGCAGTGATGG + Intergenic
1128594278 15:68930224-68930246 CTGTGAGGAAGGAACTGTAATGG - Intronic
1128726238 15:69990618-69990640 CTGTGCATGAGGAGCTGGGATGG + Intergenic
1129034174 15:72639760-72639782 CTGAGAGTCAGGCGATGTGAAGG + Intergenic
1129215708 15:74097456-74097478 CTGAGAGTCAGGCGATGTGAAGG - Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1129732841 15:77941784-77941806 CTGAGAGTCAGGCGATGTGAAGG - Intergenic
1134185214 16:12079681-12079703 CGGTGGTTAAGGAGATGTGATGG + Intronic
1134188125 16:12100192-12100214 CTGTGTGTCAGGTGCTGTGCTGG + Intronic
1136016725 16:27405601-27405623 ATGTGAGGAAGGGGCTGCGAGGG - Intronic
1136265059 16:29111374-29111396 TTGTGTGTAAGGTGCTGGGAGGG + Intergenic
1136634651 16:31512438-31512460 CTCTGAGTAAGGAGATGTCAAGG - Intergenic
1138237018 16:55392460-55392482 CTGTGAGGAGGGAGCTGTTTCGG - Intronic
1141999506 16:87656128-87656150 CTGTGAGCCAGGAGCCCTGAGGG + Intronic
1142053855 16:87979349-87979371 TTGTGTGTAAGGTGCTGGGAGGG + Intronic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1144597662 17:16584575-16584597 CTGTGAGGAAACAGCTGTGACGG + Intergenic
1144677923 17:17173718-17173740 CTGTGAGAAAGGACCAGGGAGGG + Intronic
1144688245 17:17241326-17241348 CTGTGAATAAGAAAATGTGATGG - Intergenic
1144950907 17:18992892-18992914 CTGTGAGGCAGGAGCTGTGTGGG - Intronic
1145065137 17:19757017-19757039 CTGTGATTACGGAGCAGAGACGG - Intergenic
1146150676 17:30467303-30467325 CTTTTATTAAGGAGCTGGGAAGG - Exonic
1146256457 17:31393708-31393730 ATGGGAGTATGGAGCTGGGAAGG - Intronic
1147302852 17:39543756-39543778 CTGTGAGAAAGGAGGTTTGCAGG - Intronic
1147765353 17:42831848-42831870 CAGTTAGTAAGGAGCTGAGGTGG + Intronic
1150432433 17:65129169-65129191 CTCTTTGTAAGGAGCTGAGAGGG - Intergenic
1150723449 17:67632908-67632930 TTGAGAGAAAGGAGCTGTGCTGG - Intronic
1153068822 18:1080718-1080740 TTGTGAGTATGTGGCTGTGAAGG + Intergenic
1155216362 18:23646751-23646773 TTGAGAGTCAGGAGCTGTGGGGG + Intronic
1155645328 18:28070648-28070670 CTGTGAGTTGGGCACTGTGAAGG + Intronic
1156228982 18:35135825-35135847 CTGTGTGTACAGAGCTGAGATGG + Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156600111 18:38595840-38595862 CCTTGAGTAAGGTGCTGTGAGGG + Intergenic
1157522804 18:48356897-48356919 ATGTGTGTTAGGAACTGTGAGGG - Intronic
1157847595 18:51017988-51018010 CTGTGTGTAAGGGGCAGAGAAGG - Intronic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1158875446 18:61730061-61730083 CTGTGAGTAGGGAGCAGGGATGG - Intergenic
1159135503 18:64332425-64332447 CTCTGAGGAAGGAGCAGGGAAGG - Intergenic
1159839643 18:73383795-73383817 ATGTGGGTAAGGAACTCTGATGG + Intergenic
1160309178 18:77772807-77772829 CTGTGAGAGAGGAGCCGTGGAGG + Intergenic
1160697873 19:493427-493449 CTGAGGGGAAGGGGCTGTGAGGG - Intronic
1162130070 19:8521040-8521062 CTGTGAGGTAGGAGCTGTGAAGG - Exonic
1163609744 19:18294678-18294700 CTGTGAGGAGGCGGCTGTGACGG + Intergenic
1165198014 19:34121319-34121341 CTGTGTGTATGGGGCTGTTAGGG - Intergenic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926748001 2:16175580-16175602 CTGTGAGTCAGGATATGGGAAGG - Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927676244 2:25108232-25108254 CAGTGAGTAAGGAGCTTAGCTGG - Intronic
927690218 2:25202953-25202975 CTGTGAGCAACAAGCTCTGAAGG - Intergenic
928602063 2:32913438-32913460 CTGTGATCAAGGATCAGTGAGGG - Intergenic
929212258 2:39369880-39369902 CTGGCAGTAAGGAACGGTGATGG - Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930449975 2:51523398-51523420 CTGTGATTTGGGTGCTGTGATGG + Intergenic
930705897 2:54504546-54504568 ATGTGAGTAAGGTGATGTGTAGG + Intronic
931596443 2:63950332-63950354 GTGTGTGTAATGAGCTGTAAAGG + Intronic
931895929 2:66729576-66729598 CTGTGAGTAAGTAGGTTTGTGGG - Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
937572082 2:123376180-123376202 CTGGGAGTAGGGAGGTGTCAGGG + Intergenic
938710053 2:133968571-133968593 CTGTGACTCAGGAGCAGAGATGG + Intergenic
941439132 2:165511655-165511677 CTGAGAGTGAGGAGGTGGGAAGG + Intronic
941540706 2:166780579-166780601 CTGTCACTCAGGAGCTATGATGG - Intergenic
943020806 2:182571467-182571489 AAGTGAGTATGGATCTGTGAAGG + Intergenic
943292253 2:186088816-186088838 CTGTGAGTGAGTAAATGTGAAGG + Intergenic
945971889 2:216238894-216238916 ATGAGAGTGAGGAGCAGTGAAGG - Intergenic
946875627 2:224126770-224126792 CTGTGAGGAGGTGGCTGTGAAGG - Intergenic
947328281 2:229001291-229001313 CTGTGAGTTTGTGGCTGTGAAGG + Intronic
947520413 2:230841563-230841585 CTGTGGGAAAGGAGCTGTGGAGG - Intergenic
947835033 2:233169192-233169214 CAGTGAGTGAGGAGCTGGCAAGG - Intronic
948377991 2:237534679-237534701 CTTTAACTAAGGAGCTGTGGGGG - Intronic
948548179 2:238747117-238747139 CACTGAGTCAGGAGCTGAGAGGG + Intergenic
1174972119 20:55287491-55287513 CTGTGTGGAAGCAGCTGTGTGGG - Intergenic
1178428414 21:32498109-32498131 CTTTGTGTCAGGAGCTGTGCTGG + Intronic
1181752337 22:24997499-24997521 AAGTGAGTTAGGAGCTGGGAGGG + Intronic
1182021684 22:27086903-27086925 CTGTGAGAAAGGAGGCGTGCCGG + Intergenic
1183407674 22:37638486-37638508 CTGGGAGTATGGAGATGTGTGGG + Intronic
1184391956 22:44207802-44207824 CTGTGAATTGGGAGCTGAGAAGG - Exonic
1185202003 22:49513145-49513167 CTGCAAGTAAGGATCTGTGGAGG + Intronic
950045199 3:9944907-9944929 CTGGCAGGAGGGAGCTGTGATGG - Exonic
950201730 3:11049206-11049228 CTGAGACTTAGGGGCTGTGATGG + Intergenic
950478427 3:13228679-13228701 GTGAGAGGAAGGAGCTGAGATGG - Intergenic
953495890 3:43386751-43386773 CTGGGACTGAGGAGCTGTCAGGG - Intronic
954884702 3:53862278-53862300 CTGTGTGTAATGAGCCTTGAAGG - Intronic
955411644 3:58659299-58659321 CAGGCAGAAAGGAGCTGTGATGG - Intronic
956234361 3:67052322-67052344 CTCTGATTAAGGACCTGTTAAGG - Intergenic
957909246 3:86601043-86601065 CTTTGAGTAAGGAGTTGTACAGG + Intergenic
958121969 3:89302492-89302514 CTGAGAGTAAGGAACTGAGGAGG + Intronic
960520733 3:118652052-118652074 CTTTGACAAAGCAGCTGTGAAGG - Intergenic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
963051571 3:141147917-141147939 CTGTGAGTCAGTGGCTGGGAAGG - Exonic
963556827 3:146801718-146801740 CTGTGACTAAGGATCAGTGCAGG + Intergenic
964718727 3:159750640-159750662 CTGTGAGTGTTTAGCTGTGAAGG - Intronic
966939570 3:184737073-184737095 CTGGGCCTAAGGAGCTGTGTGGG - Intergenic
968114859 3:196081849-196081871 CTGTGGGGAAGGGGCTGTGGCGG - Intronic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
970337319 4:15061863-15061885 CTGTAAGTAGGTAGATGTGATGG + Intronic
971512007 4:27438113-27438135 CTCTGAGTTAGGTGCTATGATGG - Intergenic
974824301 4:67106987-67107009 GTGAGAGTAAGAAGCTGGGAGGG - Intergenic
975857306 4:78638282-78638304 CTGTGAGGAAGTGGCTGTGGAGG - Intergenic
976252673 4:83069208-83069230 GTGGGAATAAGGAGCTGGGAAGG - Intronic
977555388 4:98483119-98483141 TTATGAGAAATGAGCTGTGAAGG + Intronic
980299425 4:130968113-130968135 CTGTGAGTAAGAATCCCTGAAGG - Intergenic
982037478 4:151360302-151360324 CAGAGAGTTAGGAGCTGGGAGGG + Intergenic
983218701 4:165024387-165024409 GTGTGAGTAAGTAGCTGTGCAGG + Intergenic
984853604 4:184174504-184174526 CTGTGAGCACTGTGCTGTGAGGG + Intronic
985848216 5:2370004-2370026 CTGTGATTAATGAGCAGTGGAGG + Intergenic
988004677 5:25393723-25393745 TTGTAAGTAAGGATCTGTGGGGG + Intergenic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
993667729 5:90721849-90721871 GTGAGAGTGAGAAGCTGTGAAGG + Intronic
994497728 5:100535176-100535198 CTGTTAGTGAGGAGCGGTCAAGG - Intergenic
994928660 5:106152686-106152708 CTGTGAGTAAAGCCCTGTGTTGG + Intergenic
996755028 5:126926636-126926658 TTTTGAGTAAGGAGCTGTCTGGG + Intronic
999636816 5:153631775-153631797 CTTTGAGTAAAGTTCTGTGAAGG + Intronic
1000585715 5:163095881-163095903 ATGAGAGCAAGGTGCTGTGATGG - Intergenic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1002134348 5:177098671-177098693 CTCTGAGTACAGGGCTGTGACGG - Intergenic
1002261961 5:177999504-177999526 CTGGGAGTCCAGAGCTGTGAAGG - Intergenic
1003034753 6:2632957-2632979 CCGGGAGGAAGGAGCTGGGAGGG - Intronic
1003436318 6:6091731-6091753 GTGTGAGTGAGGAGCTCAGATGG + Intergenic
1004136568 6:12972976-12972998 CAGAGAGAAAGGAGTTGTGAGGG - Intronic
1005117429 6:22354272-22354294 CTGTAAGTTGGGAGTTGTGATGG + Intergenic
1006168454 6:32079575-32079597 GTCTGAGAAAGGAGCTGAGATGG + Intronic
1007079680 6:39090546-39090568 CTGAGAGTGAGGTGCTGTCAGGG + Intergenic
1009466539 6:63977584-63977606 CAGCAGGTAAGGAGCTGTGAAGG + Intronic
1011571790 6:88745993-88746015 TTGTGAGTACAGAGCAGTGAAGG + Intronic
1014254927 6:119151465-119151487 CTATGAGTCAGGAGCTGTACAGG - Intergenic
1014315814 6:119863311-119863333 CAGTAAGGAAGGAGTTGTGAGGG - Intergenic
1014950472 6:127548405-127548427 CTTTGAGTAATGAGATTTGAAGG + Intronic
1018463283 6:164019717-164019739 CTCTGATTAAGGATGTGTGAGGG - Intergenic
1018992387 6:168684208-168684230 CTGTTATCAATGAGCTGTGAGGG + Intergenic
1019073253 6:169366903-169366925 CCGGGCGTCAGGAGCTGTGAAGG + Intergenic
1019470921 7:1220239-1220261 CTGTGTGTAAGTAGCTGGAAGGG + Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1020128314 7:5545522-5545544 CTGTGAGGAAGGAGCTGGGTGGG - Intronic
1023263078 7:38377837-38377859 CTATCAGCAGGGAGCTGTGATGG + Intergenic
1024246265 7:47472575-47472597 CTGTGTGTAGGGAGCTGCCAGGG - Intronic
1026152786 7:67802471-67802493 CTATGCGTCAGGAGCTGTGCTGG + Intergenic
1026161924 7:67877131-67877153 CAGTGAGAAGGGAGCAGTGAAGG + Intergenic
1026385218 7:69840032-69840054 CAGTGAGTCAGGAACTCTGATGG + Intronic
1028382110 7:90211640-90211662 CTGTGTGGAGGGAGCTGGGAAGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032162550 7:129521933-129521955 CTATGAGGAAGGAGCTGGCAGGG - Intergenic
1032557519 7:132852734-132852756 CTGTGAGGAAGGAGAAGTGTTGG + Intronic
1034391805 7:150793035-150793057 CTGGGAAAAAAGAGCTGTGATGG + Intronic
1035311893 7:157974822-157974844 CTGTGGGTGAAGAGCTGTGCGGG + Intronic
1035572062 8:679216-679238 CTGTGAGTTGGGAGCTGTGAGGG - Intronic
1035924135 8:3709403-3709425 CTATGTGTAAATAGCTGTGAGGG + Intronic
1037717280 8:21411127-21411149 CTGTGAGTGAGGAGCCACGATGG - Intergenic
1037806468 8:22060305-22060327 CTGCGAGAAATGAGCTTTGATGG + Intronic
1039854282 8:41398947-41398969 GTCTGAAGAAGGAGCTGTGAGGG - Intergenic
1042040451 8:64583470-64583492 TGGTGAGTTGGGAGCTGTGATGG + Exonic
1042913659 8:73852925-73852947 CTGTAAGTTAGGTGCTGTAAGGG + Intronic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1047154462 8:122301438-122301460 CTGTGAGAATGGATCTGTCAGGG - Intergenic
1047400525 8:124542480-124542502 CTGAAAGTACGGAGCTGTGATGG - Intronic
1047642197 8:126832742-126832764 CTATGTTTAAGGAGCCGTGAAGG + Intergenic
1048606299 8:135971998-135972020 CTGTGAGCAAGGAGCATTGCAGG - Intergenic
1048961066 8:139577948-139577970 CTGTGTGAAAGAAGCTGTGAAGG - Intergenic
1050591206 9:7162110-7162132 GGGTGAGAAAGGAGCTGTTATGG + Intergenic
1051730386 9:20136351-20136373 CTGAGACAAAGGAGCTGAGAAGG + Intergenic
1051855093 9:21556115-21556137 CTGTGAGTTAGCAGTAGTGAAGG - Intergenic
1052089072 9:24304739-24304761 TGGTGTGTAAAGAGCTGTGATGG - Intergenic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1055354484 9:75424041-75424063 CTATGAGAAAGGCACTGTGATGG + Intergenic
1055744777 9:79431272-79431294 CTGTGAGGGATCAGCTGTGAGGG + Intergenic
1056076331 9:83044785-83044807 ATGTGAGTATGTTGCTGTGAAGG + Intronic
1056263063 9:84868186-84868208 ATGTGAATAAGGGGCCGTGAGGG + Intronic
1057132127 9:92661509-92661531 ATGTGAGGAAGGGGCTGGGAGGG - Intronic
1057587548 9:96343054-96343076 CTGTGAGAAACGAGATGCGATGG - Intronic
1059419849 9:114184101-114184123 CTGTGCCGAAGGAGCTGTGGAGG + Intronic
1060229008 9:121813480-121813502 TGGTGGGTGAGGAGCTGTGACGG + Intergenic
1060424314 9:123492110-123492132 CTGTGAGTTAGGCTCTGTGCTGG + Intronic
1060679256 9:125546782-125546804 CTCTGGGTTAGGAGCTGTGGCGG + Intronic
1060748214 9:126151673-126151695 CAGCCTGTAAGGAGCTGTGAGGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187631321 X:21175856-21175878 CTGTAAGTAAAGACCTATGAAGG - Intergenic
1187933207 X:24312344-24312366 CTGTGGGTCAGCAGCTGTGACGG + Intergenic
1187939017 X:24363710-24363732 CTGTGGGTCAGCAGCTGTGACGG - Intergenic
1188549342 X:31345315-31345337 CTGTGAGGAAGGAACTTTGAGGG - Intronic
1191724203 X:64261592-64261614 CTGTCAGTGACCAGCTGTGAGGG - Intergenic
1191932142 X:66385761-66385783 CAGTGAGTAAGGAGTTAAGAGGG + Intergenic
1193152625 X:78140402-78140424 CTGTGGGTGAGGGGCTGGGAAGG - Intergenic
1193459466 X:81773465-81773487 CTGTAAGTTAGGAGGTGTAAGGG + Intergenic
1198675280 X:139124438-139124460 CTGGGAGTCAAGACCTGTGAGGG - Intronic
1198700792 X:139396213-139396235 CTGCTATTAAGGAGCTGTGATGG + Intergenic
1199710646 X:150466837-150466859 CTGGGAGTAAGGTGCAGGGATGG - Intronic
1202105950 Y:21365729-21365751 CTGTGACTGAGGATCAGTGAAGG - Intergenic