ID: 1129235995

View in Genome Browser
Species Human (GRCh38)
Location 15:74224128-74224150
Sequence CTCTCTCTCCGCCATGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129235995_1129236004 3 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236004 15:74224154-74224176 GGGCAGGCAGGTGCTGGCCCTGG No data
1129235995_1129236009 13 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236009 15:74224164-74224186 GTGCTGGCCCTGGGGAGGCTGGG No data
1129235995_1129236006 5 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236006 15:74224156-74224178 GCAGGCAGGTGCTGGCCCTGGGG No data
1129235995_1129236002 -9 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236002 15:74224142-74224164 GAGAGAGAGGTGGGGCAGGCAGG No data
1129235995_1129236017 21 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236017 15:74224172-74224194 CCTGGGGAGGCTGGGGTGGGGGG No data
1129235995_1129236007 8 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236007 15:74224159-74224181 GGCAGGTGCTGGCCCTGGGGAGG No data
1129235995_1129236013 19 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236013 15:74224170-74224192 GCCCTGGGGAGGCTGGGGTGGGG No data
1129235995_1129236011 17 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236011 15:74224168-74224190 TGGCCCTGGGGAGGCTGGGGTGG No data
1129235995_1129236012 18 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236012 15:74224169-74224191 GGCCCTGGGGAGGCTGGGGTGGG No data
1129235995_1129236010 14 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236010 15:74224165-74224187 TGCTGGCCCTGGGGAGGCTGGGG No data
1129235995_1129236015 20 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236015 15:74224171-74224193 CCCTGGGGAGGCTGGGGTGGGGG No data
1129235995_1129236003 -3 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236003 15:74224148-74224170 GAGGTGGGGCAGGCAGGTGCTGG No data
1129235995_1129236008 12 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236008 15:74224163-74224185 GGTGCTGGCCCTGGGGAGGCTGG No data
1129235995_1129236005 4 Left 1129235995 15:74224128-74224150 CCGGCACCATGGCGGAGAGAGAG No data
Right 1129236005 15:74224155-74224177 GGCAGGCAGGTGCTGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129235995 Original CRISPR CTCTCTCTCCGCCATGGTGC CGG (reversed) Intergenic
No off target data available for this crispr