ID: 1129236630

View in Genome Browser
Species Human (GRCh38)
Location 15:74227596-74227618
Sequence TAGCCAACAGCAGTGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129236630_1129236634 28 Left 1129236630 15:74227596-74227618 CCCTGAACCACTGCTGTTGGCTA No data
Right 1129236634 15:74227647-74227669 GTAGCCCTGGCCCATAATTAAGG No data
1129236630_1129236633 15 Left 1129236630 15:74227596-74227618 CCCTGAACCACTGCTGTTGGCTA No data
Right 1129236633 15:74227634-74227656 AAGTGTTGCATAAGTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129236630 Original CRISPR TAGCCAACAGCAGTGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr