ID: 1129242809

View in Genome Browser
Species Human (GRCh38)
Location 15:74261605-74261627
Sequence TGCAGTTAATGGAGCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 210}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129242804_1129242809 20 Left 1129242804 15:74261562-74261584 CCTGCTACAGGATCTCTGGGATG 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 210
1129242800_1129242809 23 Left 1129242800 15:74261559-74261581 CCCCCTGCTACAGGATCTCTGGG 0: 1
1: 0
2: 2
3: 28
4: 266
Right 1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 210
1129242802_1129242809 22 Left 1129242802 15:74261560-74261582 CCCCTGCTACAGGATCTCTGGGA 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 210
1129242803_1129242809 21 Left 1129242803 15:74261561-74261583 CCCTGCTACAGGATCTCTGGGAT 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 210
1129242805_1129242809 -6 Left 1129242805 15:74261588-74261610 CCTCAGCCCATGACTGCTGCAGT 0: 1
1: 0
2: 2
3: 21
4: 298
Right 1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129242809 Original CRISPR TGCAGTTAATGGAGCAGCGC TGG Intronic
901573311 1:10179574-10179596 TGCAGTTTGAGGTGCAGCGCTGG + Intronic
902377857 1:16038469-16038491 TGCAGGGCATGGAGCAGAGCTGG + Intergenic
905243841 1:36598793-36598815 TGCACTTAATGGAGCAGATTGGG + Intergenic
908215054 1:61943270-61943292 TGCAGCCCATGGAGCAGGGCGGG + Intronic
909682625 1:78310190-78310212 TGCAGCCCATGGAGCAGGGCGGG + Intronic
909810722 1:79929399-79929421 TGCATTTAATGTTGCAGCTCAGG + Intergenic
910379856 1:86614413-86614435 TGCAGTCCATGGAGCAGGGTGGG - Intergenic
910561572 1:88597523-88597545 TGCATTTAATGTTGCAGCTCAGG + Intergenic
910790043 1:91041690-91041712 TGCATTTAATGTTGCAGCTCAGG + Intergenic
912582865 1:110735953-110735975 TGCCGTTAATGCAGCAGTCCAGG - Intergenic
912733607 1:112130986-112131008 TGCATTTAATGTTGCAGCTCAGG - Intergenic
913075481 1:115337922-115337944 TGCAGTCCAGGGAGCAGCCCTGG - Intronic
915206711 1:154275388-154275410 TGTAGATAGTGGAGGAGCGCCGG + Exonic
915904969 1:159871036-159871058 TGCAGTTAAAGGTGCTGAGCAGG + Intronic
917052747 1:170942003-170942025 TGCATTTAATGGTGCAGCTCAGG - Intronic
918466727 1:184828287-184828309 TGAAGGTAATGGAGCAAGGCTGG + Intronic
918918494 1:190674001-190674023 TGCATTTAATGTTGCAGCTCAGG - Intergenic
920197136 1:204236198-204236220 TGCATTTAATGTTGCAGCTCAGG + Intronic
922744528 1:228036811-228036833 TGCAGTGGATGCAGCAGCCCAGG + Intronic
1064348861 10:14558103-14558125 TGCATTTAATGGAGTAGTCCAGG - Intronic
1067191326 10:44070615-44070637 TGCAGTTATTGCAGCAAGGCTGG + Intergenic
1071480839 10:86063421-86063443 TGTAGTTATTGGAGAAGTGCAGG - Intronic
1072748403 10:97958341-97958363 TGCATTTAATGGAGAAGCAGTGG + Intronic
1074244664 10:111676700-111676722 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1076122870 10:127950277-127950299 TGCAGTTAATGCTGCAGCGCAGG + Intronic
1080976569 11:37349673-37349695 TGCACTTAATGGTGCAGCTAGGG + Intergenic
1081678559 11:44985859-44985881 TGCACTGCATGGAGCAGCGGTGG - Intergenic
1081744261 11:45462033-45462055 TGCTGTGAATGCAGCAGCCCTGG + Intergenic
1084493028 11:69488578-69488600 GGCAGTTAATGGACCGGCCCGGG + Intergenic
1084936692 11:72590536-72590558 TGCAGGTCCTGCAGCAGCGCGGG - Exonic
1086078694 11:82880504-82880526 TGCAGCCCATGGAGCAGGGCAGG - Intronic
1086141640 11:83506269-83506291 TGCATTTAATGTTGCAGCTCAGG - Intronic
1093049206 12:14487140-14487162 TGCATTTAATGTTGCAGCTCAGG - Intronic
1093049943 12:14493138-14493160 TGCATTTAATGTTGCAGCTCAGG - Intronic
1093964267 12:25308767-25308789 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1093988501 12:25564115-25564137 TGCAGCCCATGGAGCAGGGCGGG - Intronic
1094767025 12:33608771-33608793 TGCAGATAATGGAGCAGAGATGG - Intergenic
1095419135 12:42007067-42007089 TGCAGTGAATGAAGCATCCCTGG - Intergenic
1095856507 12:46865848-46865870 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1097821722 12:64134688-64134710 TGCATTTAATGTTGCAGCTCGGG - Intronic
1098234981 12:68409880-68409902 TGCAGTTACTGAAGCATTGCAGG + Intergenic
1098730783 12:74035189-74035211 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1100083039 12:90876050-90876072 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1101534967 12:105608288-105608310 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1104061076 12:125269155-125269177 TGCAGTTCATCGAGCAGACCTGG + Intronic
1104903670 12:132202426-132202448 TGCAGTGAATGGTCCAGCCCGGG + Intronic
1105338024 13:19492869-19492891 TGAATTTAAAGGAGCAGCCCTGG - Exonic
1106738033 13:32608024-32608046 TGCAGCCCATGGAGCAGGGCAGG - Intronic
1110494704 13:76153621-76153643 TGCAATGCATGGAGCAGCACTGG - Intergenic
1110572039 13:77015109-77015131 TGTAATTAATGGAGCACCTCAGG + Intronic
1113731077 13:112642032-112642054 TGCGGTTTATCGAGCAGCACAGG - Intergenic
1113807692 13:113119085-113119107 TGCAGTTAATGGGGTAGAGGAGG + Exonic
1116058628 14:39894756-39894778 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1117633838 14:57722206-57722228 TGCATTTAATGTTGCAGCTCAGG + Intronic
1117649492 14:57888078-57888100 TGGAGTTAATGAAGCAGAGTGGG - Intronic
1120082315 14:80229727-80229749 TGCATTTAATGTTGCAGCTCTGG - Intronic
1120742978 14:88128194-88128216 TGCAGCCCATGGAGCAGGGCAGG - Intergenic
1123664943 15:22600707-22600729 TGCAGTGTATGGAGCAGAGCAGG - Intergenic
1124318773 15:28695122-28695144 TGCAGTGTATGGAGCAGAGCAGG - Intergenic
1124564673 15:30802317-30802339 TGCAGTGTATGGAGCAGAGCAGG + Intergenic
1129242809 15:74261605-74261627 TGCAGTTAATGGAGCAGCGCTGG + Intronic
1141405299 16:83787432-83787454 AGGAGTAAATGGAGCAGAGCGGG - Intronic
1141964714 16:87434059-87434081 TGCAGTGAATGAAGCTGCACGGG + Intronic
1144215671 17:13053138-13053160 TGCACTTTAAGGAGAAGCGCTGG + Intergenic
1147334316 17:39717451-39717473 TGCAGTTGATGGGGCAAGGCTGG - Exonic
1147902540 17:43798456-43798478 TGCAGCCCATGGAGCAGGGCAGG - Intergenic
1149501773 17:57158188-57158210 TGCAGTTAATGGAGAGGCAGTGG + Intergenic
1151198891 17:72453252-72453274 TGCACTTCATGGAGAAGGGCAGG + Intergenic
1153382775 18:4456286-4456308 TGCAATTAAGTGGGCAGCGCAGG - Intergenic
1155337275 18:24777557-24777579 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1155822676 18:30397952-30397974 TGCATTTAATGTGGCAGCTCAGG - Intergenic
1156487718 18:37477217-37477239 TGGAGTTAATGGAGCAGCCTGGG + Intronic
1156990574 18:43402883-43402905 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1157123470 18:44933913-44933935 TGCAGCCCATGGAGCAGGGCAGG - Intronic
1157845893 18:51003779-51003801 TGCATTTAATGTTGCAGCTCAGG + Intronic
1159559370 18:69977344-69977366 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1163341779 19:16712773-16712795 TGAAGGGAATGGAGCAGGGCTGG - Intergenic
1163858603 19:19727049-19727071 TGCAGCCCATGGAGCAGGGCGGG - Intronic
1166156162 19:40912838-40912860 TGCAGCCCATGGAGCAGGGCAGG + Intergenic
1166581045 19:43899984-43900006 AGCAGTTTTTAGAGCAGCGCTGG - Intronic
1167333970 19:48873377-48873399 AGCAGTAAAAGGAGCAGCTCTGG + Exonic
925108632 2:1314487-1314509 TGCAGTGGGTGGAGCAGGGCAGG + Intronic
930456551 2:51613952-51613974 TGCATTTAATGTTGCAGCTCAGG - Intergenic
930536873 2:52654448-52654470 TGCATTTAATGTTGCAGCTCAGG - Intergenic
930909869 2:56618651-56618673 TGCATTTAATGTTGCAGCTCGGG + Intergenic
932220184 2:69993227-69993249 TGCAGTTTGTGGAGCAGTGGCGG - Intergenic
932469555 2:71944980-71945002 TTCTGTTGATGGAGCAGCGATGG + Intergenic
936076246 2:109403605-109403627 GGCACTTTATGGAGCACCGCAGG - Intronic
936641002 2:114312846-114312868 TGCATTTAATGTTGCAGCTCAGG + Intergenic
937800052 2:126072565-126072587 TGCATTTAATGTTGCAGCTCAGG + Intergenic
943239486 2:185364778-185364800 TGCATTTAATGTTGCAGCTCAGG - Intergenic
944446569 2:199797780-199797802 TTCAGTTAATTGAGCTGTGCTGG - Intronic
948703549 2:239775773-239775795 TGCTGTTTATGGAGCAGCAACGG - Intronic
1171376019 20:24694527-24694549 TGCAGGTGATGGAGAAGCTCAGG - Intergenic
1173709424 20:45141428-45141450 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1174683002 20:52426063-52426085 TGGAGTTTCTGGAGCATCGCAGG + Intergenic
1176735603 21:10543341-10543363 TGAATTTAAAGGAGCAGCCCGGG + Exonic
1177363446 21:20103668-20103690 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1178061779 21:28860839-28860861 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1178764109 21:35433118-35433140 TGCATTTAATGCTGCAGCTCGGG - Intronic
1179383241 21:40918896-40918918 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1179458491 21:41516296-41516318 TGCAGTGAATGTTGCAGCTCAGG - Intronic
1180564454 22:16651015-16651037 TTCAGTTGATGGCTCAGCGCAGG - Intergenic
1182526405 22:30923088-30923110 TGCAGTTACTGGAGCAGGAAGGG + Intergenic
1182965652 22:34518990-34519012 TGCATTTAATGTTGCAGCTCGGG - Intergenic
1183533600 22:38380389-38380411 TGAATTTAAAGGAGCAGCCCTGG - Intronic
1184575084 22:45357334-45357356 TGCCTTTAATTGAGCAGCTCTGG - Intronic
1185163673 22:49244643-49244665 GGCAGTGACTGGAGCAGGGCAGG + Intergenic
949417940 3:3833373-3833395 TGCATTTAATGTTGCAGCTCAGG - Intronic
951384256 3:22025571-22025593 TGCATTTAATGTTGCAGCTCAGG + Intronic
952586889 3:34904290-34904312 TGCAGCCCATGGAGCAGGGCGGG + Intergenic
953866257 3:46585607-46585629 TTCAGTTATTGAAGCAGCACGGG - Intronic
954053832 3:48005512-48005534 TGCATTTAATGTTGCAGCTCGGG + Intronic
955035298 3:55261908-55261930 TGCATTTAATGTTGCAGCTCAGG + Intergenic
958499556 3:94887935-94887957 TGCATTTAATGTTGCAGCTCAGG + Intergenic
958789127 3:98630773-98630795 TGCACTTAATGTTGCAGCTCAGG - Intergenic
959100454 3:102003538-102003560 TGCACTTAATGTTGCAGCTCAGG - Intergenic
959377672 3:105605351-105605373 TGCATTTAATGTTGCAGCTCAGG - Intergenic
959746296 3:109779438-109779460 TGCATTTAATGTTGCAGCTCGGG - Intergenic
962618370 3:137151024-137151046 TGGAGTCATTGGAGCAGGGCTGG + Intergenic
966044599 3:175533104-175533126 TGCATTTAATGTTGCAGCTCAGG - Intronic
966656561 3:182364908-182364930 TGCCGTCTATGGAGCAGAGCTGG - Intergenic
970982935 4:22123197-22123219 TGCAGCCCATGGAGCAGGGCGGG + Intergenic
973102662 4:46292586-46292608 TGCATTTAATGTTGCAGCTCAGG + Intronic
974262654 4:59544471-59544493 TGCATTTAATGTTGCAGCTCTGG - Intergenic
974458886 4:62163049-62163071 TGCAATTAATGTTGCAGCTCAGG + Intergenic
975733984 4:77364204-77364226 TGCACTTAATGTTGCAGCTCAGG - Intronic
977204367 4:94153115-94153137 TGCATTTAATGTTGCAGCTCAGG + Intergenic
977337645 4:95718582-95718604 TGCATTTAATGTTGCAGCTCAGG - Intergenic
977465714 4:97381218-97381240 TGCATTTAATGTGGCAGCTCAGG + Intronic
977490368 4:97702242-97702264 TGCATTTAATGTTGCAGCTCAGG - Intronic
977626879 4:99197509-99197531 TGCAGTTAATGTTGCAGCTTGGG - Intergenic
978551445 4:109931688-109931710 TCCAGTTAATCCAGCAGGGCTGG - Intronic
980957490 4:139444187-139444209 TGCATTTAATGTTGCAGCTCGGG + Intergenic
981380429 4:144065262-144065284 TGCAGTTAATGCAGAAGTGCAGG - Intergenic
981578697 4:146230633-146230655 TGCAGTTAGTGGAGGAACCCGGG + Intergenic
983439480 4:167763204-167763226 TGCTGATAATGGAGCATCCCAGG + Intergenic
985021244 4:185693045-185693067 TGCAGTGTAGGGAGCAGGGCAGG + Intronic
985226125 4:187763675-187763697 TGCAGTTAATGCTGTAGCTCTGG - Intergenic
985538356 5:476618-476640 TGCAGTCTCTGGAGCAGCGACGG - Exonic
985993108 5:3579546-3579568 TCCTGGTAATGGAGCAGCTCTGG - Intergenic
986037322 5:3952628-3952650 TGCATTTAATGTTGCAGCTCAGG - Intergenic
986955815 5:13148323-13148345 TGCATTTAATGTTGCAGCTCGGG - Intergenic
986959555 5:13197015-13197037 TGCATTTAATGTTGCAGCTCAGG + Intergenic
987657402 5:20823825-20823847 TGCATTTAATGTTGCAGCTCAGG - Intergenic
988766141 5:34380121-34380143 TGCATTTAATGTTGCAGCTCAGG + Intergenic
992214014 5:74507827-74507849 TGCAGTTAATGGGGCAGCTAGGG + Intergenic
992696809 5:79297371-79297393 TCCAGATAATGGAGCAGTGCAGG - Intronic
993319560 5:86456407-86456429 TGCATTTAATGTTGCAGCTCAGG + Intergenic
994291661 5:98034161-98034183 TGCATTTAATGTTGCAGCTCAGG - Intergenic
994583605 5:101678536-101678558 AGCAATTAAGGGAGCAGCACAGG - Intergenic
994802028 5:104390681-104390703 TGAGATTAATGGAGCAGCTCTGG + Intergenic
998568992 5:143240238-143240260 TGCAGCAAATGGAGCAGCAGAGG - Intergenic
999351103 5:150872665-150872687 TGCATTTAATGTTGCAGCTCAGG + Intronic
1000416685 5:160991755-160991777 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1000730499 5:164828772-164828794 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1000747063 5:165046403-165046425 TGCAGCCCATGGAGCAGGGCGGG - Intergenic
1004622365 6:17342275-17342297 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1005436686 6:25819681-25819703 AGCAGTTCAGGGAGCAGCCCAGG - Exonic
1010552152 6:77236528-77236550 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1011068808 6:83359508-83359530 TGCATTTAATGTTGCAGCTCAGG + Intronic
1014416721 6:121193194-121193216 TGCATTTAATGTTGCAGCTCAGG + Intronic
1014534488 6:122598819-122598841 TGCATTTAATGTTGCAGCTCAGG - Intronic
1017485806 6:154900913-154900935 TGCAGTTACAGGAGCAAGGCCGG - Intronic
1018068261 6:160138952-160138974 TGCAGTGAATGGAAGAGCGTAGG + Intronic
1018123258 6:160657719-160657741 TGCATTTAATGTTGCAGCTCGGG - Intronic
1022187237 7:27982127-27982149 TGCAGCCCATGGAGCAGGGCGGG + Intronic
1022864847 7:34406739-34406761 TGAAGTCAGTGGAGCAGGGCGGG - Intergenic
1022987053 7:35665581-35665603 TGCAGCCCATGGAGCAGGGCGGG - Intronic
1027407092 7:77873245-77873267 TGCATTTAATGCTGCAGCTCCGG - Intronic
1028050016 7:86174112-86174134 TGCAGCCCATGGAGCAGGGCAGG + Intergenic
1030458381 7:109801398-109801420 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1030734800 7:113034942-113034964 GGCAGGAAATGGAGCAGCGGTGG + Intergenic
1033075929 7:138250514-138250536 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1033274812 7:139963792-139963814 TACATTTAATTGAGCAGCTCAGG + Intronic
1034169710 7:149053512-149053534 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1037832182 8:22196319-22196341 TGCAGGAAAGGGAGCAGCTCGGG - Intronic
1039981360 8:42411828-42411850 GGCAGTTTACGGAGCAGGGCGGG - Intergenic
1042001347 8:64126157-64126179 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1043733655 8:83717589-83717611 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1044286250 8:90414642-90414664 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1046448652 8:114358796-114358818 CACAGTTAATGGAGCACTGCAGG + Intergenic
1050482372 9:6100420-6100442 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1051881849 9:21848451-21848473 TGCATTTAATGTTGCAGCTCTGG + Intronic
1052368353 9:27638643-27638665 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1053705411 9:40748217-40748239 TCAAGTAACTGGAGCAGCGCTGG - Intergenic
1054415486 9:64871824-64871846 TCAAGTAACTGGAGCAGCGCTGG - Intergenic
1055191679 9:73531968-73531990 TGTAGTTATTGTAGCAGCTCTGG - Intergenic
1057167823 9:92942266-92942288 GGGAGTTTCTGGAGCAGCGCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059811558 9:117860925-117860947 AGCATTTAGTGGAGCAGGGCTGG - Intergenic
1060058128 9:120433558-120433580 TGCAGTCATTGGAGCTGGGCTGG - Intronic
1060194357 9:121613750-121613772 TGCACTTATTGGAGAAGTGCTGG + Intronic
1190809514 X:53869803-53869825 TGCATTTAATGGTGCATCTCAGG + Intergenic
1190912437 X:54785805-54785827 TGCAGTTGATGGGGCAGCTGAGG + Intronic
1191759085 X:64627731-64627753 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1191769776 X:64742289-64742311 TGCATTTAATGTTGCAGCTCGGG - Intergenic
1192287729 X:69756028-69756050 TGCAGCCCATGGAGCAGGGCGGG - Intronic
1192522902 X:71816842-71816864 TGCAGCCCATGGAGCAGGGCGGG + Intergenic
1192673487 X:73170321-73170343 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1193035842 X:76950544-76950566 TGCAGCCCATGGAGCAGCACGGG + Intergenic
1193155921 X:78174217-78174239 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1193573956 X:83177165-83177187 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1194209995 X:91060160-91060182 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1195749133 X:108146868-108146890 TGCATTTAATGTTGCAGCTCGGG - Intronic
1196372612 X:114996294-114996316 TGCATTTAATGTTGCAGCTCGGG - Intergenic
1197084469 X:122455700-122455722 TGCATTTAATGTTGCAGCTCAGG - Intergenic
1198033168 X:132775004-132775026 TGCAGTCCATGGAGCAGAGATGG - Intronic
1198581780 X:138073573-138073595 TGCAGCTCACGGAGCAGGGCGGG + Intergenic
1198700959 X:139397707-139397729 TGCATTTAATGTTGCAGCTCGGG + Intergenic
1199711289 X:150471272-150471294 TGCAGGTAGTGGAGCAGGGAAGG - Exonic
1200340577 X:155391278-155391300 TGCATTTAATGTTGCAGCTCGGG - Intergenic
1201796783 Y:17904837-17904859 TGCAGTTAAAGTAGGAGCTCAGG - Intergenic
1201804770 Y:18001148-18001170 TGCAGTTAAAGTAGGAGCTCAGG + Intergenic
1201953060 Y:19586419-19586441 TGCAGCTCATGGAGCAGGGCAGG - Intergenic
1202034775 Y:20620782-20620804 TGCAGCCCATGGAGCAGGGCAGG - Intergenic
1202100164 Y:21299241-21299263 TGCATTTAATGTTGCAGCTCAGG + Intergenic
1202358162 Y:24073899-24073921 TGCAGTTAAAGTAGGAGCTCAGG - Intergenic
1202512616 Y:25596214-25596236 TGCAGTTAAAGTAGGAGCTCAGG + Intergenic
1202593850 Y:26515667-26515689 TGAATTTAAAGGAGCAGCCCTGG + Intergenic