ID: 1129252100

View in Genome Browser
Species Human (GRCh38)
Location 15:74314738-74314760
Sequence CTCCTGGCAGGAATGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129252100_1129252104 -7 Left 1129252100 15:74314738-74314760 CCCAGCAGCATTCCTGCCAGGAG 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1129252104 15:74314754-74314776 CCAGGAGAGAGTTTTAGAAATGG 0: 1
1: 0
2: 3
3: 26
4: 318
1129252100_1129252106 2 Left 1129252100 15:74314738-74314760 CCCAGCAGCATTCCTGCCAGGAG 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1129252106 15:74314763-74314785 AGTTTTAGAAATGGAAATGGAGG 0: 1
1: 1
2: 4
3: 80
4: 598
1129252100_1129252107 3 Left 1129252100 15:74314738-74314760 CCCAGCAGCATTCCTGCCAGGAG 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1129252107 15:74314764-74314786 GTTTTAGAAATGGAAATGGAGGG 0: 1
1: 1
2: 5
3: 69
4: 571
1129252100_1129252105 -1 Left 1129252100 15:74314738-74314760 CCCAGCAGCATTCCTGCCAGGAG 0: 1
1: 0
2: 1
3: 22
4: 262
Right 1129252105 15:74314760-74314782 GAGAGTTTTAGAAATGGAAATGG 0: 1
1: 0
2: 4
3: 62
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129252100 Original CRISPR CTCCTGGCAGGAATGCTGCT GGG (reversed) Intronic
900309753 1:2028017-2028039 CTCCTGGCTGGGGTCCTGCTCGG + Intronic
900792742 1:4690777-4690799 CTCCTGGCAGAAATGGTCCCAGG - Intronic
901081341 1:6585909-6585931 CTCCTGGCAGGAAACATACTGGG + Exonic
901830390 1:11888618-11888640 CTCCTTCCAGGAATGCTTCCTGG - Intergenic
901855023 1:12039067-12039089 CTCCTGGAAGGGCTGTTGCTGGG + Intergenic
902510402 1:16963706-16963728 CTCCAAGCAGGAGTGCTGCCAGG + Intronic
903007493 1:20308439-20308461 CTCCTGTCTGGAATGCTGATTGG - Intronic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
904015313 1:27415442-27415464 CTCCTGGCAGCCATGCTAATGGG + Intronic
905183470 1:36180089-36180111 CTGCTGGGAGGAATGGAGCTGGG - Intronic
905646237 1:39626688-39626710 CTCCTGGCAGCCCTGCTGCTGGG + Exonic
907167546 1:52427907-52427929 CTGTTGGTAAGAATGCTGCTTGG - Intronic
907599895 1:55758159-55758181 CTTCTGGCAGTAAAGCTGCAAGG - Intergenic
910804488 1:91177054-91177076 TTCCTGCCAGGCATTCTGCTAGG - Intergenic
911751855 1:101504674-101504696 CTCCTGTTAGGAAACCTGCTGGG - Intergenic
912411292 1:109482466-109482488 CTCCTGACAGGAAGCCTGTTTGG - Intergenic
912945914 1:114083961-114083983 CTCCTGGAAGGGATGAGGCTGGG + Intergenic
914331288 1:146673108-146673130 CTCCCGAAAGGAATGCAGCTCGG - Intergenic
914371941 1:147033252-147033274 AACCTGGCAGGAATGGTCCTGGG - Intergenic
914577576 1:148989554-148989576 AACCTGGCAGGAATGGTCCTGGG + Intronic
915348011 1:155207897-155207919 CCCCTGGCAGGCAGGCAGCTGGG + Exonic
916722755 1:167496961-167496983 CTCCTGGCAGTAGGGTTGCTAGG - Intronic
918163040 1:181919149-181919171 GTCCTGGCTGGAAATCTGCTGGG + Intergenic
921165664 1:212505142-212505164 CTCCTGTCAGTGATGCTTCTTGG + Intergenic
922323096 1:224504591-224504613 CTCCTTGGAGGAATTCAGCTGGG - Intronic
922338223 1:224634860-224634882 CTCCTGGCGGGGATGCAGCGGGG - Intronic
922604635 1:226881984-226882006 CTCCTGGCAGGAGCGCGGCGTGG - Exonic
923499293 1:234551036-234551058 ATCCTGACATGACTGCTGCTTGG - Intergenic
924290945 1:242535619-242535641 GTCTTGGCAGGAATAGTGCTTGG - Intergenic
1062973497 10:1666008-1666030 CACCTGGCAGGACTGTGGCTGGG - Intronic
1064479780 10:15727740-15727762 CTCCTTCCAGTAATGCTACTTGG - Intergenic
1065415524 10:25481220-25481242 CTCCCAGCAGGAAATCTGCTTGG - Intronic
1067110380 10:43396329-43396351 CTCCTGGCGAGAGTGCTGCCCGG - Intronic
1067223351 10:44359711-44359733 CCCCTGGCAGGACAGCTGGTGGG + Intergenic
1071327178 10:84529063-84529085 CTCCTGTTAGGAAACCTGCTGGG + Intergenic
1072632714 10:97157677-97157699 CCCCTGGCAGGAATGGTCCAGGG - Intronic
1072902583 10:99421711-99421733 CCCCTGCCAGGAATCCTACTTGG - Intronic
1073075670 10:100824728-100824750 ACCCTGGCAGGAATGGTGCCTGG + Exonic
1073307409 10:102514303-102514325 CTCCTGGCAGGCATGCTTCAGGG + Intronic
1073811836 10:107160985-107161007 CTTCTGGCATGAAAGGTGCTGGG - Intronic
1074393184 10:113074867-113074889 CACAGGGCAGGGATGCTGCTAGG + Intronic
1075177449 10:120178777-120178799 CTCCTGTCAGGAAGCCTCCTAGG - Intergenic
1075595191 10:123724079-123724101 CTCCTGGCAGGGAGGCTGGGTGG - Intronic
1076008648 10:126968688-126968710 GTGCTGGCAGGGATGCTGTTAGG + Intronic
1076723807 10:132404284-132404306 CTCCTGGGAGCATTCCTGCTGGG + Intronic
1078186207 11:9053939-9053961 CTCCTGCCAGGAAATTTGCTGGG - Intronic
1079157941 11:17965902-17965924 ATCCTTGCAGCAATGCTGCAAGG - Intronic
1080763501 11:35275143-35275165 CTCCAGAGAGGAATGCTGTTGGG + Intronic
1080885455 11:36363586-36363608 CTCCTTGCAGGAAACCTGCCCGG - Intronic
1081614616 11:44583269-44583291 GTCCAGGCAGGAATGCTGGAGGG + Intronic
1083200574 11:61118809-61118831 CTCCTGGCATGAGTGCCGCTTGG - Intronic
1083295752 11:61714664-61714686 CACCTGGCAGTGACGCTGCTGGG + Intronic
1083519158 11:63291591-63291613 CTTCTGACTGGAATGCTGGTGGG + Exonic
1084010725 11:66346994-66347016 CTCCTGGCAGGACCGCAGCAGGG + Exonic
1084086191 11:66856467-66856489 CCCCTGGCAGGGCTGCTGCGGGG - Intronic
1084380990 11:68812644-68812666 CCCCTGGCAGCAGGGCTGCTGGG + Intronic
1084426961 11:69089387-69089409 CTCCTGACATGAATGCGGGTTGG - Intronic
1084594651 11:70109710-70109732 CTACTGGAAGGAACGCTGCAGGG - Intronic
1084928930 11:72538257-72538279 CTCTTGGAATGAATGCTTCTAGG - Intergenic
1085045264 11:73349036-73349058 CTGCAGGAAGGAAGGCTGCTGGG + Intronic
1088375641 11:109138389-109138411 TTCCTGGCATAAATCCTGCTTGG + Intergenic
1089284566 11:117397213-117397235 CTCATGGCGCCAATGCTGCTGGG - Exonic
1090080968 11:123612433-123612455 TGCCTGGCAGGCAGGCTGCTGGG + Intronic
1090759829 11:129826615-129826637 GTCCTAGCCTGAATGCTGCTAGG - Intronic
1091930717 12:4393193-4393215 CACCTGTGAGGAATCCTGCTGGG - Intergenic
1093181116 12:15967899-15967921 ATCCTGTCAGGAAAGCAGCTGGG - Intronic
1093726899 12:22523454-22523476 ATGCAGGAAGGAATGCTGCTGGG + Exonic
1094287744 12:28814471-28814493 CTGGTGGCAGTAGTGCTGCTTGG + Intergenic
1095470004 12:42526518-42526540 CTCAAGGCAGAAAAGCTGCTGGG - Intronic
1095724147 12:45433750-45433772 CTCCCCTCAGGAATGCTGCAAGG - Intronic
1095937286 12:47699021-47699043 ATCCTGGCAGCAATGTTGGTAGG - Intronic
1096515331 12:52152398-52152420 GTCCGGGCAGGAAGGCCGCTCGG - Intergenic
1096594829 12:52688259-52688281 CTCCTGACAGGCCTGCTGCCAGG + Intergenic
1100476327 12:94938979-94939001 CCCCTAGCAGGCCTGCTGCTTGG - Intronic
1101584298 12:106071059-106071081 CACCTGACAGCAATGCAGCTGGG + Intronic
1102303501 12:111788082-111788104 GTCTTGGCAGGCATGCTACTTGG + Intronic
1103714390 12:122935488-122935510 CCCCAGGCAGCAAGGCTGCTGGG - Intronic
1104016866 12:124967427-124967449 TTCCTGGGAGTGATGCTGCTGGG - Intronic
1104192085 12:126491582-126491604 CTCCTGGAATGCATGTTGCTTGG + Intergenic
1106689470 13:32098420-32098442 CACCTAGCAGGGATGGTGCTCGG + Intronic
1108524033 13:51270473-51270495 CTCCTGGCCAGAATTCTGCGTGG - Intronic
1108836631 13:54558078-54558100 CAACTGGCAGGAATCTTGCTTGG - Intergenic
1110050354 13:70888982-70889004 CTCCTGGCTGGTTTGCTTCTAGG + Intergenic
1113158758 13:107355032-107355054 TTCCTGGCAGGGAGGCTGCAGGG + Intronic
1113884823 13:113653008-113653030 CTCCTGGAAGAAGTACTGCTCGG + Exonic
1115545946 14:34464816-34464838 CACCTGGCAGACATGGTGCTAGG - Intergenic
1118592887 14:67414222-67414244 CTCCTGGCAGGGCTCCTGCCAGG + Intergenic
1120232376 14:81854382-81854404 CTCCAGGCAGGAAGGGGGCTTGG + Intergenic
1120766892 14:88336164-88336186 CTGCTGGCGGGAATGCAGATTGG + Intergenic
1121570936 14:94946011-94946033 CTGCTGCCTGGAATGGTGCTTGG - Intergenic
1121687977 14:95853647-95853669 CCCATGGAAGGGATGCTGCTGGG - Intergenic
1121974692 14:98392083-98392105 CTCATTGCTGGAATGCTGCCTGG - Intergenic
1122558343 14:102593141-102593163 CTCCTGGGAGGAAGGCAGCTCGG + Exonic
1124624466 15:31300150-31300172 CCCCTGGAAGGAGTGCAGCTGGG + Intergenic
1127725239 15:61743410-61743432 TTCCTGGCATCACTGCTGCTGGG - Intergenic
1128739388 15:70073187-70073209 CTCCTACCAGGAATGCTGGGAGG - Intronic
1129105790 15:73306332-73306354 CTCCTGGCAGGGATCCTAGTAGG + Intergenic
1129252100 15:74314738-74314760 CTCCTGGCAGGAATGCTGCTGGG - Intronic
1132566320 16:625223-625245 CACCTGGCAGGACTGCAGCAGGG - Intronic
1132830097 16:1923775-1923797 CTCCTGCCAGGATTCCTGCGAGG + Intergenic
1133328150 16:4954865-4954887 TTCCTGGAAGGCATCCTGCTGGG - Intronic
1134844944 16:17432112-17432134 CTGCTGGCAGGAATGCAGAATGG + Intronic
1136064002 16:27746698-27746720 CTCCTGGCAGGGGTGCAGCAAGG + Intronic
1137938637 16:52658973-52658995 CTCCTGGCAGGCATGCCCCCAGG + Intergenic
1139398649 16:66662041-66662063 CTCCTGGCTTGCAGGCTGCTGGG - Intronic
1139714643 16:68802997-68803019 TTCTTGGCAGGAATGTTTCTAGG + Intronic
1140002268 16:71037793-71037815 CTCCCGAAAGGAATGCAGCTCGG + Intronic
1141825003 16:86472598-86472620 CTGCTGGCTGGAATGCAGATGGG + Intergenic
1141973195 16:87496244-87496266 CTCCTGGCACGCTTGCAGCTGGG - Intergenic
1142844989 17:2667479-2667501 CTCCTGAGAGGCATGCTGCCAGG + Intronic
1143785255 17:9250874-9250896 CTCCTGGCTTGAGTGCTGCCTGG - Intronic
1147770823 17:42866815-42866837 CTCCTGGCTGCAAGGCTGCAAGG - Intergenic
1149082856 17:52678658-52678680 CTCTTGGTAGGCATGCTCCTAGG + Intergenic
1152147948 17:78580499-78580521 CACATGGCAGGGATGCTGCCGGG - Intergenic
1153550314 18:6256064-6256086 CTTCTGGCTGGAAAGCTTCTGGG + Intronic
1153606255 18:6836385-6836407 CTCCTGGTGGGAAACCTGCTTGG - Intronic
1153845349 18:9044323-9044345 CTCCTGGGAGGAAAGGTTCTGGG + Intergenic
1156369714 18:36461796-36461818 TTCCTTGCTGGAATCCTGCTTGG - Intronic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1157200350 18:45654121-45654143 CTTTTGGCAGGAATGCTGGGGGG + Intronic
1157328323 18:46685268-46685290 TTCCTGGCAGGAATGTGGCTGGG + Intronic
1157564683 18:48672080-48672102 CTCCTGGCTTGACTGCTCCTTGG + Intronic
1157593524 18:48850295-48850317 CTATTGTCAGTAATGCTGCTGGG + Intronic
1160350461 18:78174118-78174140 TAACTGGCAGGAAGGCTGCTGGG - Intergenic
1162020015 19:7864060-7864082 CTCCTGGCAGGCTTCCTTCTGGG + Intronic
1162108374 19:8385211-8385233 CTCCTGTTAGGAAACCTGCTGGG - Intronic
1162174981 19:8823759-8823781 CGCCTGGCTGGAGTTCTGCTGGG - Intronic
1163440351 19:17319678-17319700 CTCCTGCCAGGTCTGCTCCTCGG + Exonic
1165489228 19:36113815-36113837 GTCCTGGCAGAAATGATGCATGG + Exonic
1167415501 19:49369117-49369139 CTCCTGGCAGGATTGCTGATGGG + Intronic
1168650415 19:58088825-58088847 CTGTTGACAGGGATGCTGCTGGG - Exonic
925870392 2:8265147-8265169 CTCCTGGCAGGGATGTTTCGTGG - Intergenic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
926891877 2:17645446-17645468 ATCCAGGCAGCAATGGTGCTGGG + Intronic
927081185 2:19632464-19632486 CTCCTGGCATGACTTATGCTTGG - Intergenic
927154282 2:20212761-20212783 CTCCTCTCAGAAGTGCTGCTGGG - Intronic
927982647 2:27384080-27384102 CCCCTGGCAGGAATGCAGCGAGG - Exonic
928119590 2:28573915-28573937 GTCCTGGCAGTAATGCAGCAAGG + Intronic
929829646 2:45336474-45336496 CTCCTGGCAGGGCTGCTGCATGG - Intergenic
933763873 2:85694440-85694462 CTCCTTGCAGCCATGCTCCTGGG + Exonic
934057310 2:88262188-88262210 CTCCTGGGAGAATTTCTGCTAGG - Intergenic
934297204 2:91752208-91752230 CGCATGGCAGGAAGGCTGCAGGG + Intergenic
934673289 2:96230773-96230795 CTCCTCTCAGGAAACCTGCTTGG - Intergenic
935508950 2:103946912-103946934 CTCCTGGCAGGAAAGTGGCTGGG + Intergenic
936384931 2:112020723-112020745 CCTCTGGGAGGAAGGCTGCTGGG + Intronic
938080723 2:128368658-128368680 CCCCTGCCAGGCAGGCTGCTGGG - Intergenic
939493839 2:142905511-142905533 CCCCTGTTAGGAAAGCTGCTAGG + Intronic
941806677 2:169717083-169717105 CCCGTGGCAGAGATGCTGCTCGG - Intronic
942042716 2:172081523-172081545 CTCCGGGCAGGAATGGCCCTTGG - Exonic
944396021 2:199267062-199267084 TTCCTGGAAGAAGTGCTGCTTGG + Intergenic
945061158 2:205910120-205910142 CTGCTGGCAGGACTCCTGCAGGG + Intergenic
945100394 2:206257705-206257727 CTCCCCGCAGGAAGCCTGCTTGG - Intergenic
946115377 2:217457333-217457355 CTCCTTGGAGGGATGCTGGTTGG - Intronic
946835211 2:223765657-223765679 CTCCTTCCTGGAATGCAGCTGGG - Intronic
947210441 2:227703633-227703655 CTTCTTCCTGGAATGCTGCTGGG + Intronic
948352009 2:237348568-237348590 CTCCTGGCAGCAAGGACGCTTGG + Intronic
948558740 2:238836181-238836203 CTCCTGGCCTGACTGCAGCTGGG - Intergenic
1168952552 20:1812383-1812405 CTCTTGGAAGCAATGCTGCAAGG - Intergenic
1171300662 20:24057587-24057609 ATCCTTGCAGGAATGCTTATGGG + Intergenic
1171391542 20:24804633-24804655 CTCCTGCCAGCAGTGCTGCCAGG - Intergenic
1172035129 20:32005219-32005241 CTGCTGGCTGGACTGCAGCTGGG + Intergenic
1173271401 20:41539074-41539096 CTCCCTGCAGGAAACCTGCTTGG + Intronic
1174489568 20:50883246-50883268 CTCCTGGAAGAAATCCTGCTTGG - Intergenic
1175253158 20:57621901-57621923 CACCTCACAGGAATGCTTCTGGG + Intergenic
1178603421 21:34014506-34014528 CTGCTGGCAGGAATGCAACATGG + Intergenic
1179091328 21:38268735-38268757 CTCCTGGCAGCAATACTCTTGGG + Intronic
1179621810 21:42621309-42621331 CGTCGGGCAGGAATGCTGGTCGG + Intergenic
1180134888 21:45855817-45855839 CTCCTGCCAGGGAAGTTGCTCGG + Intronic
1180600482 22:17012250-17012272 CTCCTGGCACAGGTGCTGCTTGG + Intergenic
1182928481 22:34150463-34150485 CTCCTGGTTGAAATGCTGATGGG - Intergenic
1182986698 22:34725082-34725104 TTCCAGGTAGGAATGCTGTTGGG - Intergenic
1183832217 22:40424287-40424309 CTCATGGCTGGCAGGCTGCTCGG + Exonic
1184582083 22:45424697-45424719 CTCCTGGGAGGAAGCCTGCGGGG - Intronic
1185329533 22:50245947-50245969 CTCCTGGCTGCAATGCTTCGGGG - Exonic
949200748 3:1376411-1376433 CTCCTGTCAAGAATGCGACTGGG - Intronic
949300659 3:2580260-2580282 CTCCTGGCAGCAAGGCAGCTAGG + Intronic
952940486 3:38440581-38440603 CTCCTGTCAGGAAACCTGCTGGG + Intergenic
953658141 3:44870458-44870480 CTGCTAGCAGTAATGCAGCTAGG - Intronic
954264477 3:49461798-49461820 CTCCAGGAAGGAATGCAGTTGGG - Intergenic
954811916 3:53253900-53253922 ATGCTGTCAGGAATGCTTCTTGG - Intronic
954909971 3:54096229-54096251 CTAATGGAAGGAATGTTGCTAGG - Intergenic
959228847 3:103620632-103620654 CTCATGGGAGGAATCCTGGTGGG - Intergenic
959840434 3:110968706-110968728 CTCCTGACAAGAAACCTGCTGGG + Intergenic
961614065 3:128164792-128164814 CTTCTGGGAGGAAGGCTGGTAGG + Intronic
962453649 3:135544886-135544908 CACCTGGAATGAATTCTGCTTGG + Intergenic
967584130 3:191191584-191191606 CTCCTGTTAGGAAACCTGCTGGG - Intergenic
969265008 4:6058694-6058716 CTCGTGGCAGGACTGCTGACAGG + Intronic
969651114 4:8468908-8468930 TTCCGGGCAGGGATGCTGCTTGG + Intronic
969881631 4:10179027-10179049 CTCCCGGCATGGTTGCTGCTGGG - Intergenic
970339473 4:15089610-15089632 CTCCTGGAAGGAATCTTCCTTGG + Intergenic
971390795 4:26183663-26183685 GTCCTGGTAAGAAGGCTGCTGGG - Intronic
972801557 4:42481278-42481300 GTCCTGGTTGGAAAGCTGCTGGG - Intronic
973331669 4:48915524-48915546 CTCATGGCAGAAAAGCTGCATGG + Intergenic
975128765 4:70811529-70811551 CTGCTGGCATGTCTGCTGCTAGG - Intergenic
975520820 4:75299321-75299343 CTCTTGGCAGAAATGCTACAAGG - Intergenic
977183227 4:93903913-93903935 CTCCTGGATGTAGTGCTGCTGGG - Intergenic
977927490 4:102717691-102717713 CTTCTGAAAGGAATGCTTCTGGG - Intronic
978578161 4:110206593-110206615 GTCATGGGAGGAAGGCTGCTGGG - Intergenic
979302766 4:119106516-119106538 CCCAGGGTAGGAATGCTGCTGGG + Intergenic
981588723 4:146332787-146332809 TTCCTGTCAGAAATGCTACTTGG - Intronic
981901941 4:149876242-149876264 CTCCTTGCAGTATTGCTGCCTGG + Intergenic
982630482 4:157824015-157824037 CTCCTGGCCAGAACTCTGCTTGG + Intergenic
983321690 4:166203041-166203063 CTGCTGACAGGGATGCTGTTTGG - Intergenic
984786441 4:183571710-183571732 TTCCTGGAAAGCATGCTGCTGGG + Intergenic
984875138 4:184360913-184360935 GTAGTGGCAGAAATGCTGCTTGG - Intergenic
985570560 5:642554-642576 CCCCTGGCAGCACTGGTGCTCGG - Intronic
985591635 5:768457-768479 CTCCTGGCTGCGCTGCTGCTGGG - Intergenic
985609551 5:879416-879438 CTCCTGGCTGCGCTGCTGCTGGG - Intronic
986276083 5:6276169-6276191 CTCCTGGCATTTATGTTGCTGGG - Intergenic
986720192 5:10555540-10555562 ATCCTGGCAGGTCTGCTGCGGGG + Intergenic
990533647 5:56698718-56698740 CTCCTGGCTGGAAAGCTGATAGG - Intergenic
992173509 5:74127223-74127245 CTCCTGGCAGACATGATTCTGGG - Intergenic
994006027 5:94838211-94838233 ATTCTGGCAGGAAAGATGCTGGG - Intronic
996269327 5:121583802-121583824 CTGCTGACAATAATGCTGCTAGG - Intergenic
996734967 5:126750046-126750068 CTAATAGCAGGAATGATGCTAGG + Intergenic
997257845 5:132442971-132442993 CCCCTGGCAGGTATGCTGTGGGG - Intronic
997700216 5:135892569-135892591 CTCTTGGCAGGTAGGCTTCTGGG - Intronic
999651610 5:153773515-153773537 CTCCTCAAAGGAATGGTGCTGGG - Intronic
1000525704 5:162355011-162355033 CTACTGGCAGGTAGGATGCTTGG + Intergenic
1001428808 5:171643660-171643682 CTCCTGGCAGGGGTGCTGGGAGG + Intergenic
1001926356 5:175640011-175640033 CTCCTGGCAGCAATGCCTGTTGG - Intergenic
1002599716 5:180347280-180347302 CTGCTGGTAGGAAGGATGCTTGG - Intronic
1005439847 6:25855218-25855240 CTCTTTGCAGGAATGTTACTGGG - Exonic
1006780900 6:36631663-36631685 TTCCTGGCAGAAATACGGCTGGG + Intergenic
1006901681 6:37506803-37506825 ATTCTGGCCAGAATGCTGCTTGG + Intergenic
1011554366 6:88559145-88559167 CTCGTGGCAGAAATGCATCTGGG + Intergenic
1011674710 6:89721175-89721197 CTCCTGTGAGGTATGGTGCTGGG + Intronic
1013166692 6:107600368-107600390 CTCCTAGCAGCAAGGCTGCAGGG - Intronic
1017102013 6:150857075-150857097 CTCCTGGCAGGATTGCTGACAGG - Intergenic
1018817297 6:167343134-167343156 CTCCTGGCAGGACCCCGGCTCGG + Intronic
1023077762 7:36500711-36500733 CCCCTGTTAGGAAAGCTGCTGGG + Intergenic
1026794205 7:73355497-73355519 CTCCAGGCATGAATGCAGATGGG - Intronic
1028018284 7:85741734-85741756 CTCCTGTCAAGAAACCTGCTGGG + Intergenic
1029575581 7:101401371-101401393 CTCCTGGCAGGATTAGAGCTGGG - Intronic
1029818928 7:103126558-103126580 CCCCTGGGAGGAATGATGCTAGG - Intronic
1030067829 7:105673994-105674016 CTCCTGGCATGGAAACTGCTTGG - Intronic
1030710078 7:112739604-112739626 CTCCTGGCAGGCATGCCACAAGG - Intergenic
1032506711 7:132440812-132440834 CTCTTGGCAGAAAACCTGCTGGG + Intronic
1034555050 7:151845127-151845149 TTCCTGGCAGGATCACTGCTCGG + Intronic
1035050614 7:155996848-155996870 CTCGTGGCAGGACTGCCACTCGG - Intergenic
1036170142 8:6475734-6475756 CTCCCTGCAGGAAACCTGCTTGG - Intronic
1036394623 8:8358694-8358716 CTCGTGGCAGGATTGCTGATGGG - Intronic
1036395102 8:8362708-8362730 CTTGTGGCAGGATTGCTGATGGG - Intronic
1036631942 8:10522031-10522053 GTTCTGGGAGGGATGCTGCTGGG - Intergenic
1036706720 8:11052192-11052214 CTCCTGCCTGGAAGGCTTCTTGG + Intronic
1037304708 8:17493299-17493321 CTTCTGCCAGGATTCCTGCTGGG - Intergenic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1037522428 8:19693013-19693035 CTCCTGGCAGGTGTGCTGATGGG - Intronic
1038923365 8:32110879-32110901 CTCCAGACAGCAATGCTTCTGGG - Intronic
1039876977 8:41595267-41595289 CTCCTGTTAGGAAACCTGCTGGG + Intronic
1042190804 8:66185266-66185288 ACCCTGGAAGGAAGGCTGCTTGG - Intergenic
1042266771 8:66916536-66916558 GTGCTGGCACGAAGGCTGCTAGG - Intronic
1044290855 8:90467697-90467719 ATCCTGAAAGAAATGCTGCTAGG + Intergenic
1046759733 8:118008989-118009011 CTCCTGGCAGTTCTACTGCTTGG - Intronic
1047787327 8:128166567-128166589 GGCCTGGGAGCAATGCTGCTGGG + Intergenic
1047878618 8:129168527-129168549 CTCCTCCCAGGGATGCTTCTGGG + Intergenic
1048357427 8:133664926-133664948 CCGCTGGCAGGAGTGCTGCTGGG + Intergenic
1048378342 8:133842724-133842746 CACATGCCAGGAATGTTGCTAGG + Intergenic
1048995870 8:139793419-139793441 TTCCTTGAAGAAATGCTGCTGGG - Intronic
1049259056 8:141629171-141629193 CACCTGGCAGGCAGTCTGCTGGG + Intergenic
1049517342 8:143067842-143067864 ATGCTGGCAGCAATACTGCTCGG - Intergenic
1049822304 8:144643128-144643150 ATACTGGCAGGAAGGCTGGTGGG - Intergenic
1052897435 9:33760816-33760838 GTCCTAGCCTGAATGCTGCTAGG - Intronic
1053297764 9:36927186-36927208 CTCTTGGCTGGGATGCTGCCTGG - Intronic
1054858872 9:69929502-69929524 CTCCTGTCAAGAAACCTGCTGGG + Intergenic
1057477535 9:95415564-95415586 ATCTGGCCAGGAATGCTGCTGGG - Intergenic
1059141859 9:111860813-111860835 CTCTTGGTAGGAATGTTGATTGG - Intergenic
1060395591 9:123314215-123314237 CTCTTGCCAGGAAAGTTGCTGGG + Intergenic
1061859616 9:133461183-133461205 CTTCTGGCAGGATTGCTGATGGG - Intronic
1061908928 9:133712697-133712719 TTCCTGCCAGGAATGATGCTGGG - Exonic
1062382203 9:136291874-136291896 CTCCTGGCAGGAAGGCAGGATGG - Intronic
1203792534 EBV:159559-159581 CGCCAGGCAGGACTGCAGCTTGG + Intergenic
1185791630 X:2931843-2931865 CTCCTTGCAGAACTGCTTCTGGG - Intergenic
1186594303 X:10964342-10964364 CTCCCAGCAGGAATGCTGGAAGG - Intergenic
1186921933 X:14291843-14291865 CCAGTGGCAGGAATGCTGCTTGG + Intergenic
1188136956 X:26503273-26503295 CCCCTGTTAGGAATCCTGCTGGG - Intergenic
1189121587 X:38400736-38400758 GCCTTGGCAGGAATGCTGCAGGG + Intronic
1189217377 X:39337710-39337732 CTCCTGGAAGGGTGGCTGCTTGG + Intergenic
1190745525 X:53320115-53320137 CTTCTGGCAAGGATGCAGCTAGG + Intronic
1191870050 X:65738229-65738251 CTCTTGGCAAGTATGCAGCTGGG - Intronic
1193719860 X:84974190-84974212 CTCCTGGAAGCACTGCTGATTGG + Intergenic
1195239674 X:102938266-102938288 CTCATGGGAACAATGCTGCTTGG + Exonic
1196044814 X:111246110-111246132 CTGCTGGGTGAAATGCTGCTGGG + Exonic
1196140426 X:112255510-112255532 TTCCTTGCAGGACTGCTGCGAGG + Intergenic
1196980138 X:121203871-121203893 CTCCAGACAGGATGGCTGCTTGG + Intergenic
1200410687 Y:2857828-2857850 CTACTGTGAGTAATGCTGCTGGG + Intronic