ID: 1129255762

View in Genome Browser
Species Human (GRCh38)
Location 15:74333151-74333173
Sequence CTCCAGAAGGGAGTTTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129255762_1129255766 -7 Left 1129255762 15:74333151-74333173 CCTCTCAAAACTCCCTTCTGGAG 0: 1
1: 0
2: 2
3: 16
4: 220
Right 1129255766 15:74333167-74333189 TCTGGAGCATTCCCTGGTCTTGG 0: 1
1: 0
2: 2
3: 14
4: 188
1129255762_1129255768 4 Left 1129255762 15:74333151-74333173 CCTCTCAAAACTCCCTTCTGGAG 0: 1
1: 0
2: 2
3: 16
4: 220
Right 1129255768 15:74333178-74333200 CCCTGGTCTTGGTGCAGCCTTGG 0: 1
1: 0
2: 4
3: 52
4: 458
1129255762_1129255771 25 Left 1129255762 15:74333151-74333173 CCTCTCAAAACTCCCTTCTGGAG 0: 1
1: 0
2: 2
3: 16
4: 220
Right 1129255771 15:74333199-74333221 GGAGAGCCCTTTTCCATCCCAGG 0: 1
1: 1
2: 0
3: 15
4: 221
1129255762_1129255772 28 Left 1129255762 15:74333151-74333173 CCTCTCAAAACTCCCTTCTGGAG 0: 1
1: 0
2: 2
3: 16
4: 220
Right 1129255772 15:74333202-74333224 GAGCCCTTTTCCATCCCAGGTGG 0: 1
1: 0
2: 3
3: 29
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129255762 Original CRISPR CTCCAGAAGGGAGTTTTGAG AGG (reversed) Intronic
906140888 1:43532637-43532659 ATCCAGAAGAGAGTTCTGACAGG + Intronic
906153220 1:43599848-43599870 CTCCAGCAGGGTCTTTTGGGAGG - Intronic
906297562 1:44658488-44658510 AGCCAGAAGTGAGTTTAGAGGGG - Intronic
906940875 1:50254046-50254068 CTCAAGTATGGAGTTTTGATAGG + Intergenic
907852371 1:58267889-58267911 CTGCAATAGGGAGTTTTGAGGGG - Intronic
908500152 1:64734835-64734857 CTCTAGAAGGGAGATCTGAAGGG + Intergenic
908690569 1:66774841-66774863 TTCCAGGAGGAAGTTCTGAGTGG - Intronic
911584030 1:99669558-99669580 CTCTAAAAGGAGGTTTTGAGGGG - Intronic
912961976 1:114204141-114204163 CTCCAGCAGGGATTTTTGACTGG - Intergenic
916423291 1:164656975-164656997 CTCCATATGGGAGTTTGAAGGGG - Intronic
917655922 1:177125543-177125565 CCCCACAAGGGAGGTGTGAGGGG - Intronic
917971500 1:180211072-180211094 CTCCAGAGGAGAGCTTTGGGTGG + Intergenic
919594773 1:199547896-199547918 CTCTTGAAGGGAGATCTGAGTGG - Intergenic
920438952 1:205965782-205965804 CAGCACAAGGGAGTTGTGAGGGG + Intergenic
921010217 1:211133889-211133911 CTCCAGAAACGTGTTTTGAGGGG + Exonic
921962338 1:221048409-221048431 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
922606019 1:226890443-226890465 CTTGAGAAGGGACTTTGGAGAGG + Intronic
923500492 1:234560013-234560035 CTCCAGAAGGGAGGAGAGAGAGG - Intergenic
924012904 1:239685521-239685543 GTCCAGAACACAGTTTTGAGAGG - Intronic
1063107844 10:3009083-3009105 CTCGAAAAGGGGGTTGTGAGGGG + Intergenic
1066083645 10:31956179-31956201 TTCCAGATGAGAGATTTGAGTGG - Intergenic
1068312751 10:55298977-55298999 GTCCAAAAGAGATTTTTGAGAGG - Intronic
1068557272 10:58472884-58472906 CTCTTGAAGGGAGATCTGAGGGG + Intergenic
1069107727 10:64404402-64404424 ATCCTGAATGGACTTTTGAGAGG - Intergenic
1069163904 10:65125224-65125246 CTCTGGAAGGGAGGTTTGACAGG + Intergenic
1069772964 10:70911070-70911092 CTCCTGAAGGGAGGCCTGAGAGG - Intergenic
1070437623 10:76409018-76409040 CTCCAGATGGTAGTAATGAGAGG - Intronic
1071001914 10:80840918-80840940 CTTCAGATGGGTTTTTTGAGTGG + Intergenic
1072102118 10:92239458-92239480 CTGGAGAAGGGCTTTTTGAGCGG + Exonic
1073224087 10:101901707-101901729 CTACAGAAGGGAGGCTTGAGAGG + Intronic
1074314760 10:112350965-112350987 CTCCAGAAGGCAGAGTTGTGTGG + Intergenic
1075228501 10:120650852-120650874 CTCTACAAGGGAGAGTTGAGTGG - Intergenic
1076091956 10:127694118-127694140 ATCCAGAGGGCAGTTTTAAGGGG - Intergenic
1076095880 10:127735175-127735197 CTCCGGAAGGGTGTTATGGGAGG + Intergenic
1076191798 10:128488387-128488409 TTGGAGAAGGGACTTTTGAGAGG - Intergenic
1077342778 11:2033380-2033402 CTCGGAAAGGGAGGTTTGAGAGG + Intergenic
1078437421 11:11337067-11337089 CTCCAGATGAGAGTTTAGGGTGG - Intronic
1080994089 11:37579556-37579578 CTCCAAGAGGGAGTTAAGAGTGG + Intergenic
1087843585 11:102945579-102945601 GTACAGAAAAGAGTTTTGAGGGG + Intronic
1090921921 11:131214397-131214419 CTCAAGCAGGGAGTTGTGGGAGG + Intergenic
1202825764 11_KI270721v1_random:88569-88591 CTCGGAAAGGGAGGTTTGAGAGG + Intergenic
1096216040 12:49797776-49797798 CTCCAGAAGGGAGTGTGATGTGG + Intronic
1096972677 12:55680625-55680647 CTCCAGAGAGGAGATCTGAGTGG + Intergenic
1101822925 12:108197696-108197718 GGCCAGAATGGAGTTTGGAGTGG - Intronic
1102234099 12:111283421-111283443 CTCTTGAAGGGAGCTCTGAGTGG + Intronic
1102238306 12:111308479-111308501 CTCCAGAAGGAATTTCTGCGTGG - Exonic
1102492201 12:113296255-113296277 CTCCAGAAGCCAGTTTGGTGAGG + Exonic
1102881404 12:116487779-116487801 CTCTTGAAGGGAGATCTGAGCGG + Intergenic
1105882370 13:24615927-24615949 GCCCAGAAGGGAGGTGTGAGGGG + Intergenic
1106025911 13:25954821-25954843 CTTCAGATGGGGTTTTTGAGTGG - Intronic
1106133203 13:26956185-26956207 GGGGAGAAGGGAGTTTTGAGAGG + Intergenic
1106723114 13:32455851-32455873 CTCCAGGTGGGACATTTGAGTGG - Intronic
1107353042 13:39536333-39536355 CTCTCGAAGGGAGATCTGAGTGG - Intronic
1107970105 13:45633307-45633329 TTCCAAAAGGGAGTTTTTACCGG + Intergenic
1108034031 13:46268743-46268765 TTCCAGAAGCAAGTTCTGAGAGG + Intronic
1110861084 13:80345140-80345162 CTCTAGAAGGGAATTGGGAGTGG + Intergenic
1112606504 13:100911923-100911945 CTCTAGAAGTGACATTTGAGAGG + Intergenic
1113827656 13:113268920-113268942 CTCCAGAATGGAGTTCTGGAAGG + Intergenic
1115125046 14:29981990-29982012 ATCCATAAGGCAGTTTTGAGTGG - Intronic
1115386962 14:32808944-32808966 CTCTAGGAGGAAGTTTTGAAAGG + Intronic
1115489682 14:33947227-33947249 CTCCAAAAGGGAGTAGCGAGCGG + Intronic
1115514222 14:34169054-34169076 CCAAAGAAGGGAGTTATGAGAGG - Intronic
1116283374 14:42939486-42939508 CTCCAGAAGGGAATTTTGGGAGG + Intergenic
1116395876 14:44448198-44448220 CCCCACAAGAGAGTTTTGTGAGG + Intergenic
1117977977 14:61317358-61317380 TTTCAGTAGGGAGTTGTGAGTGG - Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1119436368 14:74600288-74600310 CTCCTGAAGGGAGTTGCCAGTGG - Intronic
1124794476 15:32763520-32763542 CTCCACATGGGCGTCTTGAGTGG - Intergenic
1126122323 15:45264810-45264832 CTAGAGAAAGGAGATTTGAGAGG + Intronic
1126200143 15:45976111-45976133 ATCCTGAAGGGGGATTTGAGTGG + Intergenic
1127836604 15:62795598-62795620 CTCCAGAATGGAGTTCAGAAGGG - Intronic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1129383165 15:75180589-75180611 CTCAAGGAGGGAGTTCTGTGTGG + Intergenic
1130981996 15:88819052-88819074 CCCCAGAAGGCACTTTTGTGAGG + Intronic
1131608235 15:93932403-93932425 CTCCAAAAGGGAGATTTGGCTGG + Intergenic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132863021 16:2080805-2080827 CTCCAGAGGTGAGCTGTGAGGGG + Intronic
1137973059 16:53004830-53004852 CTCTAGAAGGGGGCTTTGAGAGG + Intergenic
1138204338 16:55113935-55113957 CTACAGAAGGGAGCTTAGAAAGG - Intergenic
1138616823 16:58174896-58174918 CTAGAGAAGTGAGTTCTGAGTGG + Intronic
1140160209 16:72482474-72482496 TTATAGAAGGGAGTTTGGAGTGG - Intergenic
1140240636 16:73196769-73196791 CACCAGAAGGAGGTTTTGAGAGG + Intergenic
1141615722 16:85208373-85208395 CACCAGGAGGGAGTACTGAGTGG - Intergenic
1141781325 16:86163517-86163539 CTCAAGAAGGTAGATTTGTGGGG + Intergenic
1143564728 17:7714768-7714790 GTTCTGAAGGGAGTTCTGAGGGG + Intergenic
1146329780 17:31917543-31917565 CTCCAGGAGGGGCTTTTGAACGG - Intergenic
1147131080 17:38409475-38409497 CTCCGCAAGGGGTTTTTGAGAGG + Intergenic
1147439598 17:40439847-40439869 CTCAAGAAGGCAGTGTTGAAAGG - Intergenic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1148750427 17:49942465-49942487 CTCCTGAAGGGAGTTAAGAATGG + Intergenic
1153085184 18:1278224-1278246 CTTCAGAAGGAAGTCTTGAGAGG + Intergenic
1153434926 18:5058995-5059017 TTCAAGATAGGAGTTTTGAGGGG - Intergenic
1154355955 18:13623396-13623418 CTCCAGAACGGAGCTCTCAGGGG - Intronic
1154382127 18:13862429-13862451 CTTCAGATGGGATCTTTGAGCGG + Intergenic
1157137078 18:45066641-45066663 CCCCAGAAGGCAGTGTTGGGGGG - Exonic
1159141378 18:64399473-64399495 CTCCAGATGGGAGGGTTGGGGGG - Intergenic
1165800755 19:38548184-38548206 CCCCAGAAGGGAGTGTTCACCGG + Intronic
1166330538 19:42075859-42075881 CTCCAGAGGGGAACTCTGAGCGG - Intronic
1166422762 19:42651598-42651620 TTCCAGAAGGGAGCTTTAATGGG + Intronic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1167677268 19:50895048-50895070 CTCCAGAAGTGAGTGCTGGGTGG - Intergenic
926963812 2:18387823-18387845 TTCCAGAAGTGAGTCCTGAGAGG + Intergenic
931961570 2:67488671-67488693 TTCCACCAGGGAGTTTTGATGGG + Intergenic
933475896 2:82790323-82790345 CTCCTGTAAGGAGTTTAGAGCGG - Intergenic
935202251 2:100868114-100868136 TCCCAGATGGGAATTTTGAGAGG - Intronic
936026677 2:109036034-109036056 TTCCTGAAGGGCGTTTTCAGTGG - Intergenic
937227062 2:120376045-120376067 CCCCAGGAGACAGTTTTGAGTGG + Intergenic
937370720 2:121295548-121295570 CTGCAGGTGGGAGTGTTGAGGGG + Intergenic
939248466 2:139655991-139656013 TTCCTGAAGGGATATTTGAGTGG - Intergenic
943175386 2:184466629-184466651 CTACAAAAGAGAGTCTTGAGGGG + Intergenic
944493054 2:200278013-200278035 CTCCTGAAGGGACATCTGAGTGG - Intergenic
947598718 2:231431181-231431203 CTCCAAAAGGGAGTCAAGAGTGG + Intergenic
948106906 2:235421681-235421703 ATCCAGATGGGTGTTTTTAGAGG - Intergenic
1169214017 20:3783530-3783552 GTCCAGATTGGAGTTTGGAGGGG - Intergenic
1169476899 20:5939894-5939916 CTCATGAAGGGAGATCTGAGGGG - Intronic
1170714541 20:18820509-18820531 TTCCAGATGGGAGTTGTGGGTGG + Intronic
1172941621 20:38658368-38658390 CTCCAAAAGGAAGTTCTGTGTGG - Intergenic
1177137948 21:17327120-17327142 TCCCAGCAGGTAGTTTTGAGAGG - Intergenic
1180961289 22:19763530-19763552 CTCCAGAGGCGGGTTCTGAGAGG - Intronic
1184833123 22:47003244-47003266 CTCCAGGGGTGAGTTCTGAGTGG + Intronic
949268911 3:2191493-2191515 GTACAGAAGGGAGGTTTGAGAGG - Intronic
950362692 3:12461056-12461078 CTCATGAAGGGAGTGTTGCGGGG + Intergenic
952818403 3:37465393-37465415 CACCAGGAGGGGGTTTGGAGAGG + Intronic
953207871 3:40847986-40848008 CTGCAGCAGGGAGTCTGGAGGGG + Intergenic
953629448 3:44600588-44600610 CTCCAGAAGGTAGGTTTGAGAGG + Intronic
953809238 3:46097587-46097609 CTGGAGAAGGGATTTCTGAGCGG + Intergenic
954701009 3:52450956-52450978 CTGCAGAAGGCAGTGTGGAGCGG + Intergenic
954736814 3:52714378-52714400 CAGCAGAAGGGAGGTGTGAGCGG + Intronic
956050555 3:65243741-65243763 CTACAGAAGGAACTTTTGAGAGG - Intergenic
956382945 3:68685620-68685642 CTCCAGATGGGGTTTTTGTGTGG + Intergenic
956544342 3:70383577-70383599 CTCCAGGAGGAATTTCTGAGTGG - Intergenic
959337749 3:105087516-105087538 CTCCTGAAGGGAGATCTGACAGG - Intergenic
960324370 3:116277179-116277201 CTCCAGTAGGGAGTTTCATGTGG + Intronic
960380863 3:116959979-116960001 ATCCAGGAGGGAGGTTTAAGTGG + Intronic
960621593 3:119642272-119642294 CTCCTGAAGGAAGGTTTGTGAGG + Exonic
961026674 3:123564482-123564504 CTCCAGGAGGGAGTCATCAGCGG + Intronic
961983968 3:131112909-131112931 CTCCACAAGAGCTTTTTGAGTGG + Intronic
962002292 3:131310998-131311020 ATCCACAGGGGAGTTATGAGAGG - Intronic
962910567 3:139845531-139845553 CTCCAGAAGGGCTGTTTTAGGGG - Intergenic
963691482 3:148508457-148508479 TTCCAGAAGAGAGATTTGGGTGG + Intergenic
963875189 3:150467573-150467595 CCCCAGAAGGGAGTTCCAAGAGG + Intergenic
963875467 3:150469952-150469974 CCCCAGAAGGGAGTTCTACGAGG + Intergenic
964477139 3:157107354-157107376 CTCCAGATGGCAGTTATGAGTGG - Intergenic
965377451 3:167942841-167942863 CTCCAAAAGTGAGTATTGATAGG - Intergenic
966926917 3:184650555-184650577 CTGCAGGAGGGAGCCTTGAGAGG + Intronic
967171255 3:186825181-186825203 CTCCAGACGGGACTTGGGAGCGG - Intergenic
968230311 3:197001949-197001971 TTTCAAAAGGGAGTTTTGTGCGG - Exonic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
969970918 4:11047421-11047443 CTTCAGATGGGATTTTTGTGTGG + Intergenic
971506335 4:27370069-27370091 CCCCTGAAGGGAGCTCTGAGGGG + Intergenic
972152970 4:36118412-36118434 CTCCAGAAGACAGTTTTAAATGG + Intronic
973364276 4:49195822-49195844 CTTTTGAAGGGAGTTTTCAGTGG + Intergenic
974265652 4:59583427-59583449 CTTCAGATGGGATCTTTGAGTGG + Intergenic
975563394 4:75728429-75728451 CTCCAGAAAGGAGTTTGGCCAGG - Intronic
975611261 4:76205980-76206002 ATCAACAAAGGAGTTTTGAGGGG - Intronic
976357984 4:84142817-84142839 CTGCACAAGGGAGATGTGAGGGG + Intergenic
976570117 4:86597547-86597569 TTACAGACGGGAGTTTTGATGGG - Intronic
979346216 4:119590523-119590545 CTCTAGAAGGGAGTAGGGAGAGG + Intronic
979981477 4:127261299-127261321 CACCAAAAGGGAATTTTGATCGG - Intergenic
981482558 4:145253842-145253864 CTCCAAAAGGGAGTCAAGAGTGG + Intergenic
981563004 4:146067405-146067427 CTCTTGAAGGGAGTTCTGAATGG - Intergenic
982302736 4:153896913-153896935 TACCTGAAGGGAGTTTTTAGGGG - Intergenic
984457958 4:179995186-179995208 CTCCAGAAGTGAGTTAGGTGCGG + Intergenic
984589399 4:181600575-181600597 CTCCCTTAGGCAGTTTTGAGAGG - Intergenic
984618752 4:181928001-181928023 CTTCAGAAGGGGTTTTTGTGTGG - Intergenic
986267893 5:6206047-6206069 CTCCACAATGGAGCTTTGACTGG + Intergenic
987236175 5:15944114-15944136 CTCCAGAAGAAGGCTTTGAGAGG - Intergenic
989747853 5:44852760-44852782 GTACAGGAGGAAGTTTTGAGGGG - Intergenic
990089269 5:52021166-52021188 CTGCAGAAGGTTCTTTTGAGGGG - Intronic
991956529 5:72000414-72000436 CTCTTGAAGAGAGATTTGAGTGG - Intergenic
992492215 5:77255986-77256008 CTGTAGAAGTGAGTTTTGGGTGG + Intronic
993183804 5:84589532-84589554 CTGCAGAAGGAGGATTTGAGAGG - Intergenic
993744470 5:91579729-91579751 CTCTATAAGGGAGCTTTCAGGGG + Intergenic
993911661 5:93690998-93691020 CTTCAGAAGGGGTTTTTGTGTGG - Intronic
995807765 5:116072961-116072983 CTCCAGAAGGGAATATGTAGAGG - Intergenic
996245890 5:121263434-121263456 ATGCAGAAGGGAGGTTGGAGGGG + Intergenic
996591496 5:125152927-125152949 CGGGAGAAGGGAGTTGTGAGTGG + Intergenic
1001274325 5:170339318-170339340 CTCCAGCAGGGAGGTCTGCGGGG - Intergenic
1001650155 5:173310286-173310308 CTGGAGAAGGGAGGTCTGAGCGG + Intergenic
1003276788 6:4660668-4660690 CGCCAGAAGGGAGTTGGCAGGGG - Intergenic
1005010164 6:21328433-21328455 CTCCAAAAGTGAGTTTTTAAAGG - Intergenic
1006592435 6:35168435-35168457 ATCCAGAAGAGAGTCTTGATGGG - Intergenic
1007325386 6:41055510-41055532 CTCCAGGAGGGAGTCCTGGGGGG - Intronic
1007858251 6:44879901-44879923 CTTCAGATGGGGCTTTTGAGTGG - Intronic
1010063635 6:71654446-71654468 CTCCAGAAAGTAGTTTAGTGTGG - Intergenic
1011848079 6:91590935-91590957 CTACAGAAGGGGTTTTTGTGTGG - Intergenic
1013242840 6:108261521-108261543 CTCCAGAAAGGCATTTTCAGGGG - Intergenic
1013806530 6:114002148-114002170 TTCCAGAATGGAGTTATCAGTGG + Intronic
1014400340 6:120981269-120981291 CTCTGGAAGTGAGTTTTGATAGG + Intergenic
1014760642 6:125352956-125352978 CTCCAGAAGGCACTTTAGAAAGG - Intergenic
1017751750 6:157495147-157495169 CTACAGATGGAAGCTTTGAGGGG - Intronic
1018818726 6:167356240-167356262 CTCCTGAAGGGAGTCTCGGGTGG - Intronic
1019863914 7:3686992-3687014 CTCAAGAAGGGAGATCTGAGTGG + Intronic
1022859730 7:34355299-34355321 CTCCAGAAAGGGGATTTCAGAGG - Intergenic
1023532520 7:41173164-41173186 CTCAAGAATGGTGGTTTGAGGGG - Intergenic
1024011907 7:45274301-45274323 CCCAGGAAGGCAGTTTTGAGAGG - Intergenic
1026792933 7:73346497-73346519 CCCCAGGAGGGAGTTGTGAGAGG + Intronic
1027582990 7:80021097-80021119 CTTCAGATGGGGTTTTTGAGTGG - Intergenic
1030015521 7:105216424-105216446 CTCCTGAAAGGAGTTTTTGGGGG - Intronic
1032324385 7:130913458-130913480 GAACAGAAGGGAGTTTTAAGAGG - Intergenic
1032811551 7:135424224-135424246 GTGGAGAAGGAAGTTTTGAGAGG - Intronic
1033883592 7:145917156-145917178 CTCCAGCAAGGAGTTGAGAGTGG + Intergenic
1034012033 7:147539475-147539497 CTCCAGAAGGTACTAGTGAGTGG - Intronic
1035868244 8:3108704-3108726 CCCCAGCTGGGAGTTTTCAGTGG - Exonic
1037422740 8:18721160-18721182 AGCCAGAAGTGAGTTTTCAGGGG - Intronic
1037521873 8:19688051-19688073 CTTCAGAGGGATGTTTTGAGAGG - Intronic
1037903910 8:22704141-22704163 CTCCAGAAGGGAGAGTTGGGGGG - Intergenic
1038211688 8:25524017-25524039 CTTCAGACGGGGTTTTTGAGTGG - Intergenic
1039335341 8:36582870-36582892 CTCAAGGAGGGAGTTGTCAGAGG + Intergenic
1039585294 8:38702147-38702169 CTGCAGAATGGGGATTTGAGAGG + Intergenic
1041323207 8:56636501-56636523 CTTCAGATGGGATTTTTGTGTGG + Intergenic
1041520019 8:58745689-58745711 TTCCAGAAGGGACTTTTGCAGGG + Intergenic
1041535980 8:58926002-58926024 CTCCAGAAGAGAGTTTAGTCCGG - Intronic
1042963952 8:74330919-74330941 CTCCTGAAGGAAGATCTGAGTGG - Intronic
1044265320 8:90174986-90175008 CTCCTAAAGGGAGTTGTTAGAGG + Intergenic
1044665363 8:94629096-94629118 CTCCAGGAGAGAGTTCTGGGTGG + Intergenic
1048065629 8:130965327-130965349 CTCCAAAAGGGAGGATGGAGGGG + Intronic
1049526581 8:143129894-143129916 CTCCAGAAGGGACATTAGACTGG + Intergenic
1049766400 8:144357270-144357292 CTCCAGCAGGGAGGTATCAGAGG - Intronic
1053637631 9:40028519-40028541 ATGAAGAAGGAAGTTTTGAGTGG - Intergenic
1054724227 9:68634278-68634300 CTGCAGAGGGGAGTGCTGAGTGG - Intergenic
1054852382 9:69861345-69861367 CTGCAGAAGGGAGATTGAAGAGG - Intronic
1058111913 9:101039875-101039897 TTCAAGAAGGGATTTTTGTGGGG + Intronic
1059903520 9:118955295-118955317 CTCTACCAGAGAGTTTTGAGTGG - Intergenic
1061145097 9:128793007-128793029 CTCCTGAAGGAAAATTTGAGGGG + Intronic
1187480525 X:19650835-19650857 CTCCAGAATGGTGTGCTGAGGGG + Intronic
1188872944 X:35397155-35397177 GTTCAGAAGGTAGTTTTGACTGG + Intergenic
1191952904 X:66613979-66614001 CTCCAGAACGGATTCTTGATTGG + Intronic
1192594230 X:72389348-72389370 CTCCATTATGGAGTTTTGTGAGG + Intronic
1195585834 X:106564695-106564717 GGAAAGAAGGGAGTTTTGAGAGG - Intergenic
1198724005 X:139657084-139657106 CTCCAGTAGGGTGTTTTTAAGGG - Intronic
1199427330 X:147718022-147718044 TTCCAGAAGGAAGATTGGAGGGG - Intergenic
1199592822 X:149483585-149483607 ATCCAGAAGGGAGTAATGTGTGG - Intronic
1199664200 X:150083628-150083650 ACCCAAAAGGGAGTTTTGAAAGG - Intergenic
1199755104 X:150856324-150856346 CTACAGAACGGAGGTCTGAGAGG + Intronic
1202169103 Y:22021997-22022019 CTACAAGAGGGAGTTTTGACCGG + Intergenic
1202222258 Y:22564371-22564393 CTACAAGAGGGAGTTTTGACCGG - Intergenic
1202320857 Y:23631290-23631312 CTACAAGAGGGAGTTTTGACCGG + Intergenic
1202549910 Y:26038766-26038788 CTACAAGAGGGAGTTTTGACCGG - Intergenic