ID: 1129258071

View in Genome Browser
Species Human (GRCh38)
Location 15:74345475-74345497
Sequence CAGAGGGAGTGGAGGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1351
Summary {0: 1, 1: 1, 2: 10, 3: 124, 4: 1215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129258071 Original CRISPR CAGAGGGAGTGGAGGGGAGT TGG (reversed) Intronic
900037376 1:427460-427482 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900059006 1:663201-663223 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900372481 1:2338087-2338109 CTGAGTGAGTGGAGGGGCGCTGG + Intronic
900606351 1:3525323-3525345 CAAAGGCGGTAGAGGGGAGTAGG + Intronic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
901033349 1:6321429-6321451 GAAAGGGAGTGGAGTGGAGTGGG - Intronic
901095525 1:6676201-6676223 AAGGGGGAGTGGTGGGGACTGGG + Intronic
901130928 1:6962371-6962393 GAGGGGGAGTGGAAGGGAGGAGG - Intronic
901167244 1:7229496-7229518 CAGAGGAAGCGGAGAGGAGGTGG + Intronic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902183255 1:14705758-14705780 TAGAGGCAGAGAAGGGGAGTAGG + Intronic
902193544 1:14780970-14780992 CAGAGGGTGCCGAGTGGAGTGGG + Intronic
902440861 1:16429053-16429075 GAGAGGGCCTGGAGGGGAGGAGG - Intronic
902534570 1:17112117-17112139 CAGAGGAAGTGGGGAGGAGGTGG + Intronic
902634881 1:17728697-17728719 CAGAGGCAGGGGATGGAAGTAGG - Intergenic
902714282 1:18261757-18261779 CAGAGGAAGTGGAGGGACTTGGG + Intronic
902821602 1:18946745-18946767 CAGAGGCAGGGGAGGGAACTGGG - Intronic
902833212 1:19030702-19030724 GGGAGGGAGGGGAGGGGAGGGGG + Intergenic
902864452 1:19269146-19269168 CTGAAGGAATGCAGGGGAGTAGG + Intergenic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903216721 1:21847520-21847542 GAGAGGGAGTGGAGGGACGCTGG + Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903867625 1:26410678-26410700 GAGAGGGAGGGGAGGGGAGGGGG + Intergenic
904354179 1:29927794-29927816 CAGAGGGTGGGGAGGGGAAGTGG - Intergenic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
904836470 1:33340719-33340741 GAGAGGGAGTTGCGGGGAGGAGG + Intronic
904946301 1:34201050-34201072 GGGAGGGATTGGAGGGGAGGGGG + Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905322560 1:37128306-37128328 CTCATGGAGTGGCGGGGAGTGGG - Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905615855 1:39398122-39398144 AAAAAGGAGTGGCGGGGAGTGGG - Intronic
905731815 1:40303521-40303543 GACAGGGCGTGGAGGTGAGTCGG - Exonic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
905892692 1:41527177-41527199 GAGTGGGAGTGAAGGTGAGTGGG - Intronic
906038898 1:42771047-42771069 AATAGGGAGTGGTGGGGAATTGG - Intronic
906187366 1:43871826-43871848 GTGAGGGAGAGGAGGGGTGTGGG + Intronic
906256599 1:44355251-44355273 CAGAGTGCGCGGAGGTGAGTCGG - Intronic
906260121 1:44380621-44380643 CAGAGAGCCTGGAGGGCAGTGGG - Intergenic
906264987 1:44421792-44421814 CAGTGGGAGAGGTGGGGAGTAGG + Intronic
906343104 1:44998012-44998034 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
906606256 1:47174460-47174482 CAGTGTGTGTGGAGGGGCGTGGG - Intergenic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
906685198 1:47758700-47758722 CATCGGGTGTGGTGGGGAGTGGG + Intergenic
906986263 1:50686605-50686627 GGGAGGGAGGGGAGGGGAGCGGG + Intronic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907323066 1:53617884-53617906 CAGAGTGAGTGGGGGTGAGCAGG + Intronic
907324437 1:53627756-53627778 GAGAGGAGGTGGAGGGGAGGAGG + Intronic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908082750 1:60598453-60598475 AAAAGGGAGGGGAGGGGAGGGGG + Intergenic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
908829293 1:68163555-68163577 GAGGGGGAGTGGTGGGGAGCTGG - Intronic
908960782 1:69694735-69694757 AAGAGGAAGTGGGGGGGGGTAGG - Intronic
908963980 1:69735801-69735823 GATAGGGAGGGGAAGGGAGTGGG - Intronic
909059180 1:70860041-70860063 TAGAGTGGGTGGGGGGGAGTGGG + Intronic
909099936 1:71337525-71337547 AAGAGAGAGGGGAGGGGAGAGGG - Intergenic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909951135 1:81721781-81721803 CTGAGGGAGTGGGTGGGAGCAGG + Intronic
910191295 1:84598689-84598711 GAAATGGAGTGGAGGGGAATTGG - Intergenic
910214358 1:84828003-84828025 AAGAGGGGGTGGAGGGGAGGAGG + Intronic
910275670 1:85446680-85446702 GAGAGGGAGAGGAAGGGAGGTGG - Intronic
910631648 1:89361894-89361916 CAGAGAAAGTGGCGGGGTGTGGG - Intergenic
910772124 1:90841490-90841512 GAGAGAGAGGGGAGAGGAGTGGG + Intergenic
910777709 1:90892548-90892570 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912560999 1:110551490-110551512 AAGAGGGAGTGGGAGGGAGGAGG + Intergenic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913608871 1:120491755-120491777 CAGAGGGAGGGGAGGACAGGGGG - Intergenic
913682621 1:121200992-121201014 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
913966861 1:143383747-143383769 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914034464 1:143988621-143988643 CAGAAGTAGAAGAGGGGAGTAGG - Intergenic
914061237 1:144209354-144209376 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914117913 1:144757015-144757037 CTGAGGGACTGGATGGGAGGGGG - Intergenic
914154988 1:145079349-145079371 CAGAAGTAGAAGAGGGGAGTAGG + Intronic
914204958 1:145518696-145518718 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914370610 1:147021532-147021554 CAGAGGGAGGGGAGGATAGGGGG - Intergenic
914484080 1:148091878-148091900 CAGAGGGAGGGGAGGACAGGGGG + Intergenic
914582322 1:149030083-149030105 CAGAGGGAGGGGAGGACAGGGGG + Intronic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
914912533 1:151799408-151799430 GACAGGGAGAGGAGAGGAGTCGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915691560 1:157695924-157695946 GGGAGGGAGGGGAGGGGGGTGGG - Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915878817 1:159643453-159643475 GAGGGGGAGGGGAGGGGAGCGGG + Intergenic
916006372 1:160664901-160664923 CAGAGGAAGTGGAGAGGGGTTGG - Intergenic
916019185 1:160777746-160777768 CCAAGGGAGTGCAAGGGAGTGGG - Intergenic
916142396 1:161711121-161711143 CAGAGAAAGTTTAGGGGAGTAGG + Intronic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916812685 1:168319308-168319330 GGGAGGGGGTGGAGGTGAGTAGG - Intergenic
917105003 1:171483319-171483341 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
917120136 1:171638453-171638475 CAGAGGGAGGGGAGGAGAAGAGG - Intronic
917547142 1:175982862-175982884 CAGAGGTGGGGGATGGGAGTGGG + Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
918687868 1:187442224-187442246 CAGAAGGGGAGGGGGGGAGTTGG - Intergenic
919583062 1:199400981-199401003 AGGGGGGAGGGGAGGGGAGTTGG + Intergenic
919605889 1:199683370-199683392 CAGAGGTGGTGATGGGGAGTAGG + Intergenic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920304875 1:205012227-205012249 CAGAGGAAGTGGAGGAAAGGGGG + Intronic
920469933 1:206219510-206219532 CAGAAGTAGAAGAGGGGAGTAGG - Intronic
920660818 1:207912718-207912740 CTGAGGAAGTTGAGGGGAGTGGG - Intergenic
920727517 1:208450066-208450088 CAGAGGGAGTGGAGGAGGTAGGG + Intergenic
920808260 1:209255522-209255544 GAGAGGGAGTAATGGGGAGTTGG - Intergenic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
921254889 1:213330168-213330190 CAGATGGATGGGAGGGGAGATGG - Intergenic
921524480 1:216200742-216200764 GATAGGGAGTGGAGGTGATTAGG + Intronic
921794792 1:219329893-219329915 CAGAGGGGGTGGGGGCGAGGAGG - Intergenic
921798800 1:219378551-219378573 CAAAGGTAGTGGAGGTGAGTAGG + Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922061962 1:222101367-222101389 CTGAAGGAGTGGAGCGGAGGTGG - Intergenic
922765502 1:228154516-228154538 CAGAGGGTGTGGGAGGGAGAGGG - Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923051636 1:230394569-230394591 CACAAGGAGAGGAGGGGAGGGGG - Intronic
923051653 1:230394628-230394650 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051685 1:230394741-230394763 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923213922 1:231831840-231831862 GAGAGGTAGTGGGGGGGGGTGGG + Intronic
923534449 1:234838213-234838235 GAGGGGGAGGGGAGGGGAATGGG + Intergenic
923534463 1:234838235-234838257 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
923573705 1:235139989-235140011 CCCAGGGAGTGGAGGTCAGTGGG - Intronic
923602076 1:235412166-235412188 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602093 1:235412193-235412215 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923602103 1:235412209-235412231 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
923719751 1:236456718-236456740 CAGAGGGAGTGAGGGGGAGGGGG - Intronic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924328674 1:242921177-242921199 GGGAGGGAATGGAGGGGAGGAGG + Intergenic
924415044 1:243849983-243850005 CGGAGGGAGTGGAGGCCAGGCGG + Intronic
924473146 1:244361083-244361105 CAGAGGCTGGGAAGGGGAGTGGG + Intronic
924552232 1:245089540-245089562 CAGATGTAGTGGAGAGGAGAGGG + Intronic
924558223 1:245135291-245135313 CAGAGGCTGGGAAGGGGAGTAGG - Intergenic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
1062812378 10:476653-476675 GAGAGGGTGTGGAGGGGCCTGGG - Intronic
1062935098 10:1379661-1379683 CAGAAGTAGAGGAGGGGAGGAGG + Intronic
1063112331 10:3047870-3047892 CAGAGAGAGAGGGGGAGAGTGGG - Intergenic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1063603311 10:7501156-7501178 GAGGAGGAGTGGAGTGGAGTCGG + Intergenic
1063604672 10:7512214-7512236 CACAGACAGTGGAGGGGAGATGG + Intergenic
1063982708 10:11468633-11468655 GCGTGGGAGTGGAGGGGAGGAGG + Intronic
1064114752 10:12568302-12568324 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1064114774 10:12568346-12568368 GAGGGGGAGAGGAGGGGAGGGGG - Intronic
1064405554 10:15059135-15059157 GAGAGGGAGGGAAGGGGAGAGGG - Intronic
1065301731 10:24328283-24328305 GAGAGGTAAGGGAGGGGAGTTGG + Intronic
1065444711 10:25786564-25786586 TAGAGTGAGTGGAGAGGACTGGG - Intergenic
1065764851 10:29019010-29019032 CAGAGGCTGGGGAGGGTAGTGGG + Intergenic
1066334525 10:34462900-34462922 AAGGGGGAGAGGAGGGGAGAGGG + Intronic
1066660692 10:37736480-37736502 CAGAGGGAGAGGAAGAGAGAGGG + Intergenic
1067291494 10:44946663-44946685 CTGAGAGAGGGTAGGGGAGTGGG + Intergenic
1067370888 10:45680599-45680621 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067388889 10:45845546-45845568 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067417173 10:46111402-46111424 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067445372 10:46339004-46339026 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067473270 10:46550759-46550781 GGGAGGGAGTGGAGTTGAGTTGG + Intronic
1067476752 10:46572489-46572511 CAGAGGAAGGGAAGGGGATTTGG + Intergenic
1067502588 10:46818296-46818318 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067508848 10:46878348-46878370 GAGAGGAGGTGGAGGGGAGGGGG + Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067592001 10:47521727-47521749 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067639118 10:48029798-48029820 CAGAGGCAGGGGATGGGAGCCGG - Intergenic
1067653401 10:48173502-48173524 GAGAGGAGGTGGAGGGGAGGGGG - Intronic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1067874365 10:49990497-49990519 CAGAGGCAGGGGATGGGAGCCGG + Intronic
1068710684 10:60130207-60130229 CAGAGCTGGGGGAGGGGAGTGGG - Intronic
1069814827 10:71187100-71187122 GAGAGGGAGAGGAGAAGAGTGGG - Intergenic
1069850574 10:71401659-71401681 AATAGGGAGTGGTGGGGACTGGG + Intronic
1069949620 10:72009942-72009964 CAGAGGGAGAGGACAGGAGGAGG + Exonic
1070136108 10:73695955-73695977 CAGAGGCAGGGGATGGGAGCTGG - Intronic
1070191106 10:74112676-74112698 CAGTGGGAGGGAATGGGAGTGGG + Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071527139 10:86365423-86365445 GAGGGGGAGTGGGTGGGAGTTGG - Intronic
1071547337 10:86538498-86538520 CAGGGGGAGTGGGGGAGAGTGGG - Intergenic
1071702540 10:87955596-87955618 GAGAAGGAGTGGTGGGGAGAAGG + Intronic
1072030431 10:91515930-91515952 GAGAGGGAGTAGAGGGGGATTGG - Intergenic
1072502210 10:96028964-96028986 CAGAGGCTGGGAAGGGGAGTGGG + Intronic
1072554814 10:96506704-96506726 CACAGCGAGAGGAGAGGAGTGGG - Intronic
1072732027 10:97852692-97852714 GAGAGGGAGAGGAAGGGGGTGGG + Intronic
1073037509 10:100574645-100574667 GAGAGGGAGGGTAGGGGAGAGGG - Intergenic
1073122461 10:101131180-101131202 GCGAGGGAGGGGAGGGGAGGGGG - Exonic
1073140397 10:101243420-101243442 GAGAAGGAGTGGAGGGGATGAGG + Intergenic
1073444973 10:103575163-103575185 GAGAGGGAGGGGCGGGAAGTGGG - Intronic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1073559921 10:104487900-104487922 GAGAGGGAGGGCAGGGGAGGGGG - Intergenic
1073592190 10:104767795-104767817 AAGAGGGAGGGGAAGGGAGAAGG - Intronic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074326356 10:112455270-112455292 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1074765142 10:116694932-116694954 GAGAGGGAAGGGAGGGGACTGGG - Intronic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075105585 10:119538156-119538178 GGGAGGGAGTGGAGGAGAGAGGG + Intronic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075698708 10:124454447-124454469 CAGAGGGAGTGGGGGGGAGGGGG + Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076405944 10:130212666-130212688 CAGTGGGAGGGGAGGGGAAGGGG - Intergenic
1076533411 10:131160403-131160425 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1076533425 10:131160445-131160467 CAGAGGGAGTGGCGGGGTGTAGG - Intronic
1076715860 10:132363388-132363410 CAGAGGAGGTGGAGGCGACTAGG - Intronic
1076843010 10:133055846-133055868 CAGAGGGAGGGGAGTGGATGGGG + Intergenic
1076964102 11:65383-65405 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1076981431 11:207030-207052 CACAGGGGGCGGCGGGGAGTGGG + Intronic
1077136837 11:1004005-1004027 CAGAGGGGGTGGCGGGGAGGTGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077395708 11:2320090-2320112 CAGTGCTAGTGGAGGGGAGTGGG + Intergenic
1077544189 11:3161970-3161992 GAGAGGGAGGGGAGGGGAGGGGG + Intronic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1077923203 11:6656165-6656187 CTGAGGGAGAAGAGGGGAATAGG - Intergenic
1077960400 11:7071108-7071130 CAGAGAAAGTGGAGGGCTGTAGG + Intronic
1078182911 11:9027538-9027560 CAGAAGATGTGGAGGGGAGCTGG - Exonic
1079117402 11:17648898-17648920 GAGCGGGAGTGGAGGTGAGGTGG - Intergenic
1079403022 11:20121426-20121448 GAGAGAGAGAGGAGGGGAGGAGG - Intronic
1079627993 11:22638957-22638979 GTGAGGTAGTGGAGTGGAGTTGG - Intronic
1079995760 11:27293574-27293596 GAGAGGGAAGGGAGGGGAGGCGG + Intergenic
1079995779 11:27293618-27293640 GAGGGGGAGGGGAGGGGAGGCGG + Intergenic
1080483187 11:32674324-32674346 GAGAGGGATTGGAAGGGAGTGGG + Intronic
1080650620 11:34220059-34220081 CAGAGGGACTGAAGGGGTGGAGG + Intronic
1080831084 11:35893974-35893996 CAGAGAGAGGGTAGGGGAGCAGG - Intergenic
1081105369 11:39060892-39060914 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1081483314 11:43508284-43508306 CACAGGAAGGGGAGGGGATTAGG + Intergenic
1081731836 11:45377205-45377227 GAGAGGGAGGGGAGGTGAGAGGG - Intergenic
1081743635 11:45457994-45458016 CAGAGGGAGTGGATGAATGTGGG + Intergenic
1082009805 11:47442273-47442295 CAGATGGATTGGAAGGGAGTGGG + Intronic
1082029555 11:47594427-47594449 GAGGGGGAGAGGAGGGGAGTAGG + Exonic
1082739007 11:56889853-56889875 CAGAGGGTGGGAAGGGTAGTGGG - Intergenic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083293252 11:61701378-61701400 CAGAGGGAGAGGCGGGCAGCAGG - Intronic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083894083 11:65611533-65611555 CAGGGGAACTAGAGGGGAGTAGG + Intronic
1083911579 11:65713045-65713067 CAGAGAGAGAGGTGGTGAGTAGG + Exonic
1083926283 11:65809031-65809053 CGGAGGGAGGGCAGGGGAGGAGG - Intergenic
1083960544 11:66012681-66012703 CAGACGGGGTGGGGGGGGGTGGG - Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084088761 11:66866698-66866720 AAGGGGGAGTTTAGGGGAGTGGG - Intronic
1084104892 11:66975015-66975037 AAGGGGGAGGGGAGGGGAGAAGG + Intergenic
1084358518 11:68654540-68654562 CAGAGGGTGTAGTGGGAAGTGGG - Intergenic
1084388014 11:68856122-68856144 GAGGGGGAGTGGAAGGGTGTGGG - Intergenic
1084460222 11:69292990-69293012 CAGCTGTAGTGGAGGGGAATTGG - Intergenic
1084515812 11:69637536-69637558 CAGACCAAGTGGTGGGGAGTAGG - Intergenic
1084545746 11:69814258-69814280 CAGAGGGAGGTGAGGTGTGTGGG + Intronic
1084560301 11:69901509-69901531 AAGGGGGAGTGGATGAGAGTTGG - Intergenic
1084578448 11:70006443-70006465 CAGAGGTAGGGGAGGTGGGTGGG - Intergenic
1085012772 11:73152824-73152846 CACTGGGAGGGGTGGGGAGTAGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085409631 11:76283442-76283464 GAGAGGGAGTGGAAGCGTGTGGG + Intergenic
1085991153 11:81846221-81846243 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1086419317 11:86622836-86622858 CAGGGGGAGTGGTTGGGAATAGG - Intronic
1086813157 11:91335710-91335732 CAGAGGGAGTGGAAAGTAGCAGG - Intergenic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1087360955 11:97158724-97158746 CAGAGGGAGGGGGGGTGACTGGG - Intergenic
1087736940 11:101844703-101844725 GGGAGGGAGGGGAGGGGAGTGGG + Intronic
1088078990 11:105886493-105886515 CAGAGGCAGGGAAGGGTAGTGGG - Intronic
1088116035 11:106315916-106315938 CAGAGAGGAAGGAGGGGAGTTGG - Intergenic
1088596410 11:111444246-111444268 CAGAGAGAGAGGAGAGGAGAGGG + Intronic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089301229 11:117499901-117499923 CCGAGGGTCTGGATGGGAGTCGG - Intronic
1090137876 11:124217971-124217993 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1090242910 11:125196575-125196597 CAGAGGCAGTGCAGGGGAGGAGG + Intronic
1090344603 11:126059507-126059529 CAGAGGGAGTGGAGCAGAGCGGG - Intronic
1090620265 11:128554202-128554224 CAGAGGGAGTATAGGACAGTGGG + Intronic
1090809254 11:130222223-130222245 CAGAAGAAGGGGATGGGAGTAGG - Intergenic
1090898203 11:130999381-130999403 GAGAGGGAGAGGAGGAGAGGAGG + Intergenic
1090933325 11:131319400-131319422 GAGAAGGAGGGGAGGGGAGGGGG - Intergenic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1091140031 11:133227104-133227126 CAGAGGGTGTGCAGGGGCGAAGG - Intronic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1092061733 12:5556566-5556588 CAAAGGAAGTGCAGGTGAGTAGG + Intronic
1092092490 12:5814248-5814270 CAAAGGGATTGGCAGGGAGTTGG - Intronic
1092095842 12:5841311-5841333 CAGGTGGGGTGGAGGGGAATGGG - Intronic
1092205683 12:6613232-6613254 GAGAGGAAATGGAGGGGAGGGGG + Intergenic
1092236614 12:6814584-6814606 AAGAGAGAGAGGAGGGGAGAGGG + Intronic
1092531600 12:9349719-9349741 CAGGAGGTGTGGAGGGGAATGGG + Intergenic
1092604243 12:10101497-10101519 CACAGGGAGTGGGGAGTAGTAGG - Intronic
1092758591 12:11788628-11788650 AAGAGTGAAGGGAGGGGAGTGGG - Intronic
1092817263 12:12322979-12323001 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092817333 12:12323108-12323130 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1092902093 12:13069587-13069609 CAGATGGAGTGCAGGCGAGCTGG + Intronic
1092937320 12:13376215-13376237 CAGAGGCTGTGGAGGTGAGTGGG - Exonic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1093126185 12:15331056-15331078 GAAAGGGAGTGAAGGGCAGTGGG + Intronic
1093917796 12:24824909-24824931 CAGAGGCCGAGAAGGGGAGTGGG - Intronic
1094058820 12:26292141-26292163 GAGTGGCAGTGGAGTGGAGTGGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095810984 12:46372911-46372933 CAGAGGGAGGGGCAGGGAGGCGG - Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096104174 12:48986875-48986897 CAGAGAGTGGGGAGGTGAGTGGG - Intergenic
1096155133 12:49337301-49337323 GTGGGGGAGTGGAGGGGAGGCGG - Intergenic
1096213831 12:49787681-49787703 CAGAGCCAGTGGAGGAGAGGAGG - Intergenic
1096254868 12:50056831-50056853 CAAAGGGAGTGAAGGGGACAGGG - Intergenic
1096409480 12:51366661-51366683 CAGAGGTAGTGCTGGGGTGTGGG + Intronic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096514400 12:52148186-52148208 CAGAGGCAGTGGAGGGGCCTGGG - Intergenic
1096668194 12:53180923-53180945 AAGGGGGAGGGGAGGGGAGGAGG + Intronic
1096828059 12:54294520-54294542 CAGAGGGACTGAAGAGGAGAAGG - Intronic
1096836329 12:54353541-54353563 GAGAGGGAGAGGAGTGGAGGAGG - Intergenic
1097008980 12:55939115-55939137 AAGAGGCAGTGGAGAGGTGTTGG + Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097676179 12:62603910-62603932 TAGAAGGAATTGAGGGGAGTGGG + Intergenic
1098377957 12:69837462-69837484 CCGGGGGAGTGGAGAGGAATTGG + Intronic
1099243571 12:80167250-80167272 CCGTGGGAGTGGTGGGGAGGTGG + Intergenic
1099944277 12:89225996-89226018 CAGAGGGAGAGGAAGAGAGAGGG - Intergenic
1100144470 12:91660518-91660540 CAGAGGTAGATGAGGGGAGGGGG + Intergenic
1100309109 12:93378020-93378042 CGGAGGGAGCGGAGGCGAGCGGG + Exonic
1100535319 12:95503438-95503460 GTGAGGGAGTGGAGGGGAAAGGG + Intronic
1100591707 12:96035793-96035815 CTGAAGAAGAGGAGGGGAGTAGG + Intronic
1100594518 12:96060526-96060548 GAGGGGGAGTGCAGGTGAGTGGG + Intergenic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1100958119 12:99931918-99931940 CAGAGGCTGGGAAGGGGAGTAGG - Intronic
1101319597 12:103661878-103661900 AAGAGAGAGAGGAGGAGAGTGGG + Intronic
1101676588 12:106922440-106922462 CAGAGGGTGGGAAGGGCAGTGGG - Intergenic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102491461 12:113291826-113291848 CAGAGGCAGGGGAGGAGGGTGGG - Intronic
1102626570 12:114239976-114239998 CAGGGGGCGTGAAGGGGAGGGGG - Intergenic
1102877054 12:116456966-116456988 AGGAGGGAAGGGAGGGGAGTAGG + Intergenic
1103043936 12:117719589-117719611 AATAGGGAATGGTGGGGAGTGGG - Intronic
1103167699 12:118784416-118784438 AAGAGAGAGTGGAGCTGAGTGGG - Intergenic
1103697298 12:122826241-122826263 GAGAGGGAGGGGAGAGGAGGAGG - Intronic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1104427512 12:128690205-128690227 CAGAGTGAGTGGAGTTCAGTGGG + Intronic
1104544435 12:129698597-129698619 GGGAGGGAGGGGAGGGGAGACGG + Intronic
1104544466 12:129698652-129698674 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1104715919 12:131016114-131016136 CAGAGGGCTTGGAGGAGAGAAGG - Intronic
1104762205 12:131304245-131304267 CTGAGGAAGTGGAGGAGAGGAGG + Intergenic
1104817571 12:131656551-131656573 CTGAGGAAGTGGAGGAGAGGAGG - Intergenic
1104926499 12:132316705-132316727 CAGAGGGAGTGGGCTGGGGTGGG - Intronic
1104938021 12:132376959-132376981 CAGAGAGAGAGGAAGGGAGACGG + Intergenic
1105645396 13:22312633-22312655 CAGAGGAAGAGGAGGAGAGAGGG - Intergenic
1105859043 13:24393567-24393589 GAGAGGGTGAGGAGGGGAGGGGG + Intergenic
1106307319 13:28524849-28524871 CAGAGGAAGTGGGGGTGACTGGG + Intergenic
1106419964 13:29577914-29577936 CAGAGGGAGTGGAGGAGGAGAGG - Intronic
1106573543 13:30953202-30953224 CAGACGGTGGGGAGTGGAGTCGG - Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106792521 13:33169993-33170015 CAGAGGCTGAGGAGGGTAGTGGG + Intronic
1106805635 13:33303663-33303685 CAGAGGGAGATGAAGGGAGTAGG + Intronic
1106857843 13:33872228-33872250 CAAAGGCACTGGAGGGGAGAAGG + Intronic
1107438605 13:40404027-40404049 CCTAGTGAGTGGAGGGGTGTTGG + Intergenic
1107501569 13:40983582-40983604 AAAAGGGAGTGGATGAGAGTGGG - Intronic
1107662336 13:42651529-42651551 CAGAAGGAGGGGAAGGGAGAGGG - Intergenic
1108276979 13:48820938-48820960 CAGAGTGAGTGAGGGGAAGTGGG + Intergenic
1108299792 13:49061754-49061776 GAGAGGGAGAGGAGAGGAGAGGG - Intronic
1108299796 13:49061770-49061792 GAGAGGGAGAGGAGAGGAGAGGG - Intronic
1108699637 13:52932974-52932996 CAGAGGGTGGGGAGGGGCCTGGG - Intergenic
1110032337 13:70631531-70631553 CAGAGGGAGCTGAGTGCAGTGGG - Intergenic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1110845616 13:80187753-80187775 GAGAGGTAGTGGAGGGGGGCAGG - Intergenic
1111711888 13:91826920-91826942 CAGAGGCAGGAAAGGGGAGTGGG + Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1112487794 13:99835446-99835468 AAGAGAGAGTGGAGGGCAGGTGG + Intronic
1112666986 13:101586174-101586196 AAGAGGGGTTGGAGGGGAATAGG - Intronic
1112987288 13:105466640-105466662 CAGATGGAGTGAGGGGGAGGTGG - Intronic
1113027045 13:105952408-105952430 AAGAGGAAGTGGAAGTGAGTGGG - Intergenic
1113039176 13:106085675-106085697 CAGAGGGTGGGAAGGGTAGTGGG + Intergenic
1113796543 13:113061765-113061787 GAGAGGGAGGGGAGGGGAAGGGG - Intronic
1113909918 13:113836838-113836860 GAGGGGGAGTGGGGGGGAGGAGG + Intronic
1115389796 14:32841986-32842008 AGGAGGGAGGGGAGGGGAGGGGG - Intergenic
1115517962 14:34205166-34205188 AAGAGGTAGTGGAGGTGGGTGGG - Intronic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115736059 14:36331338-36331360 CACAGGGAGTGGAGGGCAAGGGG - Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116334460 14:43639564-43639586 CACAGGGAGTGGAGAGTAGCAGG - Intergenic
1116627639 14:47286381-47286403 CAGAGGGTGGGAAGGGGAATAGG - Intronic
1116971027 14:51066111-51066133 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
1117026997 14:51630978-51631000 CAGAAGGAATGTAGAGGAGTGGG + Intronic
1117440575 14:55755385-55755407 AAGAGGCAGTGGATGGGATTTGG + Intergenic
1117457441 14:55912279-55912301 CAGAGGGCATGGTGGGGAGGGGG + Intergenic
1117841782 14:59869279-59869301 CAGAGGAGGGGAAGGGGAGTGGG - Intronic
1118509688 14:66458027-66458049 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1118610765 14:67537823-67537845 CAGAGGCAGGGGCTGGGAGTAGG - Intronic
1118746522 14:68777419-68777441 CATAGGGAGTGGTGGGGACTGGG + Intergenic
1118877839 14:69799383-69799405 CAGAGGGAATGGGAAGGAGTGGG - Intergenic
1118974554 14:70665449-70665471 GAGAGGGAGGAGAGGGGAGGGGG + Intronic
1119423710 14:74522967-74522989 CAAAGGCAGTGGAGCGGGGTGGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1119680804 14:76591034-76591056 CAGAGGCAGAGGAGGGGGTTGGG + Intergenic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119932034 14:78556956-78556978 GGGAGGGAGGGGAGGGGAGGGGG - Intronic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120171138 14:81248034-81248056 CACAGGGAGTGGGTGGGGGTGGG + Intergenic
1120571483 14:86122636-86122658 TAGAGGGATTGGAGGGGAAAAGG + Intergenic
1120751807 14:88204581-88204603 CAGCGGGGGTAGGGGGGAGTTGG - Intronic
1120911727 14:89672873-89672895 CTGACGGAGTGGGGGTGAGTAGG - Intergenic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1120974441 14:90236265-90236287 GAGAGAGAGTGGAGGGAGGTAGG - Intergenic
1121000675 14:90450138-90450160 AAGAGGGAGAGAATGGGAGTTGG + Intergenic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121275864 14:92667085-92667107 CAGAGGAATTGGATGGGAGGGGG + Intronic
1121432121 14:93895092-93895114 GAGGGGGAGGGGAGGAGAGTGGG - Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121850191 14:97214599-97214621 CACAGAGAGTGGAGAGGAGCAGG - Intergenic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122411067 14:101526480-101526502 CAGATGGAGTGGTGGGGATGAGG - Intergenic
1122805365 14:104253672-104253694 CTGAGGGAGTGGAGGGCTGGGGG + Intergenic
1123541081 15:21292151-21292173 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1124081449 15:26501837-26501859 CAGAGCTAGTGGAGGGGTGGGGG - Intergenic
1124454352 15:29827009-29827031 CAGTGGCAGTGGAGCAGAGTGGG - Intronic
1124508285 15:30298014-30298036 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1124735271 15:32240642-32240664 CAGAGGCTGGGAAGGGGAGTGGG - Intergenic
1125447757 15:39776166-39776188 CAGAGGGAGGGGAGGGGCGGAGG + Intronic
1125672536 15:41484522-41484544 TAGTGGGAGTGCTGGGGAGTTGG - Intergenic
1126099824 15:45112435-45112457 GAGAGGAAGTGGTTGGGAGTCGG + Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126163103 15:45632184-45632206 GGGAGGGAGGGGAGGGGAGGGGG - Intronic
1126292748 15:47099977-47099999 CAGGGGCAGTGTAGGGGAATTGG + Intergenic
1126415924 15:48417426-48417448 AGGAGGGAGGGGAGGGGAGGGGG - Intronic
1126704933 15:51397807-51397829 CAGAAGGAGGGAAGGGGAGTGGG - Intronic
1127276087 15:57445373-57445395 AAGAGGGAGGGAAGAGGAGTAGG - Intronic
1127470104 15:59282877-59282899 GAGAGGGAGGGGAGGGGGGAGGG + Intronic
1127507589 15:59610955-59610977 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507606 15:59610982-59611004 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127507711 15:59611178-59611200 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128514530 15:68334095-68334117 CAGAGGGAGTGGGGGCTGGTGGG - Intronic
1128771938 15:70289443-70289465 AACAGGGAGTGGTGGGGACTGGG - Intergenic
1128898599 15:71398505-71398527 CAGAAGGAGTGAAAGGGAGGAGG + Intronic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129450243 15:75647566-75647588 CGGAGGGAGAGGAGGGGAGGTGG + Intronic
1129741758 15:77992809-77992831 GGGGGGGAGTGGGGGGGAGTGGG - Intronic
1129741785 15:77992856-77992878 TGGGGGGAGTGGGGGGGAGTGGG - Intronic
1129743221 15:78000316-78000338 CAGGAGGAGCGGAGGTGAGTGGG - Intronic
1130048057 15:80461382-80461404 CAGAGGGAGTGAAGGGAGGCCGG + Intronic
1130164121 15:81435449-81435471 CAGAGGGAGTCAAAGGGAGAAGG - Intergenic
1130226093 15:82059152-82059174 GAGAAGGAGAGGAGGGGAGGGGG - Intergenic
1130445819 15:84000840-84000862 CAGAGGATGTGAAGGGGAGTGGG + Intronic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130923078 15:88365383-88365405 CAGAGGGAGGGCAGAGGGGTGGG + Intergenic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131440429 15:92455438-92455460 CAGGGGGTGCGGAGCGGAGTTGG - Intronic
1131861092 15:96653801-96653823 AGGAGGTAGTGGAGGGGAATGGG + Intergenic
1132265913 15:100470515-100470537 CAGAGTGACTGTAGTGGAGTGGG + Intronic
1132444449 15:101899800-101899822 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1202949394 15_KI270727v1_random:19292-19314 GAAAGGGAGGGGAGGGGAGAAGG + Intergenic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132688043 16:1170446-1170468 CAGAGGCAGGGGAGGGGAGCGGG + Intronic
1132734610 16:1379333-1379355 CCGAGGGAGGGCAGGGGAGCGGG - Intronic
1133259509 16:4538873-4538895 CAGTGGGAGCGGAGGCGATTTGG + Intergenic
1133699041 16:8291947-8291969 TAGAAGGTATGGAGGGGAGTGGG + Intergenic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1134186710 16:12090379-12090401 CAGAGGCAGTGGGAGGGAATGGG + Intronic
1134660051 16:15977110-15977132 GAGAGGGAGTGGTGGAGACTGGG + Intronic
1134819130 16:17231358-17231380 CACAGGCAGTGGGGGGCAGTGGG + Intronic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135248288 16:20876941-20876963 CAGAGGCAGGGAAGGGGAGCGGG + Intronic
1135621369 16:23958738-23958760 AAGAGGGGGTGGAAGGGAGTGGG - Intronic
1135656869 16:24257567-24257589 CATAGGGTGTGGGTGGGAGTAGG - Intronic
1135962544 16:27009719-27009741 AGGAGGGAGTGGAGGTGAGAGGG + Intergenic
1136072737 16:27798024-27798046 CACAGGGGGAGGATGGGAGTGGG + Intronic
1136221681 16:28833351-28833373 CTGAGTGAGTGGAGCGGGGTGGG + Exonic
1136539919 16:30923548-30923570 AGGAGGGAGGGGAGGGGAGGGGG + Intronic
1137240972 16:46654147-46654169 GAGAGGGAGAGGAAGGGAGAGGG + Intergenic
1137540576 16:49358932-49358954 CTCAGGGAGTGGAGGGGCTTGGG + Intergenic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1137578792 16:49621117-49621139 CGGAGGGGGTGAAGGGGAGGTGG + Intronic
1137764283 16:50966013-50966035 AATAGGGACTGGTGGGGAGTGGG - Intergenic
1138183821 16:54961535-54961557 GAGAGGGAGAGGTGGGGAGCAGG + Intergenic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1139276707 16:65734576-65734598 CACAGGGAGTAGAGGACAGTAGG - Intergenic
1139475763 16:67201891-67201913 CTGAGGCAGGGGTGGGGAGTTGG - Intronic
1139511859 16:67432241-67432263 CAGAGGGAGGGAAGGGGAAGGGG + Intronic
1139512179 16:67433819-67433841 TAGAGGGAGTGGAGCTGAGATGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139588218 16:67917887-67917909 CAGAGGCACTGGAGTGGAGAGGG + Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140219969 16:73036609-73036631 TAGAGGAAGAGGAGGGGAGAGGG + Intronic
1140955917 16:79865161-79865183 CAGAGGCACTGGAAGGGAGATGG - Intergenic
1141173924 16:81707103-81707125 AAGAAGGAGGGGAGGAGAGTGGG - Intronic
1141394693 16:83694331-83694353 CAGTGGGAGAGAATGGGAGTGGG + Intronic
1141443200 16:84042479-84042501 CAAAGGGAGTGGATGGGAATGGG - Intronic
1141713995 16:85716552-85716574 CAGAGGGAGGGAAGGGGAGAGGG + Intronic
1141823263 16:86462399-86462421 CGGAGGGAGTGCAGGAGAGATGG - Intergenic
1141839784 16:86567219-86567241 GAGGGGGAGAGGAGGGGAGCGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141871466 16:86789347-86789369 CTGAGAGAGTGAAGTGGAGTGGG - Intergenic
1141891666 16:86930356-86930378 CTCAGGAAGTGTAGGGGAGTTGG - Intergenic
1141900379 16:86986937-86986959 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141900389 16:86986953-86986975 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1141924310 16:87157331-87157353 CAGAGGCTGGGGAGGGGAGTGGG + Intronic
1142254437 16:89006975-89006997 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254465 16:89007053-89007075 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254486 16:89007115-89007137 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254503 16:89007166-89007188 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254512 16:89007196-89007218 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254522 16:89007226-89007248 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142254531 16:89007255-89007277 TGGAGGGAGAAGAGGGGAGTGGG - Intergenic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142836844 17:2593840-2593862 GAGGGGGAGGGGAGGGGAGCGGG - Exonic
1142927726 17:3255753-3255775 CCGAGGGTGGGAAGGGGAGTGGG + Intergenic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143091279 17:4450343-4450365 GAGAGAGAGAGGAGGGGAGAGGG - Intronic
1143574222 17:7780577-7780599 CAGAGGGATTTGTGGGGAGATGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143672519 17:8406275-8406297 CAGAGGGAGGGGATGGGATGGGG - Intergenic
1143909660 17:10237258-10237280 CAGAGGGAGAGAAGGAGAGAGGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144213016 17:13031213-13031235 AGGAAGGAGTGGAGGGGAGAAGG - Intergenic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1145707797 17:26938309-26938331 GAATGGGAGTGGAGTGGAGTGGG + Intergenic
1146000938 17:29129946-29129968 AAGAGGGAGGGGAGGAGTGTAGG - Intronic
1146453846 17:32994708-32994730 CAGAGGAACTGGAGGGGACTAGG + Intronic
1146531318 17:33609879-33609901 AAGAGGTAGAGGAGGGGAGGGGG + Intronic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1146624280 17:34424101-34424123 GAGAGGGAGAGGAGGGGAGGAGG + Intergenic
1146628695 17:34454566-34454588 GAGAGGGAGGGGATGGGAATGGG - Intergenic
1146813641 17:35924572-35924594 CACTGGGAGTGGAGGAGGGTAGG - Intronic
1147002924 17:37377845-37377867 CAGAGGGGGAGGAGGGGAACCGG - Intronic
1147306290 17:39566690-39566712 GAGAGGGAGTAATGGGGAGTTGG - Intergenic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147400229 17:40176651-40176673 CAGAAGGAGTGTGGGGGAGGAGG - Intergenic
1147460320 17:40564105-40564127 TGGAGGGGGTGCAGGGGAGTGGG + Intronic
1147484210 17:40796779-40796801 CAGAGAGAGTGGAGGAGAGCAGG - Intronic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1147881392 17:43656387-43656409 CAGGGGTAGTGGAGGGGACCTGG + Intronic
1147895407 17:43747845-43747867 CAGATGGAAGGGAGGGGATTGGG + Intergenic
1148084109 17:44984090-44984112 CAGAGGGAGTGGAACGGGGTGGG - Intergenic
1148119163 17:45197602-45197624 GAGATGGGGTGGAGGAGAGTAGG + Intergenic
1148984991 17:51613396-51613418 GAGAGGGAGAGGTGGGGAGAGGG - Intergenic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149343979 17:55715810-55715832 AAGAGGGAGTGAGGGAGAGTGGG + Intergenic
1149389520 17:56174858-56174880 GAGAGGGAGTGGCAGGGAATGGG + Intronic
1149891002 17:60391006-60391028 CAGAGTGAGTGGTAGGGGGTTGG + Intronic
1149938681 17:60838428-60838450 AAGAGGGAGTAGTGGGGATTAGG + Intronic
1150379854 17:64712093-64712115 CCGAGGTACTGGAGTGGAGTCGG + Intergenic
1150717493 17:67584211-67584233 GAGTGGGAGTGGAATGGAGTGGG - Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1150984847 17:70184530-70184552 GAGGGGGAGGGGAGGGGAGAGGG - Intergenic
1150984859 17:70184552-70184574 GGGAGGGAGGGGAGGGGAGAGGG - Intergenic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151358398 17:73573671-73573693 CTCAGGGAGCGGAGGGGAGCAGG - Intronic
1151439030 17:74116277-74116299 TGGAGGGAGTGGAGGGGATGTGG - Intergenic
1151543383 17:74776685-74776707 GAGAGGGAGAGGCTGGGAGTGGG + Intronic
1151569215 17:74917760-74917782 CAGAGGGAGGGCAGGGGCATCGG - Exonic
1151569828 17:74920727-74920749 TGGAGGGAGTGGAGGGGGGAGGG + Intronic
1151758640 17:76088585-76088607 CAGAGCGACTGGAGGTGAGCTGG - Intronic
1151768071 17:76142217-76142239 CAGAGGCAGTGGTGGGGGCTGGG + Intergenic
1151787148 17:76280569-76280591 GAGACTGAGTGGAGGGGAGCTGG - Intronic
1151827084 17:76529664-76529686 CAGGGGAAGAGGAGGGGAGGGGG - Intronic
1151969232 17:77449409-77449431 CAGAGGCAGAGGAGGGGAGGAGG + Intronic
1151972804 17:77467512-77467534 CGGTGGGAGGGGAGTGGAGTGGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152069626 17:78128333-78128355 CACGGGGAGGGGAGGGGAGGGGG - Intronic
1152133316 17:78490292-78490314 CACAGGGCATGGTGGGGAGTGGG - Intronic
1152136195 17:78505150-78505172 GAGAGGGAGAGGAGAGGAGCAGG + Intronic
1152458389 17:80428815-80428837 AAGAGGGAGGAGAGTGGAGTGGG + Intronic
1152571970 17:81124911-81124933 CAGAGTGAGTGGGGTGGGGTGGG - Exonic
1152983493 18:301280-301302 AAAAGGGAGGGGAGGGGAGAGGG - Intergenic
1153567356 18:6431774-6431796 AAGAGGGAGAGGAGGGGAGCGGG - Intergenic
1153625554 18:7019331-7019353 AAGAGGGAGGGCAGGAGAGTGGG - Intronic
1154336856 18:13472599-13472621 AAGACAGAGTGGATGGGAGTGGG - Intronic
1154355298 18:13619942-13619964 GGGTGGGAGTGGAGGGCAGTGGG - Intronic
1155073480 18:22336083-22336105 GAGAGGGAGTGGAGAGGACTGGG + Intergenic
1155512866 18:26594987-26595009 GAGAGGGAGAGGGGAGGAGTTGG - Intronic
1155707675 18:28837156-28837178 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1156033327 18:32738797-32738819 TGAATGGAGTGGAGGGGAGTAGG - Intronic
1156325091 18:36067590-36067612 CAGCGGGAGGGGCGGGGCGTGGG - Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157475392 18:48020716-48020738 ACGAGGGGGAGGAGGGGAGTCGG - Intergenic
1158244285 18:55413330-55413352 GAGAGAAACTGGAGGGGAGTGGG + Intronic
1158522867 18:58186231-58186253 CAGAGGGAGTGGGGGAGAGAAGG - Intronic
1159202858 18:65209757-65209779 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1159926704 18:74276062-74276084 CAGAGGAGGTGGAGGATAGTGGG - Intronic
1160032242 18:75272138-75272160 CAAAGGGAGTGGAGATGAATCGG - Intronic
1160353134 18:78201976-78201998 CTGAGGGAGTGGGGAGGAGGAGG - Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1160640905 19:135015-135037 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1160906342 19:1453358-1453380 CAGAGGGAGTGGGGGAGGCTGGG + Intronic
1160950449 19:1664394-1664416 GGGAGGGAGGGGAGGGGAGGGGG - Intergenic
1160951950 19:1672045-1672067 CACAGGGAGGGGAGGGGTCTGGG - Intergenic
1160975463 19:1790382-1790404 GAGAGGGAAGGGAGGGGAGGGGG - Intronic
1160987322 19:1845056-1845078 CACAGGGAGTGCGGGGCAGTGGG + Intronic
1161402239 19:4071977-4071999 CAGAGGCTGGGGAGGGGAATGGG + Intergenic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1161629343 19:5344463-5344485 CAGAGGGCGGGGAAGGGGGTAGG - Intergenic
1161635879 19:5388663-5388685 GATGGGGAGGGGAGGGGAGTCGG + Intergenic
1161762275 19:6182947-6182969 CAGAGGGCTGGGAGGGTAGTTGG + Intronic
1162012129 19:7823578-7823600 AGGAGGGAGGGGAGGGGAGGAGG + Intergenic
1162054172 19:8052949-8052971 CTGAGGAAGAGGAGGGGAGTGGG - Intronic
1162223654 19:9201188-9201210 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
1162450485 19:10751347-10751369 CAAAGGGAGAGGAGAGGAGTAGG + Intronic
1162878025 19:13635434-13635456 CAGGGGGAGTCCAGGGGTGTAGG + Intergenic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163200727 19:15767107-15767129 CAAAGGGAGTGGAGAGTAGCAGG + Intergenic
1163566546 19:18055208-18055230 CAGAGACAGAGGAGGGGAGGTGG + Intergenic
1163684728 19:18704931-18704953 GGGAGGGAATGGAGGGTAGTAGG - Intronic
1164081390 19:21864619-21864641 CAGAGGCAGGGAAGGGTAGTGGG - Intergenic
1164320148 19:24137288-24137310 CAGAGGGACTGGTGGTGGGTGGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1165072407 19:33263254-33263276 GAGAGGGAGGGGAGGGCAGCGGG - Intergenic
1165176830 19:33936468-33936490 CAGAGGCAGAGGTGGAGAGTGGG - Intergenic
1165267468 19:34673166-34673188 AAGAGCTAGTGGAAGGGAGTGGG + Intronic
1165617921 19:37218369-37218391 TAGAGGGGGTGGTGGGGAGGCGG + Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1165810344 19:38608074-38608096 CAGGCGGTGTGGTGGGGAGTGGG + Intronic
1166113629 19:40639352-40639374 CAGAGGGAGTTGAGTTGACTTGG - Intergenic
1166872470 19:45879233-45879255 CAGGGGGAGTGGAGGTGGGCGGG - Intergenic
1166885741 19:45960054-45960076 TAGAGAGAGTGGAGGGGCCTTGG + Intronic
1166888111 19:45973575-45973597 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167063344 19:47165500-47165522 CTGAGGAAGTGGAGGAGAGGAGG + Intronic
1167428329 19:49441090-49441112 CAGAGAGAGTGGAGCCGGGTGGG + Intronic
1167461261 19:49625782-49625804 GGGAGGGAGTGGAGGGGGCTTGG - Exonic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167677720 19:50897866-50897888 GAGAGGGAGTGATGGGGAGCTGG + Intergenic
1168015148 19:53566925-53566947 GAGAGGGAGAGGAGGAGAGAGGG - Intronic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168383485 19:55943718-55943740 CAGGGTGAGTGGAGGTGAATGGG - Intergenic
1202700645 1_KI270712v1_random:161242-161264 CTGAGGGACTGGATGGGAGGGGG + Intergenic
925157525 2:1658832-1658854 CAGAGGGAGCCGCGGGGAGATGG - Intronic
925418420 2:3690343-3690365 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
925418458 2:3690403-3690425 AAGGGGGAGGGGAGGGGAGGGGG - Intronic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925733279 2:6938232-6938254 AAAAGGGAGGGGAGGGGAGAGGG - Intronic
925745451 2:7039682-7039704 CAAAGGGAGTGGCCAGGAGTAGG - Exonic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
926049876 2:9737768-9737790 CAGAGGAAGTGGGGGGCACTAGG - Intergenic
926381437 2:12294497-12294519 CAGAGTGACCGGAGGTGAGTGGG + Intergenic
926990789 2:18677466-18677488 CATAGGGAGTGGTGTGTAGTAGG + Intergenic
927256340 2:21043815-21043837 CAGAGGGAGCGGGAGGGAGCCGG - Intronic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
928012549 2:27623743-27623765 TAGAGAGAGTGGAGGGAAGGGGG - Intergenic
928189399 2:29148212-29148234 AAGGTGGAGGGGAGGGGAGTTGG + Intronic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
928570976 2:32608387-32608409 CAGAGGGAGAGGAGAGGAAAAGG - Intronic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
928947045 2:36780991-36781013 TAGAAGGGGTGGAGGGGAGGAGG - Intronic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929825539 2:45306816-45306838 CCCAGGGAGGGGAGAGGAGTTGG - Intergenic
929849873 2:45576421-45576443 AAGAGGGAGTCGGGGGGGGTGGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930191377 2:48463475-48463497 CACAGGGAGTTGAGGTGAATGGG + Intronic
930639534 2:53840615-53840637 GGGAGGGAGTGGAGGGGGGAGGG + Intergenic
930692670 2:54380396-54380418 CTGAGGCAGTGCAGGGGGGTTGG - Intronic
930700628 2:54456092-54456114 CAGAGGGAGCGGGCGGGAGTGGG + Intergenic
930721437 2:54641838-54641860 CAGTGGGAGTGGAAGGGCCTTGG + Intronic
931001421 2:57788360-57788382 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
931515846 2:63050460-63050482 CGGAGGGAGTGGCAGGGAGGAGG - Intronic
931693067 2:64851784-64851806 GGGAGGGAGGGGAGGGGCGTGGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932247564 2:70208206-70208228 CAGAGGGAATGGTGGCCAGTTGG + Intronic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
932702967 2:74003458-74003480 CAGAGGCAGGGGTGGGGAGTGGG - Intronic
932886712 2:75555340-75555362 CAGAGGGAAAGAAGGGGAGATGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933866465 2:86522706-86522728 AAGAGGTAATGGAGTGGAGTAGG - Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934281881 2:91619032-91619054 CTGAGGGACTGGATGGGAGGGGG + Intergenic
934604862 2:95687007-95687029 TAGAGGATGAGGAGGGGAGTGGG - Intergenic
936538310 2:113329543-113329565 TAGAGGATGGGGAGGGGAGTGGG - Intergenic
936639728 2:114298507-114298529 GAGAGGGAGAGAAGGAGAGTGGG + Intergenic
936879506 2:117232896-117232918 CACAGGGAGTGGAGAGTAGCAGG + Intergenic
937033450 2:118761070-118761092 CAGAAGCTGGGGAGGGGAGTTGG + Intergenic
937108423 2:119341388-119341410 CAGGGTGATTGGAGGTGAGTGGG - Intronic
937279469 2:120707447-120707469 CAGAGGCAGGAGAGGTGAGTGGG + Intergenic
937349878 2:121153988-121154010 CAGAGAGGGTGGAGGAGAGGCGG - Intergenic
937430668 2:121835651-121835673 CAGAGAGAGTGAAGGGGAGGTGG - Intergenic
937430682 2:121835716-121835738 CAGAAGGGGAGGAGGGGAGGAGG - Intergenic
937862773 2:126723909-126723931 CAGAAGCAGAGGAGGGGAGCAGG + Intergenic
938086623 2:128406134-128406156 TGGAGGGAGTAGAGGGGAGGAGG + Intergenic
938135023 2:128749804-128749826 CAGACGGCTTGGAGGGGAGCGGG - Intergenic
938176992 2:129142812-129142834 CGGTGGGAGTGGAGTGGAGCAGG - Intergenic
938214505 2:129499624-129499646 GAGAGGGTGTGGAGGGGCATGGG + Intergenic
939983204 2:148805618-148805640 GAGGGAGAGTGGAGGGGAGGAGG - Intergenic
940058070 2:149534475-149534497 GAGAGGGAGGGCAGGGGAGAAGG - Intergenic
940973805 2:159921833-159921855 GGGAAGGAGCGGAGGGGAGTGGG - Intergenic
941078945 2:161037876-161037898 CAGAGCGAGTGGAGCTGAGTTGG - Intergenic
941099983 2:161284801-161284823 CAGTGGGAGTGGAAAGGATTAGG - Intergenic
941170706 2:162132392-162132414 TAGTGGGAGTGCAGGGGAGAAGG - Intergenic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943768019 2:191683309-191683331 AAGAGGGACTGAATGGGAGTGGG + Intronic
944042369 2:195370092-195370114 TGGAGGGAGAGGATGGGAGTGGG + Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
944822418 2:203444000-203444022 GAGAGGGAGAGGAGGGGATGGGG + Exonic
945058106 2:205885686-205885708 CAGAGGGTGTGGGAGGGAGGAGG - Intergenic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946015881 2:216603349-216603371 GAGAGGAAGGGGAGGGGAGGAGG + Intergenic
946026187 2:216673255-216673277 CAGAGGTGGTGGTGGGGAGATGG + Exonic
946040742 2:216781167-216781189 GAGAGGGAGGGGAGGGGAGGGGG - Intergenic
946242756 2:218367128-218367150 CAGGGAGAGTTAAGGGGAGTGGG + Intronic
946449265 2:219765760-219765782 CAGAAGGAGTGGAAGGGAGGTGG - Intergenic
946891325 2:224280321-224280343 GAGATGGACTGGAGAGGAGTTGG - Intergenic
947139624 2:227009041-227009063 CAGAGGGAGAGAAGGAGAGAAGG + Intronic
947438971 2:230100658-230100680 CAGAGGCGGGGAAGGGGAGTGGG - Intergenic
947793175 2:232879200-232879222 CCGAGGGGGTGGAAGGGGGTGGG - Exonic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947910756 2:233799338-233799360 GAGAGGGAATGGAGGAGAATGGG + Intronic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948920876 2:241065326-241065348 TGGAGAGAGTGGAGGAGAGTGGG + Exonic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1168805784 20:671636-671658 CAGAGGGAGTGAGAGGAAGTGGG + Intronic
1168916073 20:1489540-1489562 GAGAGGGAGGGAAGGGGTGTGGG - Intronic
1168980899 20:2002848-2002870 GAGGGGGAGTGGATGGGAATGGG + Intergenic
1169027897 20:2385514-2385536 GAGAGGCAGTGGGTGGGAGTGGG + Intronic
1169073552 20:2748674-2748696 CTGATGGAGGGGAGGGGAGGGGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169609094 20:7359167-7359189 CAAAGAGAGAGGAGGAGAGTGGG + Intergenic
1169740259 20:8885757-8885779 CAGAGGCTGGGGAGGGTAGTTGG - Intronic
1170073938 20:12398515-12398537 GAGAGGGAGAGGAGGATAGTAGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171354592 20:24534302-24534324 CAGATGGAGGGGAGGGGTGGAGG - Intronic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1172013592 20:31860729-31860751 CACAGGGAAGGGAAGGGAGTCGG + Intronic
1172071646 20:32261694-32261716 CAAAAGGGGTGGAGGGCAGTGGG - Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172594807 20:36143368-36143390 CAGAGAGAGTGGAATGGAGAGGG + Intronic
1172802995 20:37591395-37591417 CAGCTGGAGTGGAGGCGTGTGGG - Intergenic
1173198109 20:40932638-40932660 CAGAGGGAGTGGGGGTGAGGGGG + Intergenic
1173324171 20:42017494-42017516 CAGAGGGAGAGGAGGCTGGTGGG - Intergenic
1173416837 20:42864327-42864349 CACAGAGAGAGGAGGGGAGAGGG + Intronic
1173523252 20:43714239-43714261 CAGAGAGACTGGAAGGGCGTGGG + Intronic
1173970524 20:47148802-47148824 CAGAGTGAGTGCAGTAGAGTGGG - Intronic
1174108631 20:48181812-48181834 CACAGGGAGTGGAGGAGGGGTGG + Intergenic
1174151876 20:48491765-48491787 CAGAGGGAGAGGAAGGGACGTGG - Intergenic
1174175024 20:48639143-48639165 CACAGGGAGTGGTGGAGACTGGG + Intronic
1174216681 20:48921557-48921579 GAGAAGGTGGGGAGGGGAGTGGG - Intergenic
1174298963 20:49568345-49568367 GGGAGGGAGGGGAGGGGAGAAGG + Intergenic
1174406227 20:50305081-50305103 AAGAGGGAGTGGTGGGGACTGGG - Intergenic
1174424715 20:50423755-50423777 GAGAGGGAGGGAAGGGGAGCTGG + Intergenic
1174572368 20:51511181-51511203 AACAGGGGGTGGTGGGGAGTAGG - Intronic
1174627521 20:51927812-51927834 GAGGGGGAGTGGGGGGGAGGGGG + Intergenic
1174674954 20:52344771-52344793 CAGATGGATTGGAGGGGTGAGGG + Intergenic
1174939476 20:54909081-54909103 CAGAGGCTGAGAAGGGGAGTTGG + Intergenic
1175297322 20:57917857-57917879 CAGATGGGGAGGAAGGGAGTAGG + Intergenic
1175337663 20:58206731-58206753 CTGGGGGAGGGGAGGGGTGTGGG - Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175491710 20:59384454-59384476 GTGAGGCAGAGGAGGGGAGTGGG + Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1176093040 20:63327403-63327425 CAGACGTGGTGGAGGGGAGGTGG + Intronic
1176139487 20:63538709-63538731 CAGGGGGAGGGGTGGGGGGTGGG + Intergenic
1176215632 20:63946386-63946408 CACAGGCACTGGAGGGGAGCCGG + Intronic
1176242371 20:64081043-64081065 CAGAGTGAGTTGTGGGGAGCAGG + Intronic
1176244973 20:64093132-64093154 CACAGGGAGGGGAGGGGAGGGGG + Intronic
1176636168 21:9246632-9246654 GGGATGGAGTGGAGTGGAGTGGG + Intergenic
1176703746 21:10093202-10093224 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1178260099 21:31091538-31091560 CAGAGGGTGAGAAGGGTAGTGGG - Intergenic
1178377568 21:32080192-32080214 CCAAGGGAGTGGAGGGGACCAGG - Intergenic
1178430263 21:32512561-32512583 CACTGGGAGAGGAGGGGAGGGGG + Intronic
1178522607 21:33299115-33299137 CAGAGGGAGGGGGTGCGAGTGGG - Intergenic
1178679709 21:34663372-34663394 CAAAGGGAGTGTGGGTGAGTAGG + Intergenic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178750414 21:35297292-35297314 CAGAGGGGGTGGGGTGGGGTGGG - Intronic
1178901963 21:36605641-36605663 GAGAGCTGGTGGAGGGGAGTAGG + Intergenic
1179007296 21:37527162-37527184 CAGAGGCTGTGCTGGGGAGTGGG - Intergenic
1179025288 21:37674495-37674517 CAGTGGGTGAGGAGGGGAGTGGG - Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1179135829 21:38678930-38678952 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1179535475 21:42048730-42048752 CAGATGGAGTGGACGGTAGTAGG + Intergenic
1179598278 21:42458170-42458192 AAGAGGGACTGGAAGGGGGTTGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714397 21:43280112-43280134 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714521 21:43280388-43280410 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714525 21:43280399-43280421 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714546 21:43280449-43280471 GAGGGGAGGTGGAGGGGAGTTGG + Intergenic
1179714598 21:43280566-43280588 GAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179714754 21:43280923-43280945 TAGGGGGAGGGGAGGGGAGGTGG + Intergenic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1179994141 21:44966223-44966245 CAGCGGGATTGGAGAGGAGCTGG + Intronic
1180020908 21:45126404-45126426 TGGAGGGAGTGGAGAGGAGCAGG - Intronic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1180104291 21:45607677-45607699 CAGAGGGAGGGGAGGAGGGAGGG + Intergenic
1180735125 22:18010794-18010816 TAGAGGGATGGGTGGGGAGTTGG + Intronic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1181051320 22:20239518-20239540 CAGTGGCAGGGGTGGGGAGTTGG - Intergenic
1181571122 22:23768215-23768237 CAGAGGGCAGGGAGCGGAGTTGG + Exonic
1181767201 22:25100388-25100410 CAAATGGAGTGGAAGGGAGGAGG + Intronic
1181955357 22:26584292-26584314 CAGAGCGAGTAGGGAGGAGTGGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181977230 22:26738528-26738550 GAGGGGGAGGGGAGGGGAGGTGG - Intergenic
1181990691 22:26834598-26834620 CAGAGTGAGTGAAGAGGAGATGG - Intergenic
1182679843 22:32070240-32070262 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1182939554 22:34262263-34262285 CATAGGGAGTGGAGGGAAAGGGG + Intergenic
1182944450 22:34308810-34308832 GAGATGGAGTGGGGTGGAGTGGG - Intergenic
1182972854 22:34593866-34593888 AAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1183080724 22:35454389-35454411 AAGAGAGAGGGGAGGGGAGAAGG - Intergenic
1183333022 22:37231458-37231480 CAGAGGGAGTGTGAGGGTGTAGG + Intronic
1183583304 22:38738269-38738291 CAAAGAGAGCGGAGGGAAGTGGG + Intronic
1183696994 22:39429089-39429111 CACAGGCAGGGGAGGAGAGTGGG - Intronic
1183746258 22:39693810-39693832 CAGAAAGAGAGGAGGGGAGATGG - Intergenic
1183746458 22:39694657-39694679 CAGAGAGAGAGGATGGGAGCGGG - Intergenic
1183912772 22:41091881-41091903 CAGAGAGTGCGGAGGGGAGTCGG + Exonic
1183929940 22:41230113-41230135 AAGAGGGAGGGGAGGCGGGTGGG - Intronic
1184120104 22:42444530-42444552 CTGAGGGATTGGTGGGGAGGGGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184399156 22:44263645-44263667 CAGAGTCAGTGGAGGGGATGTGG + Intronic
1184594430 22:45505189-45505211 GGGAGGGAGTGGAGAGGAGGAGG + Intronic
1185037002 22:48484681-48484703 AGGGGGGAGGGGAGGGGAGTGGG - Intergenic
1185229824 22:49673587-49673609 CAGAGGGGGGGGAAGGGAGGAGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1203303602 22_KI270736v1_random:94088-94110 TAGAAGGAGTGTAGAGGAGTGGG + Intergenic
1203314146 22_KI270736v1_random:171397-171419 GAAATGGAGTGGAGTGGAGTAGG + Intergenic
949988580 3:9559375-9559397 GAGAGGGAGAGGGGGGGAGAGGG - Intergenic
950053064 3:10006639-10006661 CAGAGGGAGGGAATGGGAGGGGG + Intronic
950119380 3:10471485-10471507 CAGAGGGAGGGTACGGGAGGAGG + Intronic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950187034 3:10951681-10951703 AGGAGGGAGAGGAGGGGAGAGGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950442163 3:13016391-13016413 GAGAGGGAGTGGTGGGGCGTTGG - Intronic
950457282 3:13100192-13100214 CACAGGGAGTTGGGGGGTGTGGG + Intergenic
950637013 3:14322597-14322619 CAGAGGAATTGGTGGGGAGGGGG + Intergenic
950673743 3:14542024-14542046 TGGAGGGAATGGAGGCGAGTGGG - Exonic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
950914097 3:16626091-16626113 CAGAGGCTGAGAAGGGGAGTAGG + Intronic
951475920 3:23106184-23106206 TAGAGATAGTGGAGGGGAGGAGG + Intergenic
951528010 3:23672097-23672119 CTGAGGGAGTGGAGGAGACTTGG - Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
952544674 3:34406157-34406179 CAGAGGCAGGGAAGGGGAGTAGG - Intergenic
952668375 3:35935594-35935616 CAGAGGCAGTGAGGGGGAGAGGG - Intergenic
953087033 3:39679472-39679494 CAGAGGGTGCGGTGGGGAGGAGG - Intergenic
953435468 3:42874205-42874227 CAGAGGGAGGGGTGGCCAGTGGG + Exonic
953571717 3:44076532-44076554 CAAAGGGAGGAGAGGGGATTGGG + Intergenic
953799082 3:46007987-46008009 CAGAGGTAGTGGTGGTGGGTGGG + Intergenic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954429414 3:50462029-50462051 CAGATAAAGTGGCGGGGAGTTGG + Intronic
954782006 3:53068645-53068667 TAGAGGGAGTGCAGGGGACAGGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
954866366 3:53733099-53733121 GAGAGGGGTTGGAGGGGACTTGG - Intronic
955349293 3:58182173-58182195 GAGGGGGAGGGGAGGGGAGGAGG + Intergenic
955592341 3:60551472-60551494 CAGAGAGAGGGTAGGGGAGAGGG + Intronic
955598695 3:60620885-60620907 CTGGGGGAGTGGTGGGGCGTAGG + Intronic
955833647 3:63030433-63030455 AAGAGGAAGGGGAGGGGAGGGGG + Intergenic
956178196 3:66493988-66494010 AAGAGGGAAGGGAAGGGAGTGGG + Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956868171 3:73389610-73389632 AAGAGGGAGTGGTGAGGACTGGG - Intronic
958634196 3:96722026-96722048 AAGAGGGAGGGGAGGGGAGTGGG + Intergenic
959087602 3:101868116-101868138 CAAAGAGAGGGGAGGGGAGAGGG - Intergenic
959426530 3:106196678-106196700 GAAAGGTAGTGAAGGGGAGTTGG - Intergenic
959539704 3:107524611-107524633 CAGAGGGGGGGGGGGGGAGAGGG + Intronic
959758747 3:109930805-109930827 GAGAGGGAGTGGAGTGGGGTGGG - Intergenic
960668775 3:120136603-120136625 CAGAGGCTGGGGGGGGGAGTCGG + Intergenic
960784600 3:121358261-121358283 CAGAGGGTGAGAAGGGTAGTGGG - Intronic
960939743 3:122925850-122925872 CAGAGGGAGGGGGTGGGAGGAGG + Intronic
961073579 3:123961323-123961345 GAAAGGGAGTGGAGGCGCGTCGG - Exonic
961221511 3:125204566-125204588 CAGAGGGTGGGAAGGGGATTGGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961589233 3:127963296-127963318 CGGAGTGAGAGGAGGGGACTTGG - Exonic
961635294 3:128329409-128329431 CAGCGGGGGTGGGGGGGGGTGGG - Intronic
961940861 3:130636754-130636776 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
961940876 3:130636782-130636804 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
962201950 3:133407573-133407595 AAGAAAGAGTGGAGGGGAGGAGG + Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962367071 3:134793821-134793843 AGGAGGGAGGGGAGGGGAGGAGG + Intronic
962406344 3:135103817-135103839 AGGAGGAAGTGGAGGGGAGGAGG - Intronic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
962468602 3:135684880-135684902 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
962503953 3:136027178-136027200 AAGAGGCAGTGAAGGGGGGTGGG - Intronic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
962738632 3:138347493-138347515 GAGGGGCAGGGGAGGGGAGTGGG + Intergenic
962750205 3:138429245-138429267 TGGAGGGTGTGGAGGGGAATGGG + Intergenic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963115601 3:141726462-141726484 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964002832 3:151796186-151796208 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
964810328 3:160656494-160656516 CAGAGGCTGTGAAGGGTAGTAGG + Intergenic
965410606 3:168326059-168326081 CAGAGGAAGCAGAGTGGAGTTGG + Intergenic
965682122 3:171262297-171262319 CAGAGGAGGTGGAGTGGGGTGGG - Intronic
965685895 3:171302099-171302121 TAAAAGGGGTGGAGGGGAGTGGG + Intronic
965772235 3:172193241-172193263 GAGAGGGGGAGGAGGGGAGGAGG - Intronic
966064135 3:175796081-175796103 GAGAGAGAGTGGGGGAGAGTGGG + Intronic
966140597 3:176752170-176752192 GGGAGGGAGGGGAGGGGAGGAGG + Intergenic
966338009 3:178892480-178892502 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
966338072 3:178893259-178893281 CAGAGGCCGTGAAGGGTAGTGGG + Intergenic
966596107 3:181726002-181726024 CAGCGGGAGACGAGGGGACTGGG + Intergenic
966731833 3:183158115-183158137 CACAGGGAGAAGAGGAGAGTGGG - Intronic
966917484 3:184593077-184593099 CAGGGGGAGTGGAGGAGGTTGGG + Intronic
967033626 3:185631437-185631459 GAGAGGGAGGGAGGGGGAGTGGG - Exonic
967055538 3:185825799-185825821 CAGAGAGCGTGGCGGGGAGCGGG - Intergenic
967072423 3:185973296-185973318 ATGAGGGAGGGGAGGGTAGTAGG + Intergenic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967226008 3:187291812-187291834 CAGAGGGAGAGAGGGGGAGAGGG - Exonic
967459776 3:189732252-189732274 CAGGGGTGGTGGAGGGGAGTTGG - Intronic
967969330 3:194987627-194987649 AGGAGGGAGGGAAGGGGAGTGGG - Intergenic
967986948 3:195102080-195102102 GAAAGGGAGGGGAGGGGAGGGGG + Intronic
968005181 3:195237906-195237928 GAGAGGAAGCGGAGGGGTGTGGG - Intronic
968208867 3:196829891-196829913 AAAAGGGAGGGGAGGGGAGAAGG - Exonic
968379724 4:80976-80998 CAGAGGGGGTGGGGGGCAATAGG - Intronic
968599496 4:1502402-1502424 CAGTGGGAGGGGAGGGGCATGGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968738009 4:2308514-2308536 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
969057894 4:4413574-4413596 CAGAGGGAGCAGCGGGCAGTGGG + Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
969370429 4:6727866-6727888 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970369332 4:15391958-15391980 GAGAGAGAGAGGAAGGGAGTGGG + Intronic
970450764 4:16164956-16164978 AAGAGGGAGGAGAGGAGAGTTGG - Intronic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971212321 4:24630514-24630536 GAGAGGAATTGTAGGGGAGTGGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971351979 4:25863090-25863112 CAGAGGGAGCGGCCGGGAGGAGG - Intronic
971412093 4:26384913-26384935 AAGAGAGAGGGGAGGGGAGAGGG - Intronic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
972225978 4:37012504-37012526 CAGAGGCTGGGAAGGGGAGTAGG + Intergenic
972392737 4:38628186-38628208 GAGAGGGAGGGAAGGTGAGTTGG - Intergenic
972810038 4:42573772-42573794 CAGAGTGAGTGGGGAAGAGTGGG + Intronic
975119551 4:70713539-70713561 CAGAGGGAGTGGTGGGGCGGGGG + Intronic
975336072 4:73176556-73176578 CAGAGGCTGGGGAGGGTAGTTGG + Intronic
975568995 4:75792829-75792851 CAGAGGCAGGGCAGGGTAGTGGG - Intronic
975630276 4:76394472-76394494 CAGAGGGTGGGAAGGGTAGTGGG + Intronic
975658251 4:76662909-76662931 GAGAGGGAGAGGAAGGGAGAGGG + Intronic
975673288 4:76802791-76802813 CACAGGGAGGGGAGGGGAAGTGG + Intergenic
975734980 4:77372347-77372369 CGGAGGTAGGGGAAGGGAGTGGG + Intronic
975829723 4:78356643-78356665 CAGATGCAATGGAGGGGAGGAGG + Intronic
976130225 4:81876326-81876348 GAGGGGAAGGGGAGGGGAGTGGG - Intronic
976151427 4:82096356-82096378 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976221820 4:82762204-82762226 GAGGGGGAGAGGAGGGGAGGGGG + Intronic
976675231 4:87695399-87695421 GGGAGGGAGGGGAGGGGAGATGG + Intergenic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
978133332 4:105226605-105226627 CAGAGGGAGGGAAGGAGAGAGGG - Intronic
978243762 4:106548737-106548759 GAGAGGGAGGGGAGTGGAGGGGG - Intergenic
978448379 4:108802747-108802769 CAGAGGAAGTGGAGCTGTGTGGG + Intergenic
978728638 4:111999357-111999379 GGGAGGGAGGGGAGGGGAGGAGG + Intergenic
979544604 4:121925507-121925529 CAGAGGCAGGGGGCGGGAGTAGG + Intronic
979892298 4:126113966-126113988 TAGAGGGAGTGGAAGGGAGGTGG - Intergenic
979956810 4:126963620-126963642 CAGAGGGAGTGTGGGGTAGTAGG - Intergenic
980375962 4:131949554-131949576 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
980580791 4:134747373-134747395 GAGTGGGGGTGGGGGGGAGTGGG + Intergenic
981291536 4:143082198-143082220 GAAAGGGAGGGGAGGGGAGGGGG + Intergenic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
982335136 4:154227971-154227993 CAGAGGGCGGGAAGGGTAGTGGG - Intergenic
982468894 4:155762227-155762249 CAGAGGGTAGGGAGGGGAGGAGG - Intronic
982881238 4:160719888-160719910 GGGAGGGAGGGGAGGGGAGGGGG - Intergenic
982911296 4:161145985-161146007 GAGAGGGGGAGGAGGGGAATGGG - Intergenic
983586594 4:169362305-169362327 CAGAGGCTGGGAAGGGGAGTGGG + Intergenic
983936783 4:173507988-173508010 CAGAGGGAATGTCGGGGAGGGGG + Intergenic
984176639 4:176426705-176426727 CTGAGGGAGTGAAAGGGAGCCGG + Intergenic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703344 4:182832391-182832413 CAGAAGGAGGGGAGAGGAGAAGG - Intergenic
984900930 4:184585838-184585860 CACAGGGGGTGGAGGGGTGGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985140975 4:186840512-186840534 GAGAGGGAGTGGGGAGGAGAAGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
1202751064 4_GL000008v2_random:5102-5124 GGGATGGAGTGGAGTGGAGTGGG + Intergenic
985511537 5:316779-316801 CAGAGGGTGAGGAGGGCGGTGGG + Intronic
985578396 5:684232-684254 CTGAGGGAGCGGAGGGGATCGGG + Intronic
985593327 5:776372-776394 CTGAGGGAGTGGAGGGGATCAGG + Intergenic
985756654 5:1723490-1723512 GAGAGGGAGAGGAGGGGAAAGGG - Intergenic
985855536 5:2421715-2421737 AAGAGGGAGTGGTGGGGAAGAGG - Intergenic
986000557 5:3627758-3627780 GAAAGGGAGTGGAGGAGAGGTGG - Intergenic
986695833 5:10353820-10353842 AAGAGGGAGGGGAGAGGAGGAGG - Exonic
987061678 5:14249380-14249402 CAGAGTGAGTGGAGTGGGGGAGG + Intronic
987373898 5:17217420-17217442 CAGAGGGAGTGCAGGGGGTGGGG + Intronic
987373909 5:17217452-17217474 TGGAGGGGGTGGAGGGGAGACGG + Intronic
988801210 5:34698180-34698202 GAGAGGGAGGGGAAGGGAGGAGG - Intronic
989818541 5:45765692-45765714 CAAAGGGAGTGGGGAGTAGTGGG + Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990787167 5:59434706-59434728 GAGAGGGAGTGGAGGAGGGGAGG - Intronic
990902929 5:60772636-60772658 GAGAGGGAGGAGAGTGGAGTTGG - Intronic
991064732 5:62412959-62412981 GCGCGGGAGTGGAAGGGAGTGGG + Intronic
991093899 5:62719483-62719505 CAGAGCGAGTGGAGTGGTGGTGG - Intergenic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
991380359 5:66016559-66016581 CAGAGGCTGAGGAGGGTAGTGGG - Intronic
991556573 5:67901577-67901599 CAGAGGGAGTGGTCTGGATTAGG + Intergenic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
992085006 5:73270421-73270443 CAGTGGGAGTGGATGGGGATGGG - Intergenic
992248584 5:74854605-74854627 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
993026410 5:82652214-82652236 CACAGGCTGTGGAGGGTAGTTGG - Intergenic
993701851 5:91128081-91128103 GAGAGGGAGGGGAGGGCATTGGG - Intronic
993768169 5:91889208-91889230 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
994817624 5:104604429-104604451 CAGAGGCAGGGAAGGGTAGTAGG + Intergenic
995289560 5:110435605-110435627 CAGAGGTAGTGAAGGGTAGAGGG - Intronic
995975322 5:118028766-118028788 GAGAAGGAGCGGAGGGGAGAAGG - Intergenic
996354902 5:122584930-122584952 AAGAGGGAGGGGAGAGGAGGTGG + Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
996772303 5:127098284-127098306 TAGAGGTAGAGGAGGGGAGGTGG + Intergenic
997131255 5:131278725-131278747 GAGGGGGAGGGGAGGGGAGGGGG - Intronic
997652676 5:135534173-135534195 CAGAGGCTTTGGAGGTGAGTGGG + Intergenic
997709394 5:135990952-135990974 CAGCGGAAGTGGAGAGCAGTGGG + Intergenic
997727118 5:136131334-136131356 CAGAGTGAGAGGAAGGGAGCGGG + Intergenic
997743441 5:136278061-136278083 GGGAGGGACTGGAGAGGAGTTGG + Intronic
998056555 5:139083138-139083160 AAGAGGGTGTGGAGGGGAAGGGG + Intronic
998127194 5:139632628-139632650 CACAGAGAGTCGAGGGGAGCTGG + Intergenic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998896374 5:146804447-146804469 TAGAGGGGATGGAGGGGAGAGGG - Intronic
998953236 5:147412939-147412961 TAGAGGCAGAGGAGAGGAGTTGG - Intronic
999610346 5:153362458-153362480 CCCAGTGAGTAGAGGGGAGTGGG + Intergenic
1000205697 5:159056407-159056429 TAGAGGGAGAGGTGGGGAGTTGG - Intronic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1001010946 5:168097848-168097870 AATAGGGAGTGGTGGGGACTGGG - Intronic
1001403226 5:171458693-171458715 CAGAGGCAGTGGGGAGGGGTAGG + Intergenic
1001415160 5:171540511-171540533 CAGAGGCAGCACAGGGGAGTCGG - Intergenic
1001604157 5:172948145-172948167 CCCAGGGAGTGGAGAGGACTGGG - Intronic
1001626892 5:173143672-173143694 CAGATGGAGTGGGGTCGAGTGGG + Intergenic
1002001279 5:176197578-176197600 CAGAGGGAGGTGGGGGGAGGGGG - Intergenic
1002080091 5:176732623-176732645 CTGAGGAAGTGGAGGGGTGCAGG - Intergenic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002253060 5:177941391-177941413 CAGAGGGAGGTGGGGGGAGGGGG + Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1002320886 5:178375257-178375279 CTGGGGGAGAGGAGGGGAGGTGG + Intronic
1002736445 5:181391406-181391428 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1002748252 6:83418-83440 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003858259 6:10297739-10297761 TAGAGGGAGAGAAGGGAAGTAGG + Intergenic
1004002046 6:11604814-11604836 AAGAGGGAGGGGAGAGGAGGAGG + Intergenic
1004204081 6:13574959-13574981 CAGTGGGCGTGGAGAGGGGTCGG + Intronic
1004302315 6:14469700-14469722 AAGAGAGAGTGAAGGGGAGGGGG + Intergenic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004334144 6:14748748-14748770 AAGAGGGAGGGGAAGGGAGGTGG + Intergenic
1004374284 6:15078178-15078200 CACAGGTGGTGGAGGGGGGTGGG + Intergenic
1004562235 6:16761520-16761542 AGGAGGGAGGGGAGGGGAGCGGG - Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005971247 6:30763651-30763673 CAGAGGCAGTGGAGGGCTGGGGG - Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006431511 6:34000176-34000198 CAGAGGGAAGGAAGGGGAGGGGG + Intergenic
1006441177 6:34054617-34054639 GAGAGGGACAGGAGGGGAGAAGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006618072 6:35343045-35343067 CAGAGGCAGGGGAGGGGAATGGG - Intronic
1007134494 6:39508003-39508025 AAGAGGGAGGGGAAGGGAGAGGG - Intronic
1007199552 6:40095190-40095212 AAGGGGGATGGGAGGGGAGTTGG - Intergenic
1007616110 6:43180606-43180628 CAAAGGGGGAGGAGGGGGGTGGG - Exonic
1007691246 6:43702922-43702944 CAGAGGGTGGGGAGAGGAGGAGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009811214 6:68669391-68669413 CAGAGGCAGGGAAGGGTAGTGGG - Intronic
1009969530 6:70612312-70612334 CAGAGGGGGTGGTGTGGAGGTGG - Intergenic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1010813541 6:80327912-80327934 GGGAGGGAGGGGAGGGGAGAAGG - Intronic
1010841076 6:80649703-80649725 GAGAGGCAGTGGAGGGGAGCAGG + Intergenic
1012365777 6:98437776-98437798 TAGGGAGAGTGGAGGGGAGATGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1012537761 6:100319852-100319874 CAGAGGATGTGAAGGGTAGTGGG - Intergenic
1012978161 6:105802078-105802100 GAGAGGGAGTGGAAGAGAGGAGG + Intergenic
1013338862 6:109193115-109193137 GGGAGGGAGTGAAGGGGAGTAGG - Intergenic
1013619712 6:111875848-111875870 CAGAGAGAGAGGAGGAGAGAGGG - Intergenic
1014034574 6:116750682-116750704 CAGAGAGAGTGGTGGAGAGAGGG + Intergenic
1014078512 6:117264418-117264440 CAGAGGGCTTGGTGGGGGGTAGG + Intergenic
1014226603 6:118855507-118855529 TAGAGGGAGGGGGGGAGAGTAGG - Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014644390 6:123954991-123955013 CAGAAGGGGAGGAGGGGAGAAGG + Intronic
1014703251 6:124715403-124715425 CACAGGGAGGGGAGAGGAGAAGG - Intronic
1014878707 6:126694651-126694673 GAGAGAGAGTGGAGGGGAGAGGG + Intergenic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1015516890 6:134091379-134091401 AAGAGGGAGTGGAGGAGGGTTGG + Intergenic
1015840653 6:137473415-137473437 CAGAGGGAGGGGAGGGGCGGAGG + Intergenic
1015876770 6:137830469-137830491 GAAAGAGAGTGGAAGGGAGTTGG - Intergenic
1015894135 6:137999982-138000004 GAGAGGGAGTGTAGGGGAGAGGG + Intergenic
1016835478 6:148472558-148472580 CAGAGTGGGTGATGGGGAGTTGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017103041 6:150865554-150865576 CAGAGGGTGGGGTGCGGAGTGGG - Exonic
1017458307 6:154623579-154623601 GAGAGAGAGTGGTGGGGGGTGGG + Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017753327 6:157509159-157509181 CAAAGGGCGTAGAGGGGTGTTGG - Intronic
1017774552 6:157670640-157670662 GCGGGGGAGGGGAGGGGAGTAGG - Intronic
1018085846 6:160300518-160300540 CAGAGGAAGTGGGTGGGAGGAGG + Intergenic
1018095860 6:160386578-160386600 CAGAGTGAGGGAAGGGGAGTGGG + Intronic
1018379526 6:163245673-163245695 CAGAGTGTGTGGTGGGGAGAGGG - Intronic
1018597299 6:165495335-165495357 GAGAGGGGGTGGAGGGGAAAGGG + Intronic
1018921614 6:168179705-168179727 CAGGGGAATTGGAGGGGAATTGG + Intergenic
1019054738 6:169214989-169215011 CAGAGGGAAAGAGGGGGAGTTGG - Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019125963 6:169840240-169840262 GAGTGGGAGTGGTGTGGAGTGGG - Intergenic
1019241543 6:170666935-170666957 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1019268326 7:131565-131587 GAAAGGGAGGGGAGGGGAGGAGG + Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019643935 7:2119209-2119231 GAGAGGGAGAGGAGGGCACTGGG - Intronic
1019773971 7:2901451-2901473 CAGATGGAGAGGAGAGGAGAGGG + Intergenic
1020033463 7:4949330-4949352 CAGAGGCTGGGAAGGGGAGTGGG - Intronic
1020108096 7:5431791-5431813 AAGAGAGAGTGGAGGGCAGCCGG - Intronic
1020340174 7:7101519-7101541 CAGAGGGAGCAGGAGGGAGTAGG - Intergenic
1020654992 7:10918319-10918341 CGGAGGGAGTGGAGAGGAAAGGG - Intergenic
1021578272 7:22125318-22125340 CAGCGGGAGTTGCGGGGAGGAGG + Intronic
1022038563 7:26557563-26557585 CAGTGGAAGTGGTGGGGGGTGGG + Intergenic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1022319787 7:29277811-29277833 AAGAGGTAGTGGCGGAGAGTTGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022470542 7:30679440-30679462 CAGAGGGAGTGTGGGCGAGTGGG + Intronic
1023111272 7:36813383-36813405 CAGGGTGAGAGGAGGGTAGTAGG - Intergenic
1023261596 7:38363667-38363689 CAGAGGGAGTGCAGAGGTGGGGG + Intergenic
1023558603 7:41449172-41449194 CAGGAGGAGTGGATGGGAATAGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1023860941 7:44217463-44217485 GAGAGGGAGAGGAGGGGAGGAGG + Exonic
1024097140 7:45991260-45991282 CTGAGGGAGAGGAGAGGAGGGGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024368575 7:48552967-48552989 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
1024617565 7:51128524-51128546 GAGAGGGAGGGGCGGGGAGCAGG + Intronic
1024993545 7:55254594-55254616 CCGTGGGAGTGGAGGGCACTGGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025945085 7:66099191-66099213 TAGAAGGAGTGGAGGAGAGGAGG + Intronic
1026477200 7:70747030-70747052 GAGTGGGAGTGGAAGGGGGTGGG + Intronic
1026517290 7:71084094-71084116 AAAAGGGAGGGGAGGGGAGGAGG - Intergenic
1026531050 7:71197594-71197616 CAGAGGCTGGGAAGGGGAGTGGG - Intronic
1026776668 7:73235090-73235112 CCGAGGAAGTGGGGGGCAGTAGG - Intergenic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027017520 7:74788460-74788482 CCGAGGAAGTGGGGGGCAGTAGG - Intronic
1027070503 7:75157472-75157494 CCGAGGAAGTGGGGGGCAGTAGG + Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027130266 7:75585637-75585659 CAGAGGCTGAGGCGGGGAGTCGG - Intronic
1027509211 7:79058083-79058105 CAGAGGAAGTGGTGGAGAGGGGG + Intronic
1028465359 7:91145500-91145522 GAGAAGGGGTGGAGGGGAGAAGG - Intronic
1029411033 7:100410831-100410853 CAGATGGAGAGGATGGTAGTGGG - Intronic
1029448527 7:100627868-100627890 AATAGGGGGTGAAGGGGAGTAGG - Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030088133 7:105834849-105834871 GTGATGGAGTGGAGGGGAGAGGG + Intronic
1030517980 7:110561856-110561878 CAGAGAGAGTGGGGGGGGGGGGG - Intergenic
1030683908 7:112463478-112463500 CAAAAGGAGTGTAGGGGAGTTGG - Intronic
1030951517 7:115795958-115795980 CAGAGGGAGTGAAGGAGAAGAGG - Intergenic
1031491692 7:122397449-122397471 GAGAGGGAGAGGAGGGGTGGGGG + Intronic
1031992569 7:128207742-128207764 CCTAGGGGGAGGAGGGGAGTGGG - Intergenic
1032058244 7:128701324-128701346 GAGGGGGAGGGGAGGGGAGGGGG + Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032081345 7:128860022-128860044 CAGAGGTAATGAAGGGGGGTTGG - Intergenic
1032255612 7:130294949-130294971 CAGATGGAAGGGAGGGGAATGGG - Intronic
1032417481 7:131747594-131747616 CAGAGGTATTGGAGAGGAGATGG + Intergenic
1032490107 7:132318141-132318163 CAGGGGGACTGGAGCGGAGAGGG + Intronic
1033154580 7:138946022-138946044 AAGAGGGAGGGGAGGAGAGAAGG - Intronic
1033169860 7:139073948-139073970 AAGAAGGAGTGGAGAGGCGTCGG + Exonic
1033354926 7:140591951-140591973 GAGGGGGAGGGGAGGGGAGTAGG - Intronic
1033414345 7:141148996-141149018 AAGATGAAGTGGAGGGCAGTAGG + Intronic
1033712341 7:143960750-143960772 CAGAGGGACTGGAGTGGGGCTGG - Exonic
1034160245 7:148988689-148988711 CAGAGGCAGGGAAGGGGGGTTGG + Intergenic
1034353063 7:150429761-150429783 AAGAGGGAGAGGTGGGGGGTTGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035132425 7:156668454-156668476 CAGAGGCTGTTGAGGGGAGGCGG + Intronic
1035286883 7:157812359-157812381 CAAAGGGAGTGGAGTGGAAAGGG - Intronic
1035506573 8:141161-141183 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1035731269 8:1854990-1855012 GGGAGGGAGTGGAGGGGCCTCGG + Intronic
1035985866 8:4431155-4431177 CAAAGGCAAGGGAGGGGAGTAGG + Intronic
1036400058 8:8400114-8400136 GAGAGAGAGAGGAGGGGAGAAGG - Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037701125 8:21274690-21274712 CACAGGGAGTGGAGGGGGAAGGG - Intergenic
1037742910 8:21621735-21621757 CAGAGGGGGTGGATGGGGGTGGG - Intergenic
1037755256 8:21706161-21706183 AAGAGGGAGGGGAGGAAAGTCGG + Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1037886591 8:22599224-22599246 GAGAGGGTGGGGAGGGGAGAGGG - Intronic
1037929606 8:22870656-22870678 GATAGTGAGTGGTGGGGAGTGGG + Intronic
1038010479 8:23471889-23471911 CAGAGAGAGGGGATGAGAGTAGG + Intergenic
1038136549 8:24792252-24792274 GAGAGAGAGGGGAAGGGAGTGGG - Intergenic
1038860913 8:31388029-31388051 GAGAGGGAGGGGAGAGGAGAGGG - Intergenic
1039212917 8:35236211-35236233 GAGAGGAAGTGGAGAGGAGAGGG - Intronic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039658791 8:39439538-39439560 GAGGGGGAGGGGAGGGGAGGGGG - Intergenic
1040362903 8:46684272-46684294 CAAAGGGAGTGGGGAGTAGTGGG + Intergenic
1040479311 8:47809139-47809161 GAGGGGGAGGGGAGGGGAGAAGG + Intronic
1041423242 8:57692819-57692841 CAGAGGTCATGGAGGGGAGAGGG + Intergenic
1041726835 8:61026018-61026040 CAGGGGGAGGGAAGGGGGGTGGG - Intergenic
1042077785 8:65015312-65015334 CAGGGGCAGAGGTGGGGAGTGGG - Intergenic
1042130498 8:65582779-65582801 GAGGGGGAGGGGAGGGGAGAGGG + Intergenic
1042577193 8:70233489-70233511 TAGAGTGAGTGGAAGGGAATAGG - Intronic
1043053522 8:75409028-75409050 GAGAGGGAGTGGTGGTGAGGAGG - Intronic
1043417250 8:80063913-80063935 CAGAGGGAGGGAGGGGGAGGGGG + Intronic
1043961787 8:86424834-86424856 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1043961799 8:86424856-86424878 GAGGGGGAGGGGAGGGGAGAGGG + Intronic
1044014158 8:87030837-87030859 GAGAGGGAGGAGAGGGGAGGGGG - Intronic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044582887 8:93839839-93839861 CAGAGGCTGGGAAGGGGAGTGGG - Intergenic
1044732476 8:95240481-95240503 CAGAGGGTGGGAAGGGTAGTGGG - Intergenic
1044767981 8:95597188-95597210 GGGAGGGAGAGGAGGGGAGGAGG - Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045560917 8:103261713-103261735 CAGAGGGATGGGGTGGGAGTGGG + Intergenic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046116502 8:109791005-109791027 CAGAGGCTGGGGAGGGTAGTAGG + Intergenic
1046449657 8:114371729-114371751 CGGAGGGAGTGGGGAGGATTGGG - Intergenic
1046449959 8:114375904-114375926 GTGAGGGAGTGGGGGGGAGAAGG - Intergenic
1046559975 8:115823993-115824015 AAGAGGGACTGAAAGGGAGTGGG + Intergenic
1047072818 8:121366025-121366047 CAGAGGCTGGGGAGGGGAGTGGG + Intergenic
1047097651 8:121641476-121641498 CGGAGGGAGTGGGGGGGTGAGGG + Intergenic
1047188106 8:122653968-122653990 GAGAAGGTGTGGTGGGGAGTGGG - Intergenic
1047213656 8:122859589-122859611 TTGAAGGAGGGGAGGGGAGTGGG + Intronic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1047969783 8:130074759-130074781 GAGAGACAGTGTAGGGGAGTGGG + Intronic
1048132072 8:131708828-131708850 CAGAGGCTGGGAAGGGGAGTAGG + Intergenic
1049094600 8:140540935-140540957 CAGAGGGAGGGGAGGAGGGGCGG - Intronic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049180572 8:141219979-141220001 CAGAGGCAGCGGAAAGGAGTTGG + Intronic
1049240492 8:141535319-141535341 CAGAGGGACTGGGGAGGAGGGGG + Intergenic
1049245591 8:141560552-141560574 CAGATGGAGGGCAGGGGAGGAGG + Intergenic
1049310521 8:141931484-141931506 CAGTGGGGGTGGAGGTGTGTTGG + Intergenic
1049575042 8:143386035-143386057 GAGAGGGAGTGGGGAGGGGTGGG + Intergenic
1049582767 8:143420389-143420411 CAGAGGGGCTGGACTGGAGTCGG - Intronic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1050243036 9:3658451-3658473 CAGATGGTGTGTAGGGGTGTAGG + Intergenic
1050278415 9:4024621-4024643 CATAGGGAGTGCATGGGAGGAGG + Intronic
1050304256 9:4291605-4291627 AAAAGGGAGAGGAAGGGAGTAGG + Intronic
1050309620 9:4339799-4339821 AAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050309639 9:4339828-4339850 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050572516 9:6956090-6956112 CAGAGGCTGAGGAGGGTAGTTGG + Intronic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051559545 9:18425146-18425168 GAGAGAGAGTGGAGTGGAGGGGG - Intergenic
1051642686 9:19238466-19238488 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1051642749 9:19238590-19238612 GAGGGGGAGGGGAGGGGAGGAGG - Intronic
1051854238 9:21544469-21544491 AAGAGGGAGTGGGAGGCAGTGGG - Intergenic
1051907982 9:22118329-22118351 GAGAGGGAGTGGAGTGGGGTGGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052862008 9:33443097-33443119 CAGAGGGGGTGGCGTGGGGTGGG + Intronic
1052951916 9:34219948-34219970 AAGGGGGAGGGGAGGGGAGAGGG - Intronic
1053016514 9:34665305-34665327 CGGAGGGAGCGGAGGTGAGGAGG - Exonic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1053641012 9:40080222-40080244 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1053765124 9:41385246-41385268 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1053891091 9:42693701-42693723 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1053932743 9:43124899-43124921 CAGAGCAAGGGGAGGGGAATTGG + Intergenic
1054220607 9:62408062-62408084 CAGAGACAGGGGAGGGGAATCGG - Intergenic
1054230107 9:62501110-62501132 CAGAGACAGGGGAGGGGAATCGG + Intergenic
1054321756 9:63676518-63676540 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1054543740 9:66296408-66296430 CAGAGGGAGTGGGGGTGGGAGGG - Intergenic
1055197780 9:73617675-73617697 GAGAGGGAGCGAATGGGAGTGGG - Intergenic
1055268831 9:74532358-74532380 CAGGAGGAGTGAAGGAGAGTGGG - Intronic
1055978912 9:81981522-81981544 TAGATGGAGTGGAGGGAGGTAGG - Intergenic
1056067522 9:82952587-82952609 CTGAGGGATGGGAGGAGAGTAGG + Intergenic
1056210944 9:84364668-84364690 CAGAGGCTGGGGAGGGTAGTGGG - Intergenic
1056683536 9:88740980-88741002 CAGTGTGAGTGAAGGGCAGTGGG + Intergenic
1057275357 9:93673444-93673466 CAGAGGGCGTGGAGCAGAGAGGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1057767434 9:97934434-97934456 GAGGGGGAGGGGAGGGGAGGGGG + Intronic
1058139437 9:101342375-101342397 GAGAGGGAGAGGAGGGGAAGGGG + Intergenic
1058312984 9:103529244-103529266 TAGAGGGAGGGAAGGGGAGATGG - Intergenic
1058471499 9:105283932-105283954 CAGATGAAGGGAAGGGGAGTAGG + Intronic
1058679876 9:107431514-107431536 AAGAGGGAGAGGAGGGGATTGGG - Intergenic
1058768282 9:108205026-108205048 CAGAGGTTGTGAAGGGTAGTAGG + Intergenic
1059132321 9:111766057-111766079 CAGAGGCAGGGAAGGGTAGTAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059791871 9:117649025-117649047 CGCTGGCAGTGGAGGGGAGTAGG - Intergenic
1059960810 9:119562701-119562723 AAAGGGGAGTGGTGGGGAGTAGG + Intergenic
1060123991 9:121024223-121024245 GGGAGGGAGGGGAGGGGAGGGGG + Intronic
1060124027 9:121024283-121024305 GAGGGGGAGGGGAGGGGAGCGGG + Intronic
1060147992 9:121268393-121268415 CAAAGAGTGTGGATGGGAGTTGG + Intronic
1060551979 9:124489981-124490003 GAGAGGGAGGAGTGGGGAGTGGG - Intronic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1060697085 9:125718565-125718587 CAGAGGTATTGGTGGGGAGAGGG + Intergenic
1060706466 9:125806286-125806308 CAGAGGGAGGGAGGGAGAGTAGG + Intronic
1060745463 9:126127998-126128020 AAGAGGGAGTGGTGGGGAAAGGG + Intergenic
1060748125 9:126151093-126151115 TAGAGACAGTGGATGGGAGTTGG + Intergenic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061009531 9:127946749-127946771 AAAAGGGAGTGGAGGGAAGCTGG + Intronic
1061194658 9:129101079-129101101 CAGGGGGTGTGGAGGCGGGTGGG + Intronic
1061613460 9:131763690-131763712 CAGACGGTGTGGGGTGGAGTCGG - Intergenic
1061824391 9:133248758-133248780 CACCGGGACTGGAGAGGAGTGGG + Intergenic
1061900158 9:133668641-133668663 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1061900206 9:133668761-133668783 GAGAGGGAGGGTAGGGGAGAGGG - Intronic
1062019018 9:134307473-134307495 CACAGGCAGTGGAGAGGGGTCGG + Intergenic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062328768 9:136026460-136026482 CAGAAGGAGAGGAGGAGAGGAGG + Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1202788783 9_KI270719v1_random:63297-63319 CAGAGGGAGTGGGGGTGGGAGGG + Intergenic
1203346899 Un_KI270442v1:41345-41367 GAGATGGAGTGGAGTGGAGTGGG + Intergenic
1203601735 Un_KI270748v1:16169-16191 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185581241 X:1212975-1212997 AAGGGGGAGGGGAGGGGAGTGGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1187103502 X:16218620-16218642 GAGAGGTAGTGGAGGGGGGCAGG + Intergenic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187296283 X:18004130-18004152 AAGAGGCAGGGGAGGGGAGACGG - Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187505404 X:19874802-19874824 GAGAGGGGGTGCAGGGGAATGGG + Intronic
1187593436 X:20744084-20744106 GTGAGGGAGTGGAGGAGAGGTGG - Intergenic
1187826046 X:23334329-23334351 CGAAGGGAGGGGAGGGGACTGGG + Exonic
1188275145 X:28191529-28191551 CAGAGGCTGGGAAGGGGAGTAGG - Intergenic
1188572837 X:31610017-31610039 CAGAGAGAGAGGAATGGAGTGGG - Intronic
1188625508 X:32279654-32279676 CAGAGGCTGTGAAGGGTAGTGGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189725992 X:43968784-43968806 AAGTGGTAGTGGAGGGGAATTGG + Intronic
1190037340 X:47037942-47037964 CAGAGGGTGGGAAGGGTAGTGGG - Intronic
1190044361 X:47100433-47100455 TAGGGGCAGTGGAGGAGAGTTGG - Intergenic
1190109721 X:47582247-47582269 GAGAGGGAGAGGAGGCGGGTGGG + Intronic
1190184810 X:48224283-48224305 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190197382 X:48331144-48331166 CAGGGGGAGAGGAGAGGAGAGGG + Intergenic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190664123 X:52681554-52681576 CAGGGGGAGAGGAGAGGAGAGGG + Intronic
1190675299 X:52776868-52776890 CAGGGGGAGAGGAGAGGAGAGGG - Intronic
1190888290 X:54548053-54548075 CAAAGACAGTGGAGGGGAATGGG + Intronic
1191072993 X:56421633-56421655 GAGAGTGGGTGCAGGGGAGTGGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193204924 X:78736883-78736905 CAGAGGCAGTGGACTGGAGGGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194783316 X:98051405-98051427 CATAGGGAGTGGTGGGGAGGTGG - Intergenic
1195027711 X:100894626-100894648 TAGAGGCAGTGGGGAGGAGTGGG + Intergenic
1195592547 X:106647135-106647157 CAGAGGCTGGGAAGGGGAGTAGG - Intronic
1195906356 X:109848511-109848533 TGGAGGGGGTGGAGGGGAGCAGG - Intergenic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1196401384 X:115320517-115320539 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1196704992 X:118709825-118709847 CTGAGTGACTGGAGTGGAGTGGG - Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1196919378 X:120569871-120569893 CAAAGGGAGTGAAAGGGAGCAGG + Intronic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197720624 X:129742363-129742385 GGGAGGGAGTGGAGGGGGGAGGG - Intronic
1198820713 X:140645283-140645305 GCAAGGGAGTGGTGGGGAGTAGG + Intergenic
1198981361 X:142399958-142399980 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199654592 X:149981748-149981770 CAGAGGAAGAGGTGGGGTGTGGG - Intergenic
1199857351 X:151771053-151771075 CAGAGGGTGGGGAGGGGTGGGGG + Intergenic
1200108885 X:153728994-153729016 GAGAGGGAGTGGAGAGGGGACGG + Intronic
1200169257 X:154060552-154060574 GGGAGGGAGGGGAAGGGAGTGGG + Intronic
1200181985 X:154156210-154156232 CATAGGGAGTTGTGGGGAGGAGG - Intronic
1200187634 X:154193324-154193346 CATAGGGAGTTGTGGGGAGGAGG - Intergenic
1200193283 X:154230464-154230486 CATAGGGAGTTGTGGGGAGGAGG - Intronic
1200199038 X:154268268-154268290 CATAGGGAGTTGTGGGGAGGAGG - Intronic
1200334863 X:155339831-155339853 CAGAGGCAGGGGAGGCGAGGAGG - Intergenic
1200351603 X:155501390-155501412 CAGAGGCAGGGGAGGCGAGGAGG + Intronic
1201132345 Y:10962756-10962778 GAGGTGGAGTGGAGTGGAGTGGG - Intergenic
1201146581 Y:11068012-11068034 GAGAGGGAGAGGAAGGGAGAGGG + Intergenic
1201457279 Y:14182466-14182488 TGGAGAGAGTAGAGGGGAGTTGG - Intergenic