ID: 1129258743

View in Genome Browser
Species Human (GRCh38)
Location 15:74350676-74350698
Sequence CTCCATTTACATAAGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129258740_1129258743 23 Left 1129258740 15:74350630-74350652 CCATAGGGCGTATGCTGTAAATG 0: 1
1: 6
2: 12
3: 14
4: 773
Right 1129258743 15:74350676-74350698 CTCCATTTACATAAGGCATATGG 0: 1
1: 1
2: 0
3: 13
4: 154
1129258739_1129258743 28 Left 1129258739 15:74350625-74350647 CCTCTCCATAGGGCGTATGCTGT 0: 2
1: 5
2: 10
3: 27
4: 101
Right 1129258743 15:74350676-74350698 CTCCATTTACATAAGGCATATGG 0: 1
1: 1
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129258743 Original CRISPR CTCCATTTACATAAGGCATA TGG Intronic
902827388 1:18986032-18986054 CCCCATTTGCGGAAGGCATATGG + Intergenic
908084458 1:60615937-60615959 CCCCATTTAGCTAAAGCATATGG + Intergenic
909498159 1:76302981-76303003 CTTCATTTACATCAGGCTAATGG - Intronic
912526515 1:110287513-110287535 ATCCCTTTACACTAGGCATAAGG + Intergenic
917283732 1:173403467-173403489 CTGCACTTACATAAAGCATGGGG - Intergenic
917818430 1:178735278-178735300 CTTCATTTACATAAAGTTTAGGG + Intronic
918565664 1:185928062-185928084 CTCCACTTAGATAAGATATAAGG - Intronic
919663831 1:200273353-200273375 CTTCATATTCATAAGGCACAAGG + Intergenic
920748420 1:208651016-208651038 CTCTATTTTCCTAAGGGATAGGG - Intergenic
922223587 1:223626976-223626998 CTCCATTGATGTGAGGCATATGG - Exonic
922819602 1:228475009-228475031 CTCCTTTTATATAAGACACAGGG + Intergenic
924736500 1:246761621-246761643 TTCCATTTACATGAGGCACTTGG - Intronic
1065485433 10:26232359-26232381 GTCAATTTACATAAAGCATGAGG - Intronic
1067559303 10:47293734-47293756 CTCCATTTACCAAAGTGATAAGG - Intergenic
1068074985 10:52241589-52241611 CTTCATGTACAGAAGGCTTAGGG - Intronic
1068450542 10:57180950-57180972 CTACATTTTCTTAAGGCAAAGGG - Intergenic
1069878502 10:71577649-71577671 GTCCATTTGAATAAGGGATATGG + Intronic
1070531110 10:77338298-77338320 CACCATTTCCAGAAGGCATGAGG - Intronic
1079455706 11:20634329-20634351 CTCCACTTACCCAAGGCAGATGG - Intronic
1081074701 11:38656485-38656507 CTCAATATACATCAGGCAAATGG + Intergenic
1084628975 11:70333193-70333215 CTCCATTGAGATTGGGCATAGGG + Intronic
1086081301 11:82905032-82905054 CTCCTTTTAGACAAGCCATATGG - Intronic
1091581019 12:1789783-1789805 CTAAATTTACCTAAGGCAAAAGG - Intergenic
1092555721 12:9559215-9559237 CTCCACTTCCATAGGGCATTTGG - Intergenic
1093663067 12:21779785-21779807 CTCCATTTACCCAATGAATAAGG + Intergenic
1094460340 12:30691012-30691034 CTCCATTTACAAAAGGATAAAGG - Intronic
1095748803 12:45688624-45688646 ATCCATTCACATAAGACATTTGG - Intergenic
1098688291 12:73453441-73453463 CTCCATTCAGCTAATGCATATGG + Intergenic
1099865413 12:88273903-88273925 CTCCATTTAATAAAGGCCTATGG + Intergenic
1101478186 12:105071468-105071490 TTCCATTTTCATATGGCATTAGG - Intronic
1102004028 12:109577441-109577463 CTCCATCCCCATACGGCATATGG - Intronic
1104215928 12:126733884-126733906 CTCCCATTACATGGGGCATATGG - Intergenic
1105247066 13:18662965-18662987 CTCCATTTACTTCAGACACAAGG - Intergenic
1108054117 13:46468855-46468877 TTCCATATACATAATGTATAGGG + Intergenic
1108141086 13:47422167-47422189 CTCCATTTACAGAAGACACCTGG + Intergenic
1110200759 13:72847418-72847440 CTACATTATCATATGGCATAAGG + Intronic
1113209316 13:107956846-107956868 CTCCATGTACATAACCCAGAGGG + Intergenic
1113215670 13:108038336-108038358 ATCAATTTACATAAGGGTTACGG - Intergenic
1114970559 14:28022194-28022216 ATCAATTTACATATGGCCTAAGG - Intergenic
1117935264 14:60897547-60897569 CTTCATTTAAATCATGCATAAGG - Intronic
1120303189 14:82734286-82734308 CTCCATTTATATCATGCTTATGG - Intergenic
1120378152 14:83735724-83735746 CACAATTCACAAAAGGCATAAGG + Intergenic
1120613309 14:86670218-86670240 TTCCATGTACATATGGCATGAGG + Intergenic
1120992767 14:90392748-90392770 CTATTTTTACATAAGGAATATGG - Intergenic
1121768689 14:96510870-96510892 CTCCTTTTTCACAAGGTATACGG - Intronic
1122588377 14:102826913-102826935 CTCCATTTGCCCAAGGCACATGG - Intronic
1128091137 15:64919698-64919720 CTCCATTCACAGAAGGCTTGTGG + Intronic
1129102918 15:73283164-73283186 CTCCATATACAGAAGTCACATGG - Intronic
1129258743 15:74350676-74350698 CTCCATTTACATAAGGCATATGG + Intronic
1131738447 15:95360134-95360156 CTTCATTTTCATAAAGCAAACGG - Intergenic
1134456487 16:14399117-14399139 CCTCATTTACATATTGCATACGG + Intergenic
1134757142 16:16677438-16677460 CACCATTTAGATAAGAAATATGG - Intergenic
1134988926 16:18681725-18681747 CACCATTTAGATAAGAAATATGG + Intergenic
1140947739 16:79785876-79785898 CTCCAGTTCCAGAAGGCATCTGG - Intergenic
1143693203 17:8588325-8588347 CTCCACTTACATGAGCCATAGGG + Intronic
1151264643 17:72945406-72945428 CTCCATTTACAGCAAGCTTAAGG + Intronic
1153352987 18:4102300-4102322 TTCCATTTACACAAACCATAAGG - Intronic
1153797649 18:8639841-8639863 TTCCACTTACATGAGGTATATGG + Intergenic
1155441667 18:25868859-25868881 CTTCATTTTTGTAAGGCATAGGG - Intergenic
1155808878 18:30206743-30206765 CTCCACTGACATTAGGCAGAGGG + Intergenic
1155895151 18:31315979-31316001 CTCAATTAAGAAAAGGCATAGGG + Intergenic
1157024576 18:43827674-43827696 ATCCATATACACAAGCCATATGG - Intergenic
1159307519 18:66663839-66663861 GTCCATTTCCATAATGCATAAGG + Intergenic
1159561499 18:70000196-70000218 TTCCATTTACACAAGTCAGATGG + Intergenic
1166010431 19:39937081-39937103 CTCTAATTACAAGAGGCATATGG - Intergenic
928561645 2:32494599-32494621 CCCCATTAATATAAGGAATAGGG + Intronic
930397490 2:50842063-50842085 CTCCATTTACAGAAGCCATGTGG + Intronic
935818733 2:106872530-106872552 CTCCATTTACGTTAGACACAGGG - Intronic
936876868 2:117200685-117200707 CCCCTTTTACATGAGGAATATGG - Intergenic
938979299 2:136510452-136510474 CCACATTTGCATAAGGCCTATGG - Intergenic
940354111 2:152719180-152719202 CTCCACTTAGAAAAGGCAAAGGG - Intronic
940667313 2:156624701-156624723 CTACATTTTCACAAGGCAGAGGG + Intergenic
942266480 2:174231933-174231955 CTCATTTTACAAAAAGCATATGG - Intronic
943887378 2:193238412-193238434 CTACATATATATATGGCATATGG + Intergenic
943888485 2:193254451-193254473 CTACATTTATAAAAGGCAAAAGG - Intergenic
945714386 2:213339083-213339105 ATCAAATTACATGAGGCATATGG - Intronic
945944864 2:215985473-215985495 CTTCATTTACATAAGGCTTCTGG - Intronic
946612263 2:221471916-221471938 CTCCATTTACAGTAGGAGTAGGG - Intronic
948162824 2:235839229-235839251 TTCCATTTAAATATGGCACAAGG + Intronic
948719600 2:239890522-239890544 CTGCATTTAAATAAAGCAGAGGG + Intergenic
1169769966 20:9189756-9189778 CTCCATCTTCATATGGCAGAAGG + Intronic
1170259235 20:14384595-14384617 CTCCATTTACACTTGGCAGATGG - Intronic
1174271281 20:49371007-49371029 CTCTTCATACATAAGGCATAAGG - Exonic
1174716183 20:52761401-52761423 GTCAATTTACATAGGGCACAGGG - Intergenic
1176454288 21:6895020-6895042 CTCCATTTACTTCAGACACAAGG - Intergenic
1176832462 21:13760068-13760090 CTCCATTTACTTCAGACACAAGG - Intergenic
1177186750 21:17805916-17805938 ATCCACTTACATGGGGCATATGG + Intronic
1178766439 21:35457125-35457147 CTCCATTGAGATAATGCCTAAGG - Intronic
1181549167 22:23627011-23627033 CTTCATTAACATAAGGCTGATGG + Intronic
1181723586 22:24795282-24795304 CACCATTCACATTAGGCAAAAGG + Intergenic
1183312538 22:37118522-37118544 TTCCATATACATAAGGCTTTAGG + Intergenic
950911741 3:16602841-16602863 CTCCATTGAAATTAGGAATAAGG + Intronic
951837901 3:27002960-27002982 TTCCCTTGACATAAGGGATATGG - Intergenic
952252459 3:31667744-31667766 ATTCATTTACATATGGCTTATGG - Intronic
956273560 3:67473796-67473818 CTCCATTTACTTAAAGCAAGTGG - Intronic
958856365 3:99390944-99390966 CTTCATTTACATATTGCCTATGG - Intergenic
959806525 3:110561588-110561610 CTCCATTTACTTAAGGGCTAGGG + Intergenic
962027676 3:131565995-131566017 CTCCATTTTCATGTGACATAGGG + Intronic
964230042 3:154455196-154455218 CTCCATTTACATAAATCGTGGGG + Intergenic
965448931 3:168812765-168812787 CTCCATTTAAATAAATCATTAGG + Intergenic
965455792 3:168898332-168898354 TTGCATTTACATAAAGCCTATGG + Intergenic
965656970 3:170997481-170997503 CTCCTTTAACATAAGATATATGG + Exonic
970608541 4:17704796-17704818 CTCCCTTTGGAGAAGGCATAAGG + Intronic
970989038 4:22191592-22191614 TTCCATTTCAATAAGGCAGAGGG + Intergenic
972870517 4:43292201-43292223 CACCATTTACACAAGCAATAAGG - Intergenic
974099260 4:57398838-57398860 CTCCATTTACCTACTGAATAAGG + Intergenic
974527631 4:63063612-63063634 CTCAACTTACATAAGGTATAAGG - Intergenic
976653467 4:87461080-87461102 TTCATTTTACATAAGACATAAGG - Intergenic
977750254 4:100601343-100601365 CTCCATGTATGTAAGGAATATGG - Intronic
977752733 4:100628788-100628810 GTCAATTTACATAAAGTATATGG + Intronic
979151533 4:117322582-117322604 CACAATTTACAAAATGCATATGG + Intergenic
981129952 4:141147546-141147568 CTCTATGTACACAAGGCAGAGGG + Intronic
982589978 4:157296114-157296136 CTCCACTTACAAAATGTATATGG + Intronic
985022643 4:185708581-185708603 CTTCATATACATTTGGCATAAGG + Intronic
986889866 5:12289333-12289355 GTCCATTTAAATAAGGCAGAGGG + Intergenic
987504693 5:18752758-18752780 CTTCATTTTCCAAAGGCATATGG - Intergenic
988657659 5:33229782-33229804 CTCCATCTCCATCAGGCATCGGG - Intergenic
989793438 5:45436407-45436429 CTACATTTACATACTTCATATGG + Intronic
993514933 5:88819796-88819818 GTTCATTTACATACTGCATACGG + Intronic
994944882 5:106374737-106374759 CTGCATTTTCATAAGACATTTGG + Intergenic
996596101 5:125204457-125204479 CTCCATTTACATAGGGCATATGG + Intergenic
996815287 5:127567177-127567199 CTCCAGAAACAGAAGGCATATGG + Intergenic
998562302 5:143183045-143183067 TTTCATTTGCATGAGGCATAAGG - Intronic
999218160 5:149953505-149953527 CTGAATTTAAATAAGGAATAAGG + Intergenic
1002155715 5:177277366-177277388 CTTCATTTACATATTACATATGG + Intronic
1005591242 6:27330410-27330432 CTCCATTTACATAAGTTGTAAGG + Intergenic
1008888751 6:56460385-56460407 CTTCAATTAAATAAGGCATGGGG + Intronic
1009779636 6:68253802-68253824 TTCCATAAACATAAGGCAAAGGG - Intergenic
1010945025 6:81963888-81963910 CTCCATTCTCCTAAGGCATTGGG - Intergenic
1012975118 6:105772355-105772377 CTTCATTTCCATAAGACATATGG - Intergenic
1017838432 6:158201544-158201566 CTGCACTTACATAAGGTATTTGG + Intergenic
1023202040 7:37708772-37708794 ACCCATTTAAATAAGTCATAGGG + Intronic
1027586382 7:80063694-80063716 CTACATTTTCATCAGGCTTATGG - Intergenic
1028720202 7:94021610-94021632 TTCCATATACATAAGGAATTAGG - Intergenic
1028953244 7:96660526-96660548 CTCAGTTTAAATAAAGCATAAGG - Intronic
1032628271 7:133617639-133617661 CATCATCTACATAAAGCATATGG + Intronic
1039456855 8:37712903-37712925 CTCCCTTTCCATAAGGGAGAGGG - Intergenic
1039733706 8:40307082-40307104 CTTCATTTTCATAAGGAATTTGG + Intergenic
1041354979 8:56990894-56990916 CTACATTTACATAGGGCACTAGG + Intronic
1041757747 8:61332588-61332610 CTCCATTTACATAAGAGTAAAGG - Intronic
1042710922 8:71716317-71716339 TTTGATTTACATAGGGCATAGGG + Intergenic
1045150143 8:99396944-99396966 TTCCATTTTTATCAGGCATATGG + Intronic
1046298960 8:112260286-112260308 CTACATTGTCATAAGGCCTAAGG - Intronic
1046421836 8:113995500-113995522 TCCCATATAAATAAGGCATATGG - Intergenic
1047907423 8:129487269-129487291 CTCCATTTACACCAGGGATGAGG + Intergenic
1050104930 9:2155684-2155706 CTCCATGTGCTTATGGCATATGG + Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1052015368 9:23458086-23458108 CTGCATTTAAAAAAGGCAGATGG + Intergenic
1054819218 9:69505252-69505274 CTCCCTTAACATAAGGCTTTGGG + Intronic
1054876134 9:70098083-70098105 ATCCATTTCCATAAAGTATATGG - Intronic
1056039212 9:82644011-82644033 TTACATGTATATAAGGCATAGGG - Intergenic
1056429335 9:86511767-86511789 CTCCATTTACAAATGGGAGATGG + Intergenic
1056478805 9:86980104-86980126 CTCTTTTTGCATAAGGCTTAAGG - Intergenic
1058240755 9:102555205-102555227 CTCCATTTACAGTAGGCACAAGG + Intergenic
1059733682 9:117081045-117081067 CTCCAATTAGAAAAGGCATATGG + Intronic
1059851933 9:118351634-118351656 CTCCATTAATATAGGGGATAAGG - Intergenic
1185933395 X:4228668-4228690 CTCCAATTATATAAAGCAAAGGG + Intergenic
1186657256 X:11627307-11627329 CTTCATTTACATAAGTTCTATGG - Intronic
1186837150 X:13449515-13449537 CATCATTTACATAATGCCTATGG + Intergenic
1190650671 X:52565574-52565596 CTCCCTTTATATAAGGCTTAAGG + Intergenic
1192171321 X:68856963-68856985 CTCCATTTTCAAAAGCCCTATGG - Intergenic
1192833591 X:74776171-74776193 CTTCATTTACTTAAGGTACATGG - Intronic
1194205553 X:91007153-91007175 CTCCACTTAAATGAAGCATATGG - Intergenic
1194819645 X:98490036-98490058 GTCCATTTACAAAAGTGATAAGG + Intergenic
1196708142 X:118734742-118734764 ATCAATGTTCATAAGGCATATGG + Intronic
1198795226 X:140387414-140387436 CTCCAGTTACATATGACAAATGG + Intergenic
1199546266 X:149009939-149009961 CTACATTCACATATGGCATTGGG + Intergenic
1201714343 Y:17027923-17027945 CTCCAGTTATATAAAGCAAAGGG + Intergenic
1201938012 Y:19428321-19428343 CTTGATTTACATAAGGCACAAGG + Intergenic