ID: 1129259201

View in Genome Browser
Species Human (GRCh38)
Location 15:74354667-74354689
Sequence TTACCGGGTTTAAAATTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129259201 Original CRISPR TTACCGGGTTTAAAATTGGT GGG (reversed) Intronic
900954532 1:5878305-5878327 TTGCCGGCGTTAAAATTGGATGG - Intronic
908508627 1:64831519-64831541 TTACCGGGTTTAATTTTGCATGG - Exonic
909839883 1:80306784-80306806 TTACAGGCTTTTAAATTTGTAGG - Intergenic
920745238 1:208621011-208621033 TTTCCTGGTTTAATCTTGGTAGG - Intergenic
922184782 1:223264700-223264722 TTCCCGGATTTAAACTTGATGGG - Exonic
1081356551 11:42121226-42121248 TTACCGGATTCGAAATTGGTGGG - Intergenic
1083058157 11:59842959-59842981 TTTCTGGGTTTAAAATTCTTAGG + Intronic
1085160877 11:74343388-74343410 TTACCAGGTTTTAAATGGATTGG - Exonic
1092550756 12:9496750-9496772 TTACCCAGTCTAAAATTGATGGG - Intergenic
1092841428 12:12545881-12545903 TTACCGGCTTTGAATTTGGTGGG - Intronic
1093933651 12:24978854-24978876 TTTCCAGGTTTAAGATTGGTTGG - Intergenic
1099483429 12:83196859-83196881 TTATCTGGTGTAAAAATGGTTGG - Intergenic
1115004113 14:28460200-28460222 TTGCCTGTTTTAAAATTGGGTGG - Intergenic
1118926452 14:70194378-70194400 TTACCTAGTTTATCATTGGTGGG + Intergenic
1119325568 14:73758222-73758244 TTCCCGGGTTGAGAATTCGTAGG - Intronic
1129259201 15:74354667-74354689 TTACCGGGTTTAAAATTGGTGGG - Intronic
1137452956 16:48594276-48594298 TTTCCTGTTTTAAAATTTGTGGG + Intronic
1147642412 17:42011773-42011795 TTACCTGGTTTTAAATTCTTAGG - Intronic
1158632524 18:59128290-59128312 TTACCGGGTATAATATTGAGAGG + Intergenic
1158641024 18:59203695-59203717 TTGCCGGCTTCACAATTGGTAGG + Intergenic
1161661454 19:5549144-5549166 TTACCGGATTTGAAATTGGTGGG - Intergenic
1164707334 19:30329820-30329842 TTACTGGGTCTACACTTGGTGGG + Intronic
928768148 2:34672376-34672398 TTACTGGGGTTAAATCTGGTTGG - Intergenic
929074812 2:38072133-38072155 TTACTGGGTTTAAAATGAGGCGG - Intronic
929480297 2:42300219-42300241 TTACCAGGTTCAAAATGGGAAGG - Intronic
929931697 2:46262067-46262089 TTACAGTGTTTAAAATTTGGGGG + Intergenic
930327584 2:49939641-49939663 TTTCCTGGCTGAAAATTGGTGGG - Intronic
933603477 2:84357244-84357266 TTTCCTGGTTTAGACTTGGTAGG - Intergenic
934879694 2:97965150-97965172 TTACCGGGACTGAAATGGGTGGG - Intronic
941102616 2:161312884-161312906 TTACTGGGTTTCAAAATGCTGGG - Intronic
944102253 2:196039968-196039990 TTCCCTGGTTCAATATTGGTAGG - Intronic
944573917 2:201072900-201072922 TCAAGGGGTTGAAAATTGGTGGG + Intronic
948206463 2:236165067-236165089 TTGCCAGGTTTAAAATAGGAGGG - Intergenic
1173683346 20:44903477-44903499 TTTGTGGGTTTAAAAATGGTGGG + Intronic
1184581407 22:45420360-45420382 GTACAGGGTTTAAAATAGGGGGG - Intronic
963392141 3:144678840-144678862 TGACTGGGTTTAAAGTTAGTGGG + Intergenic
965067379 3:163867937-163867959 CTACCAGGTTTAAAATTTGTAGG + Intergenic
972276357 4:37561423-37561445 TAACAGGGTTTAAAACTGGCTGG + Intronic
974204502 4:58683282-58683304 ATATGAGGTTTAAAATTGGTGGG - Intergenic
974396930 4:61349144-61349166 TTACCATGTGTAAAATTGGCAGG + Intronic
978236597 4:106468263-106468285 CTTCCTGGTTTAGAATTGGTAGG + Intergenic
978255061 4:106682992-106683014 TTACGGGGTGAAAAATTGATTGG - Intergenic
980765229 4:137294120-137294142 TTACTGGGGTTGAAATTGGAGGG + Intergenic
990849281 5:60183165-60183187 TTACCAGGAACAAAATTGGTTGG + Intronic
994506993 5:100655966-100655988 TTTCCAGGTTTAAGATTTGTAGG - Intergenic
1003213915 6:4091462-4091484 TTCCTGTGTTCAAAATTGGTGGG - Intronic
1005712189 6:28513025-28513047 CTACTGTGTTCAAAATTGGTGGG - Intronic
1005990906 6:30901366-30901388 TTAAAGGGTTCAAATTTGGTTGG + Intergenic
1009659581 6:66593252-66593274 TTACTGGGTGTCAAATTGATTGG - Intergenic
1027979332 7:85197400-85197422 TTTTCTGGTTGAAAATTGGTTGG - Intergenic
1033831874 7:145264534-145264556 TTACAGTGTTTAATATTGATTGG - Intergenic
1038807723 8:30810795-30810817 TTAACGGGTGTAATGTTGGTCGG - Intronic
1040690082 8:49926906-49926928 TTACCGATTTTTTAATTGGTTGG - Intronic
1041647258 8:60265521-60265543 TTTGCTAGTTTAAAATTGGTGGG - Intronic
1043289471 8:78579286-78579308 TTACCTGGTTTAAATTTCTTTGG - Intronic
1047453191 8:124985472-124985494 TTACTTGTTTTAAAATTGTTAGG + Intergenic
1048954013 8:139519245-139519267 TTACCTGGTTTCAAATAGCTAGG - Intergenic
1052243143 9:26299243-26299265 TTACCGATTTTATAAATGGTAGG - Intergenic
1053728855 9:41031898-41031920 TTCCCTTGTTTAAAATGGGTTGG - Intergenic
1056982657 9:91329956-91329978 TTACAGTGTTTAAAAGTGTTAGG - Intronic
1058847743 9:108978727-108978749 ATTCCTGGTCTAAAATTGGTGGG - Intronic
1186560815 X:10610928-10610950 TTACCTGGTTAAAATTTAGTTGG + Intronic
1194290042 X:92060714-92060736 TTACCTAGTTTAACATTGATGGG + Intronic
1195444083 X:104931121-104931143 TTCCTGGGATTAAAAATGGTGGG + Intronic
1200607553 Y:5285288-5285310 TTACCTAGTTTAACATTGATGGG + Intronic
1201050514 Y:9928790-9928812 CTTCCTGGTTTAAAATTGGGCGG - Intergenic