ID: 1129260280

View in Genome Browser
Species Human (GRCh38)
Location 15:74362982-74363004
Sequence ATGCCCTTTCAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 9, 2: 30, 3: 74, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129260280_1129260282 2 Left 1129260280 15:74362982-74363004 CCTTCACTCTTCTGAAAGGGCAT 0: 1
1: 9
2: 30
3: 74
4: 217
Right 1129260282 15:74363007-74363029 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129260280 Original CRISPR ATGCCCTTTCAGAAGAGTGA AGG (reversed) Intronic
900911051 1:5597263-5597285 AGGACCTTTCAGGAGATTGAAGG - Intergenic
904579468 1:31530516-31530538 ATTTCCTTGCAGAAGAGTCATGG - Intergenic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
906156528 1:43617253-43617275 ATCACCTATCAGAAAAGTGATGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910732381 1:90412180-90412202 ACCTCCTTTCAGAAGAGTCATGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
911696228 1:100893376-100893398 ATGCCCTTGGAGCAGTGTGAAGG - Intronic
911819384 1:102397968-102397990 GAGTCCTTTCAAAAGAGTGATGG + Intergenic
914997125 1:152553681-152553703 ATGCCCTTTCCTAGGGGTGATGG - Intronic
916538368 1:165727098-165727120 ATGCCCCTTCATAAGGGAGAAGG - Exonic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917645510 1:177025106-177025128 ATGCCCTCTGTGAAGAGCGATGG - Intronic
917873831 1:179267078-179267100 ATCCACATTCAAAAGAGTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919254258 1:195100507-195100529 ATCCCCTTTGAGAAGGGTAAGGG + Intergenic
920238083 1:204522804-204522826 AAGCCTTTTCAGAAGCATGAGGG + Intronic
920565205 1:206967528-206967550 ATTCCTTTTCAGGAGAATGAAGG + Intronic
921571364 1:216783057-216783079 ATTCCCACTCAGAAGAGTTAGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
924498190 1:244610711-244610733 ATGCGCTTTCATGAAAGTGATGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1065778366 10:29143364-29143386 CTTCCATTTCAGAAGAGTGGTGG + Intergenic
1065778960 10:29149007-29149029 AAGGCCTTGCAGAAGAGTAAGGG - Intergenic
1066976426 10:42372236-42372258 ATACCCATCCAGAAGAGTGAAGG + Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1071106657 10:82105924-82105946 ATGGCTTTTCAGTTGAGTGATGG + Intronic
1071184338 10:83023541-83023563 ATGCCTTTTCAGAAAACTGCTGG - Intergenic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1075953054 10:126498567-126498589 ATGGCCATTCAGCAGTGTGATGG + Intronic
1076186100 10:128450581-128450603 ATCCTCTATCAGATGAGTGAGGG + Intergenic
1076308431 10:129482629-129482651 AGGCCATTTCATAAGAGTAAAGG - Intronic
1077036792 11:499278-499300 ATGCCCAGGCAGAAGACTGAGGG - Intronic
1077974285 11:7231670-7231692 ATGCCTTTTCTTCAGAGTGATGG - Intergenic
1077991268 11:7414452-7414474 CTGCCCTTACTGAAGAGGGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078749248 11:14144209-14144231 ATACCCTTTTAGAAGATGGAAGG - Intronic
1078926581 11:15880720-15880742 TAGCCCTTTCTTAAGAGTGAGGG - Intergenic
1080215296 11:29832861-29832883 ATGAAATTTCAGAAGAGTCAAGG + Intergenic
1081585069 11:44378638-44378660 ATGCCCTGTGAGGAGAGTGATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083067108 11:59936177-59936199 ATGTCTTTTCAGAAGAGTCTTGG - Intergenic
1083253333 11:61482148-61482170 CTGCCCTTTCAGGACTGTGATGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086423679 11:86662981-86663003 TTGCTCTTTCAGAAAACTGAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1089524867 11:119090266-119090288 GTATCCTTTTAGAAGAGTGACGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093305602 12:17513703-17513725 AATCCTTTTCAGAAGTGTGAAGG + Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1094239593 12:28206886-28206908 ATGCCCTTCCAGGGAAGTGAAGG + Intronic
1095709740 12:45275612-45275634 AATCAATTTCAGAAGAGTGATGG - Intronic
1095951758 12:47785445-47785467 ATCCCCTTTCAGAAGAAGGCTGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097280279 12:57841121-57841143 ACTCCATTTCAGAAAAGTGAGGG + Intronic
1097611385 12:61825539-61825561 CTGCACTTTCAGATGAGTGTTGG + Intronic
1097670499 12:62531414-62531436 ATTCACATGCAGAAGAGTGATGG - Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1099481431 12:83171225-83171247 ATGCCCTTGCAGAACTGTGCTGG - Intergenic
1100083933 12:90884445-90884467 ATGCACATTCATAAGAGGGAGGG - Intergenic
1100116804 12:91315619-91315641 AGTCCCATTCAGAAGAGAGAAGG + Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1100309471 12:93380764-93380786 ATGCAATTTCAACAGAGTGAAGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101449356 12:104762285-104762307 ATGCCTTTTCACACGAGTGGTGG - Intergenic
1102242454 12:111333508-111333530 TTGCCCTTTCTGAAGAGTAGAGG + Intronic
1105449808 13:20489359-20489381 ATGCACATTCAGGTGAGTGAAGG - Exonic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111217346 13:85161584-85161606 ATGGACTTTCAGCAGAGTGATGG + Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111640997 13:90969637-90969659 AAGCCCTTTCAGAAGAATAGGGG - Intergenic
1111721151 13:91946711-91946733 AGGCACTTTCAGATGAGAGAAGG - Intronic
1112106767 13:96249021-96249043 ATGACCTTTCAGAAGACAGGAGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116576586 14:46583054-46583076 GATCCCTTTTAGAAGAGTGAAGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1117605186 14:57421658-57421680 ATGCCCCTTCAGAATTGTGAGGG - Intergenic
1117774522 14:59169071-59169093 ATTCACATTCAGAAGAATGAAGG + Intergenic
1118787982 14:69062462-69062484 ATGCCCTTTCAGCACCATGAAGG + Exonic
1120204690 14:81574939-81574961 ATGCACTTGCAAAAGATTGAGGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1123540670 15:21286541-21286563 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1124616667 15:31247206-31247228 ATACGCTTTGGGAAGAGTGAGGG + Intergenic
1124858414 15:33413158-33413180 ATGCCGTTTGAGAAAAGGGAGGG + Intronic
1127997458 15:64161875-64161897 TTGCCCTTTCTTAAGAGTAATGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129261375 15:74369727-74369749 AAGCTCTTTCAGAGAAGTGAGGG - Intergenic
1131173548 15:90195467-90195489 TTGCCCTTTCTGAAGAGTCCAGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1202948981 15_KI270727v1_random:13684-13706 AAGCCCTTTTATAAGAGAGATGG + Intergenic
1133733331 16:8594769-8594791 AAGCACTTTCAGAAGTGTGGAGG + Intergenic
1134513030 16:14864045-14864067 AAGCCCTTTCGGAAGCATGATGG + Intronic
1134700667 16:16262534-16262556 AAGCCCTTTCGGAAGCATGATGG + Intronic
1134971157 16:18532125-18532147 AAGCCCTTTCGGAAGCATGATGG - Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1137040235 16:35604327-35604349 GTGCCCATTCAGAAAAGTCAAGG + Intergenic
1140286653 16:73609173-73609195 ACGCCATTTCAGAAGTGAGAAGG + Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1145786336 17:27596232-27596254 TTGCCCATTCAACAGAGTGAGGG - Intronic
1147207680 17:38849833-38849855 TTTCCATTTCAGAAAAGTGATGG + Exonic
1147463876 17:40595142-40595164 ATGCCTATCTAGAAGAGTGAAGG - Intergenic
1150237820 17:63607275-63607297 CTTCCCTGTCAGAGGAGTGATGG + Exonic
1153719418 18:7886538-7886560 ATACCCTTTCACAGCAGTGAAGG - Intronic
1153980291 18:10302912-10302934 AGGCACTTTCAGCAGAATGATGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1156031990 18:32723420-32723442 ATTTGCTTTCAGAAGACTGAGGG + Intronic
1156104841 18:33647583-33647605 TTTCCCTTTCAGGAGGGTGAAGG + Intronic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1158892178 18:61883069-61883091 ATGCATTTTCAAATGAGTGATGG + Intronic
1159623185 18:70662751-70662773 ATGCCCTATCAGAAGCCAGAGGG - Intergenic
1159767255 18:72505257-72505279 ATATCCTTTCAGAAGAGAGGGGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1161057907 19:2199897-2199919 ATTTCCTCTCAGAAGAGTGGAGG + Exonic
1163982790 19:20916987-20917009 ATGACCACTCAGAAGAGTAATGG - Intergenic
1164042091 19:21502033-21502055 ATACCCATTCAGAAGAGTAATGG - Intronic
1164138702 19:22438094-22438116 ATGCCCATTCAGAAGAGTAATGG - Intronic
1164181948 19:22827018-22827040 ATGCCCATTCAGAAGAGTAATGG - Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164245421 19:23424237-23424259 ATGGCCATTCAGAAGAGTAAGGG - Intergenic
1164308644 19:24027300-24027322 ATGGCCATTCAGAAAAGTAAGGG + Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1166304553 19:41930169-41930191 GTTCCCTTTCAGACAAGTGAAGG - Intergenic
925722278 2:6840880-6840902 ATACCATTTCAAAAGGGTGAAGG + Intronic
926522055 2:13927706-13927728 ATGTCCATCTAGAAGAGTGAAGG - Intergenic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929254913 2:39799979-39800001 AGGACCTTACAGAAGAGAGAGGG - Intergenic
930042427 2:47137520-47137542 AATCCCTTTCAGAAGATAGAGGG - Intronic
930498514 2:52179855-52179877 GATGCCTTTCAGAAGAGTGAAGG - Intergenic
932178035 2:69620531-69620553 AAGAGCATTCAGAAGAGTGATGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933736246 2:85497068-85497090 ATGCCCATTCAGAAGGGTGAAGG - Intergenic
934540258 2:95167878-95167900 ATGCCATTTCAGGTGTGTGAGGG + Intronic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
939262264 2:139825567-139825589 AATCACTTTCAGAAAAGTGAAGG + Intergenic
939722157 2:145667378-145667400 ATGCCCTTTGAAAAAGGTGATGG - Intergenic
940442698 2:153736973-153736995 CTGCCCTCCCAGAAGAGTGATGG - Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940656530 2:156493839-156493861 ATGGCCATTCAGATGAGGGAGGG - Intronic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
945314676 2:208359613-208359635 GTGCCCTATCAGAAGAAAGAAGG - Intergenic
945780540 2:214166351-214166373 AGGCACTTACAGGAGAGTGAAGG + Intronic
1170263128 20:14434825-14434847 AAGCATTTTCAGTAGAGTGATGG - Intronic
1170556417 20:17518615-17518637 AAGCCCTTTCATAAGAGAAATGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171938646 20:31302305-31302327 AGGCCATTTCAGTGGAGTGATGG + Intergenic
1171949772 20:31410753-31410775 ATCCCCTTTCTCAAGAGTGGAGG - Intronic
1176942870 21:14944803-14944825 AAGCAGTTTCAGAGGAGTGATGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177801700 21:25834490-25834512 AAGCCCTTCCAGCTGAGTGACGG + Intergenic
1179224303 21:39440108-39440130 AGGCCCTCTCAGCAGAGTTAGGG - Intronic
1180184199 21:46131430-46131452 ATGGCCAATCAGAAGAGTCAGGG + Intronic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
1181891964 22:26071095-26071117 ATGCCCTTTCAGAAGCCTGGTGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183825668 22:40384915-40384937 ATCCCCATTCAGAATAGGGATGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950975749 3:17242124-17242146 AAGCTCTTTCAGTAGAGTGCGGG - Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
953135474 3:40177933-40177955 ATGGCCATTCAAAAGAGAGAAGG - Intronic
955797650 3:62654577-62654599 ATGGCCTCTCTGGAGAGTGAAGG + Intronic
957318549 3:78599659-78599681 ATACACTTTCAGAAGTGTAAAGG + Intronic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
959181867 3:102991140-102991162 ATGACATTGCATAAGAGTGATGG + Intergenic
960458730 3:117906340-117906362 AGGCCCTTTCAGAGAAGAGAGGG + Intergenic
961117058 3:124339396-124339418 GAGCCCTCTCAGAAGAATGATGG + Intronic
963041678 3:141074890-141074912 AGGCCCTGGCAGAAGGGTGAAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963975173 3:151472489-151472511 CAACCTTTTCAGAAGAGTGAGGG - Intergenic
964016039 3:151948063-151948085 ATAGCCTATGAGAAGAGTGAGGG + Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966686402 3:182700493-182700515 ATGCCCATTCAGAAGTGTGAAGG + Intergenic
966953948 3:184853845-184853867 TTGCATTTTCAGGAGAGTGATGG + Exonic
967514036 3:190346031-190346053 ATGAACATTCAGAAGTGTGATGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
971677000 4:29644629-29644651 ATGCCCTTTCAGAAGTTTAAGGG + Intergenic
971962857 4:33511345-33511367 ATGCCCATCCAGAAGGGTAAAGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974294088 4:59971976-59971998 ATGGCATTTCAGAACAATGAAGG + Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975062929 4:70025727-70025749 AGGCCATTTTAGAAGACTGATGG - Intergenic
975063007 4:70026720-70026742 AGGCCATTTTAGAAGACTGATGG + Intergenic
975064850 4:70047985-70048007 AAGCCATTTTAGAAGACTGATGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975453302 4:74556090-74556112 ATGCCATTTCAGGGCAGTGATGG - Intergenic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978090475 4:104708622-104708644 CTTCCCTTTCAGAAGAGAAAGGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979597113 4:122546516-122546538 ATTCCCTTTCAGAAGTGCAATGG - Intergenic
979636423 4:122959734-122959756 ATGCCTTTTCAGAGGATAGAAGG + Intronic
979780407 4:124644695-124644717 CAGCCCTTTTAGAAGATTGAGGG + Intergenic
980564977 4:134527781-134527803 CAACCCTTTCAGAAGACTGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981080986 4:140639043-140639065 ATGCCCATTCAAAGGAGTAAAGG - Intronic
981201305 4:141982806-141982828 ATATCCTTTTAGAAGATTGAAGG - Intergenic
984216805 4:176923396-176923418 ATGCCCTTTCAAAAGAGCTCAGG + Intergenic
985471391 5:49454-49476 CAGCCATTTCAGAAGTGTGAAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992689637 5:79230122-79230144 ATGCCTTTTCAGAAGGAAGATGG - Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
996486951 5:124047017-124047039 ATTCCTTTTCAGAAAAGGGAAGG - Intergenic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
997572779 5:134944827-134944849 ATGCCCTTGCTGAAGAGAGAAGG + Intronic
999092658 5:148951086-148951108 AGGCCCTTCCACAAGACTGAAGG - Intronic
1000044794 5:157513323-157513345 ATTCCCTTTCAGAAGATGGCTGG + Intronic
1000382806 5:160644353-160644375 CTGTTTTTTCAGAAGAGTGATGG + Intronic
1000573575 5:162946744-162946766 AGGCAATTTCAGAAGATTGAGGG + Intergenic
1001840340 5:174870883-174870905 ATGCTCTTTCATCACAGTGAAGG + Intergenic
1002452401 5:179326383-179326405 ATTCCATTTCAGAACAGTAACGG + Intronic
1003373996 6:5557410-5557432 CTTCCTTTTCATAAGAGTGAGGG + Intronic
1003467614 6:6396383-6396405 AAGCACTTTCAGTGGAGTGATGG - Intergenic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1004775074 6:18834963-18834985 CTGGCCTTTCAGAAGAGTCCTGG + Intergenic
1005347396 6:24904074-24904096 ATGCACTTGCACAAGATTGAAGG + Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1008869417 6:56254712-56254734 ATGACCTTTAAGAAAAGTTAAGG - Intronic
1009933150 6:70200738-70200760 TTGCTCTTTCAGAAGAGGAAGGG - Intronic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011153247 6:84299077-84299099 GTGCCCATTCAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011705832 6:90000808-90000830 AGGCCCTTTCTGAAAAGTCAGGG + Intronic
1013389307 6:109667126-109667148 AGGCCCTTTTAAAATAGTGATGG + Intronic
1013426227 6:110015452-110015474 AGCCCCTTTCAGAAATGTGAAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1017386442 6:153890225-153890247 ATGCCCACCCAGAAGGGTGAAGG - Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020493180 7:8814816-8814838 ATTCCCTTTAAGAAAACTGACGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1020719234 7:11720673-11720695 AAGCAGTTTCAGGAGAGTGATGG - Intronic
1025864612 7:65369271-65369293 ATGCCCATTCAGAGGAGTAATGG - Intergenic
1027145982 7:75694997-75695019 GTGCTATTTCAGAAGACTGAAGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029045271 7:97621344-97621366 ATGTGCTATCAGAAGAGTAAGGG + Intergenic
1029424597 7:100488054-100488076 ATGTCCTTGCAGAAGGGTCAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031777651 7:125921909-125921931 TTGTCCTTTCGCAAGAGTGAGGG - Intergenic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035465996 7:159077938-159077960 ATTCCAGGTCAGAAGAGTGAGGG - Intronic
1035750387 8:1992052-1992074 GGGACCTTTCAGAAGAGGGAGGG - Intronic
1038769873 8:30467482-30467504 ATGGTCTGTCAGAAGAGGGATGG + Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040775696 8:51040669-51040691 ATGTCTTTTCAGAAGATTGGAGG - Intergenic
1042962490 8:74319437-74319459 ATGCCCATTCAGAACATTTAAGG + Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1044232053 8:89789871-89789893 ATGCCTTTTCTGGGGAGTGAGGG + Intronic
1045182184 8:99796257-99796279 AAGCACTTTCAGTAGAGAGAGGG + Intronic
1046202585 8:110946858-110946880 AGGCCCTTCTAGAAGACTGAAGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047229523 8:122984553-122984575 ATGTCCTTTCAGAAAGATGAGGG + Intergenic
1047461079 8:125066036-125066058 CTGCCCTGTCAGTATAGTGAGGG - Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051069227 9:13143234-13143256 ATGGCCCTTCTGAAGAGTAAGGG - Intronic
1051213694 9:14773734-14773756 ATGCTCTTTAAGATGAGTGTTGG + Intronic
1051745807 9:20293569-20293591 ATCCCCTTTGACCAGAGTGAGGG - Intergenic
1052425784 9:28302686-28302708 AACCCCTTTCAGCAGGGTGATGG + Intronic
1054832249 9:69638788-69638810 GTGCCCATTCAGAAGATTGATGG + Intronic
1055633990 9:78256335-78256357 ATCTCATTTCAGGAGAGTGAAGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1057977523 9:99622064-99622086 ATACCCTTTCCGAAAAGTGGAGG + Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1059126707 9:111695073-111695095 TTGACATTTCAGAAGAGAGAAGG - Intronic
1062057858 9:134477864-134477886 ATGCCCTTTCAGACTTGTGAAGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1187794861 X:22992873-22992895 ATGCCCTTTTTGTAGAATGATGG - Intergenic
1189664623 X:43340546-43340568 ATGCCTATCCAGAAGGGTGAAGG - Intergenic
1189732470 X:44035876-44035898 ATGGGCTTTCAGAAAAGTAAAGG - Intergenic
1191099480 X:56710445-56710467 ATGCTCTTTCAGCTCAGTGAAGG + Intergenic
1191933772 X:66404528-66404550 GTGGCCTTTCACAACAGTGATGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193695699 X:84705220-84705242 ATGCCAGTCCAGAATAGTGAAGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196967936 X:121078558-121078580 ATGCACTTTTAAAATAGTGAAGG + Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197622210 X:128763366-128763388 AAGCCATTTCAGGAGAGTGCTGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1201524813 Y:14920353-14920375 ATGCCCTTTGAGAAGGGAAAAGG - Intergenic