ID: 1129262470

View in Genome Browser
Species Human (GRCh38)
Location 15:74376315-74376337
Sequence CACCATGGTGGCAGGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129262470_1129262476 6 Left 1129262470 15:74376315-74376337 CCTGGGTGCCTGCCACCATGGTG No data
Right 1129262476 15:74376344-74376366 TGTAACCACTGTGTCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129262470 Original CRISPR CACCATGGTGGCAGGCACCC AGG (reversed) Intergenic
No off target data available for this crispr