ID: 1129263981

View in Genome Browser
Species Human (GRCh38)
Location 15:74384166-74384188
Sequence GGGCTTTTTCACCAAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129263975_1129263981 18 Left 1129263975 15:74384125-74384147 CCCACATAGCAGCTGCTTCAGAT No data
Right 1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG No data
1129263976_1129263981 17 Left 1129263976 15:74384126-74384148 CCACATAGCAGCTGCTTCAGATC No data
Right 1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG No data
1129263973_1129263981 29 Left 1129263973 15:74384114-74384136 CCACCATCAGGCCCACATAGCAG No data
Right 1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG No data
1129263974_1129263981 26 Left 1129263974 15:74384117-74384139 CCATCAGGCCCACATAGCAGCTG No data
Right 1129263981 15:74384166-74384188 GGGCTTTTTCACCAAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129263981 Original CRISPR GGGCTTTTTCACCAAGCTGA TGG Intergenic
No off target data available for this crispr