ID: 1129265314

View in Genome Browser
Species Human (GRCh38)
Location 15:74390162-74390184
Sequence GCCTGGCGTTTGGATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129265314_1129265326 25 Left 1129265314 15:74390162-74390184 CCTGGCTCATCCAAACGCCAGGC No data
Right 1129265326 15:74390210-74390232 GCACTTTAGGAGGCCAAGGTGGG No data
1129265314_1129265319 12 Left 1129265314 15:74390162-74390184 CCTGGCTCATCCAAACGCCAGGC No data
Right 1129265319 15:74390197-74390219 GCCTGTAATCCCAGCACTTTAGG No data
1129265314_1129265325 24 Left 1129265314 15:74390162-74390184 CCTGGCTCATCCAAACGCCAGGC No data
Right 1129265325 15:74390209-74390231 AGCACTTTAGGAGGCCAAGGTGG No data
1129265314_1129265323 21 Left 1129265314 15:74390162-74390184 CCTGGCTCATCCAAACGCCAGGC No data
Right 1129265323 15:74390206-74390228 CCCAGCACTTTAGGAGGCCAAGG No data
1129265314_1129265321 15 Left 1129265314 15:74390162-74390184 CCTGGCTCATCCAAACGCCAGGC No data
Right 1129265321 15:74390200-74390222 TGTAATCCCAGCACTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129265314 Original CRISPR GCCTGGCGTTTGGATGAGCC AGG (reversed) Intergenic