ID: 1129266415

View in Genome Browser
Species Human (GRCh38)
Location 15:74395801-74395823
Sequence GACTCAGCTCTGCCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266415_1129266428 28 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266428 15:74395852-74395874 CCCAGGCCTACTTCACTGGGAGG No data
1129266415_1129266425 24 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266425 15:74395848-74395870 GAGGCCCAGGCCTACTTCACTGG No data
1129266415_1129266419 -7 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266419 15:74395817-74395839 CTGAGTCAGCAGCCAGGGTCGGG No data
1129266415_1129266418 -8 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266418 15:74395816-74395838 GCTGAGTCAGCAGCCAGGGTCGG No data
1129266415_1129266423 11 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266415_1129266426 25 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266426 15:74395849-74395871 AGGCCCAGGCCTACTTCACTGGG No data
1129266415_1129266420 -6 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266420 15:74395818-74395840 TGAGTCAGCAGCCAGGGTCGGGG No data
1129266415_1129266422 5 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266422 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266415 Original CRISPR GACTCAGCTCTGCCTCTGTG AGG (reversed) Intergenic
No off target data available for this crispr