ID: 1129266421

View in Genome Browser
Species Human (GRCh38)
Location 15:74395829-74395851
Sequence CCTCAGAGGCACCCCGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266421_1129266428 0 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266428 15:74395852-74395874 CCCAGGCCTACTTCACTGGGAGG No data
1129266421_1129266425 -4 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266425 15:74395848-74395870 GAGGCCCAGGCCTACTTCACTGG No data
1129266421_1129266432 24 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266432 15:74395876-74395898 GTCCCTGCACAGAAGTGAGAGGG No data
1129266421_1129266426 -3 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266426 15:74395849-74395871 AGGCCCAGGCCTACTTCACTGGG No data
1129266421_1129266431 23 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266431 15:74395875-74395897 TGTCCCTGCACAGAAGTGAGAGG No data
1129266421_1129266435 30 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266435 15:74395882-74395904 GCACAGAAGTGAGAGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266421 Original CRISPR CCTCAGAGGCACCCCGACCC TGG (reversed) Intergenic
No off target data available for this crispr