ID: 1129266423

View in Genome Browser
Species Human (GRCh38)
Location 15:74395835-74395857
Sequence TCGGGGTGCCTCTGAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266412_1129266423 20 Left 1129266412 15:74395792-74395814 CCCACTGGCCCTCACAGAGGCAG No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266415_1129266423 11 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266411_1129266423 21 Left 1129266411 15:74395791-74395813 CCCCACTGGCCCTCACAGAGGCA No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266413_1129266423 19 Left 1129266413 15:74395793-74395815 CCACTGGCCCTCACAGAGGCAGA No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266414_1129266423 12 Left 1129266414 15:74395800-74395822 CCCTCACAGAGGCAGAGCTGAGT No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266408_1129266423 23 Left 1129266408 15:74395789-74395811 CCCCCCACTGGCCCTCACAGAGG No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data
1129266410_1129266423 22 Left 1129266410 15:74395790-74395812 CCCCCACTGGCCCTCACAGAGGC No data
Right 1129266423 15:74395835-74395857 TCGGGGTGCCTCTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266423 Original CRISPR TCGGGGTGCCTCTGAGGCCC AGG Intergenic
No off target data available for this crispr