ID: 1129266426

View in Genome Browser
Species Human (GRCh38)
Location 15:74395849-74395871
Sequence AGGCCCAGGCCTACTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266415_1129266426 25 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266426 15:74395849-74395871 AGGCCCAGGCCTACTTCACTGGG No data
1129266421_1129266426 -3 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266426 15:74395849-74395871 AGGCCCAGGCCTACTTCACTGGG No data
1129266414_1129266426 26 Left 1129266414 15:74395800-74395822 CCCTCACAGAGGCAGAGCTGAGT No data
Right 1129266426 15:74395849-74395871 AGGCCCAGGCCTACTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266426 Original CRISPR AGGCCCAGGCCTACTTCACT GGG Intergenic
No off target data available for this crispr