ID: 1129266428

View in Genome Browser
Species Human (GRCh38)
Location 15:74395852-74395874
Sequence CCCAGGCCTACTTCACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266414_1129266428 29 Left 1129266414 15:74395800-74395822 CCCTCACAGAGGCAGAGCTGAGT No data
Right 1129266428 15:74395852-74395874 CCCAGGCCTACTTCACTGGGAGG No data
1129266421_1129266428 0 Left 1129266421 15:74395829-74395851 CCAGGGTCGGGGTGCCTCTGAGG No data
Right 1129266428 15:74395852-74395874 CCCAGGCCTACTTCACTGGGAGG No data
1129266415_1129266428 28 Left 1129266415 15:74395801-74395823 CCTCACAGAGGCAGAGCTGAGTC No data
Right 1129266428 15:74395852-74395874 CCCAGGCCTACTTCACTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266428 Original CRISPR CCCAGGCCTACTTCACTGGG AGG Intergenic
No off target data available for this crispr