ID: 1129266687

View in Genome Browser
Species Human (GRCh38)
Location 15:74397093-74397115
Sequence CACGCCCACATCAGGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266687_1129266694 9 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266694 15:74397125-74397147 GGGGACCTGTGAGTCAATAAGGG No data
1129266687_1129266697 23 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266697 15:74397139-74397161 CAATAAGGGTGTATGAGTAAGGG No data
1129266687_1129266696 22 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266696 15:74397138-74397160 TCAATAAGGGTGTATGAGTAAGG No data
1129266687_1129266698 24 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266698 15:74397140-74397162 AATAAGGGTGTATGAGTAAGGGG No data
1129266687_1129266691 -10 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266691 15:74397106-74397128 TGTGGGCGTGACTCACCTTGGGG No data
1129266687_1129266693 8 Left 1129266687 15:74397093-74397115 CCACAATACCTGATGTGGGCGTG No data
Right 1129266693 15:74397124-74397146 TGGGGACCTGTGAGTCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266687 Original CRISPR CACGCCCACATCAGGTATTG TGG (reversed) Intergenic
No off target data available for this crispr