ID: 1129266994

View in Genome Browser
Species Human (GRCh38)
Location 15:74398644-74398666
Sequence ATCCCCGCCATCAGAGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129266994_1129266996 0 Left 1129266994 15:74398644-74398666 CCTCACACTCTGATGGCGGGGAT No data
Right 1129266996 15:74398667-74398689 GTAAAATGGTATCACCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129266994 Original CRISPR ATCCCCGCCATCAGAGTGTG AGG (reversed) Intergenic
No off target data available for this crispr