ID: 1129267733

View in Genome Browser
Species Human (GRCh38)
Location 15:74403074-74403096
Sequence CCCCTGGCTTCCCCGAAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129267730_1129267733 -6 Left 1129267730 15:74403057-74403079 CCATGAGCTCAGCATTTCCCCTG No data
Right 1129267733 15:74403074-74403096 CCCCTGGCTTCCCCGAAAGCCGG No data
1129267728_1129267733 14 Left 1129267728 15:74403037-74403059 CCAGCTGTGGGAAGAACAGCCCA No data
Right 1129267733 15:74403074-74403096 CCCCTGGCTTCCCCGAAAGCCGG No data
1129267727_1129267733 23 Left 1129267727 15:74403028-74403050 CCTTGGAAACCAGCTGTGGGAAG No data
Right 1129267733 15:74403074-74403096 CCCCTGGCTTCCCCGAAAGCCGG No data
1129267729_1129267733 -5 Left 1129267729 15:74403056-74403078 CCCATGAGCTCAGCATTTCCCCT No data
Right 1129267733 15:74403074-74403096 CCCCTGGCTTCCCCGAAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129267733 Original CRISPR CCCCTGGCTTCCCCGAAAGC CGG Intergenic
No off target data available for this crispr