ID: 1129267763

View in Genome Browser
Species Human (GRCh38)
Location 15:74403217-74403239
Sequence CCTGCAGAAGGGTTTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129267763_1129267770 4 Left 1129267763 15:74403217-74403239 CCACCAGGAAACCCTTCTGCAGG No data
Right 1129267770 15:74403244-74403266 GTCCCCAAGCCCCGTATCTCAGG No data
1129267763_1129267777 15 Left 1129267763 15:74403217-74403239 CCACCAGGAAACCCTTCTGCAGG No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129267763 Original CRISPR CCTGCAGAAGGGTTTCCTGG TGG (reversed) Intergenic