ID: 1129267777

View in Genome Browser
Species Human (GRCh38)
Location 15:74403255-74403277
Sequence CCGTATCTCAGGTTCTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129267763_1129267777 15 Left 1129267763 15:74403217-74403239 CCACCAGGAAACCCTTCTGCAGG No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data
1129267768_1129267777 4 Left 1129267768 15:74403228-74403250 CCCTTCTGCAGGGCAGGTCCCCA No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data
1129267769_1129267777 3 Left 1129267769 15:74403229-74403251 CCTTCTGCAGGGCAGGTCCCCAA No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data
1129267766_1129267777 12 Left 1129267766 15:74403220-74403242 CCAGGAAACCCTTCTGCAGGGCA No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data
1129267762_1129267777 19 Left 1129267762 15:74403213-74403235 CCTGCCACCAGGAAACCCTTCTG No data
Right 1129267777 15:74403255-74403277 CCGTATCTCAGGTTCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129267777 Original CRISPR CCGTATCTCAGGTTCTGACC AGG Intergenic