ID: 1129268512

View in Genome Browser
Species Human (GRCh38)
Location 15:74407584-74407606
Sequence TTCCATGTAAATGAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129268512_1129268516 13 Left 1129268512 15:74407584-74407606 CCTGCCAGCTCATTTACATGGAA No data
Right 1129268516 15:74407620-74407642 ATTTCATGCCTTAATGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129268512 Original CRISPR TTCCATGTAAATGAGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr