ID: 1129269139

View in Genome Browser
Species Human (GRCh38)
Location 15:74410296-74410318
Sequence GCTCCCAGCCCAAGAGCCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129269139_1129269140 3 Left 1129269139 15:74410296-74410318 CCATGGGCTCTTGGGCTGGGAGC 0: 1
1: 0
2: 4
3: 40
4: 304
Right 1129269140 15:74410322-74410344 GCTGCATTTAGTCAAGTTTGAGG 0: 1
1: 0
2: 1
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129269139 Original CRISPR GCTCCCAGCCCAAGAGCCCA TGG (reversed) Exonic
900140630 1:1138085-1138107 CTTCCCATCCCAGGAGCCCATGG + Intergenic
900242701 1:1624581-1624603 GCTCCAGGCCCCTGAGCCCAGGG + Intronic
900539856 1:3197238-3197260 GGACCCAGGACAAGAGCCCAGGG + Intronic
900607961 1:3532140-3532162 GCTTCCAACCCCAGAGCCCTGGG + Intronic
900622445 1:3593548-3593570 GCTGCCAGCCCGAGTCCCCAGGG - Intronic
900639753 1:3682979-3683001 CCTCCCAGGCCCAGAGCTCAAGG - Intronic
901129102 1:6951043-6951065 ACTCCCAGCCCAAAACCACAAGG - Intronic
902407362 1:16191969-16191991 GCTCCCTGCCCACCTGCCCAGGG - Intergenic
902621043 1:17651346-17651368 GCCTCCAGCCCAAGGCCCCAGGG - Intronic
902639914 1:17760580-17760602 GTTCACAGTCCAAGAGCCCAGGG + Intronic
902770154 1:18641085-18641107 GCTCGCAGCCCCAGAACCCGCGG + Intronic
903773250 1:25777337-25777359 GCTCTCACCCCAGGAGCCCTGGG - Intronic
904126900 1:28247287-28247309 GCCCCCAGTCAAAGAGCCCCGGG + Intergenic
904479934 1:30787384-30787406 GCTCCCAGCCCACGAAGCCCTGG + Intergenic
905533712 1:38702192-38702214 CCTACCAGACCAGGAGCCCATGG + Intergenic
906642203 1:47448266-47448288 TCTCCCAGCCCAGGAACCCTGGG - Intergenic
906880225 1:49581953-49581975 ACTCCCAACACAAGAGCACAGGG - Intronic
907414839 1:54307140-54307162 CCTTCCGGCCCTAGAGCCCAGGG + Intronic
913074708 1:115332003-115332025 TCTCCCAGACCAAGAGCCAAGGG - Intronic
915073874 1:153293392-153293414 TCTCCCACCGCAAGCGCCCATGG - Intergenic
915524598 1:156468034-156468056 GCGCCCAGCCCCAGAGCCTGAGG - Exonic
915553944 1:156650986-156651008 GCCCCAAGCCCAAGATCACAAGG + Intronic
916143215 1:161717756-161717778 GTACCCAGCCCAGTAGCCCAAGG + Intergenic
920668058 1:207981133-207981155 GCTCCAAGCCAGAGAGCCCCTGG + Intergenic
922325492 1:224524515-224524537 GCTCCAAGACCAAGATCTCAAGG - Intronic
922645323 1:227280895-227280917 GATCCCAGCACAACAGCTCAGGG + Intronic
923683618 1:236139578-236139600 GCTCCAAGCCCAGGAGCTCTGGG - Intergenic
1064086417 10:12349363-12349385 GCTCCCCTCCCAAGAGCGCCGGG - Intergenic
1064094982 10:12417563-12417585 GTTCCCAGGCCAACAGCCCAGGG - Intronic
1064152016 10:12873177-12873199 GCTTCCCTCCCAGGAGCCCAGGG + Intergenic
1066479555 10:35782419-35782441 TCTCCCAGCTCCAGAGTCCATGG - Intergenic
1067039294 10:42940490-42940512 CCCCCCAGCCCAAGACCCCAAGG - Intergenic
1067324474 10:45253818-45253840 GCTCCCAACTCAAGAACCCAGGG - Intergenic
1067780059 10:49195457-49195479 GCTCCCAGCCAAGGAAACCAAGG + Intergenic
1068793660 10:61054063-61054085 GTTCCCAGCCCAGAAGCCCATGG - Intergenic
1069024253 10:63522157-63522179 GCTCCCAGCCCAGGATCCCTGGG + Intronic
1070814198 10:79312856-79312878 GCTCCCCGCCCCACAGCCCGTGG - Exonic
1071451076 10:85791881-85791903 GCCCCCTGCACAAAAGCCCAGGG - Intronic
1073027559 10:100498975-100498997 ACTCCCAGCCCAAAAGCTTAGGG + Intronic
1073052927 10:100680976-100680998 GATCCCAGCCCAAGCGCCGGGGG - Intergenic
1073115087 10:101087418-101087440 GCTCCCAGCCCCTGACCCCTTGG + Intergenic
1073452638 10:103618784-103618806 GCATCCAGCCAAGGAGCCCAGGG - Intronic
1073462454 10:103673893-103673915 CCTCCCCTCCCCAGAGCCCAGGG - Intronic
1074650897 10:115523278-115523300 CATCACAGACCAAGAGCCCAAGG - Intronic
1075119315 10:119652171-119652193 TCTCCCAGCCCTAGAGCGCGAGG - Intronic
1075962889 10:126584651-126584673 GCTAACAGCACAAGAGACCAAGG + Intronic
1076477177 10:130761104-130761126 ACTCCCAGACCAAGGGCCCTGGG - Intergenic
1076610494 10:131723105-131723127 GCCCCCATCCGCAGAGCCCAAGG + Intergenic
1077064661 11:635754-635776 GCGCCCAGCCGGAGACCCCAGGG + Intergenic
1077160216 11:1109265-1109287 GCTCCCTGCCCCACAGCCCGGGG + Intergenic
1078538538 11:12194764-12194786 GGTACCAGCACCAGAGCCCAAGG + Intronic
1079356861 11:19737047-19737069 GCTGCTAGCCGTAGAGCCCAAGG + Intronic
1079408488 11:20165287-20165309 ACTCCCAGCCTCTGAGCCCAGGG + Intergenic
1079837431 11:25351347-25351369 GCTCCCAGCCTGAGAGCTCAGGG + Intergenic
1080022436 11:27576855-27576877 GCTTTGAGCCCAAGAGGCCAAGG - Intergenic
1080622286 11:33996825-33996847 GCTCACAGCCCAAACGTCCAAGG - Intergenic
1080919460 11:36694476-36694498 GCGCCCAGCCCAAGAGACACAGG - Intergenic
1081702271 11:45159294-45159316 GCTGCCAGGCCAGGAGCCCAGGG - Intronic
1082828502 11:57598199-57598221 GCTCCCACCCTGGGAGCCCAGGG - Intronic
1083306422 11:61764281-61764303 CTTCCCAGCCCCAGAGCCCTGGG - Intronic
1083745835 11:64736018-64736040 GCCCACAGCCACAGAGCCCAGGG + Intronic
1083884858 11:65567907-65567929 GCTCCCAGCCCAGGAGATCCAGG - Intergenic
1083970465 11:66070902-66070924 CCTCCCCGCCCCAGCGCCCATGG + Intronic
1084168206 11:67387005-67387027 CCTTCCAGCCCCACAGCCCAGGG + Intronic
1084179062 11:67437579-67437601 GCCCCCATCCCAAGAACCCGGGG + Intronic
1084275099 11:68047360-68047382 CCTCCCGGCCCAAGACGCCACGG - Intronic
1084320451 11:68370480-68370502 GCTCCATGCCACAGAGCCCAGGG - Intronic
1084385255 11:68839655-68839677 GCACCGCGCTCAAGAGCCCAGGG + Intronic
1084591407 11:70092758-70092780 GACCCCAGACCAAGACCCCAGGG + Intronic
1085260899 11:75204134-75204156 TCTCCGAGCCCAAGGGCTCAGGG - Intronic
1085307895 11:75498567-75498589 CCTCCCAGCCCTAGAGGCCCTGG - Intronic
1087014632 11:93543263-93543285 GCTCCCAGCCCACCTGCCCGCGG + Exonic
1088507692 11:110542245-110542267 GCTACCAGCTCAAATGCCCATGG - Intergenic
1088868530 11:113871905-113871927 GTTCTGACCCCAAGAGCCCAAGG - Intronic
1089268076 11:117281222-117281244 AATCCCAGCACAAGAGGCCAAGG - Intronic
1090105699 11:123851975-123851997 CCTGCCAGCTCAAGTGCCCATGG + Intergenic
1090404591 11:126469196-126469218 GCTGCCAGCTCCTGAGCCCACGG + Intronic
1090405886 11:126475620-126475642 CCTCCCGGCTCAAGAGCCCAGGG - Intronic
1091054119 11:132402448-132402470 GCTCCCAGACAGAGTGCCCAGGG - Intergenic
1091254695 11:134173247-134173269 GCTCAAAGCCCCAGATCCCAGGG + Intronic
1091305523 11:134533443-134533465 GGTGCCAGCCCCAGGGCCCATGG + Intergenic
1092688834 12:11084176-11084198 GTTACAATCCCAAGAGCCCACGG - Intronic
1093266933 12:17015300-17015322 GCACCCATGCCAAGGGCCCATGG + Intergenic
1093912997 12:24768531-24768553 CCTCCCAGCCTGAGTGCCCATGG + Intergenic
1094169829 12:27480044-27480066 GCTGCAGGCCCAAGAGCCCCTGG + Intronic
1096007659 12:48185287-48185309 CCTCCCAGCCCAGGGGCCCTTGG - Exonic
1097245673 12:57606364-57606386 GCCCCCAACCCAGCAGCCCATGG - Intronic
1098498714 12:71166276-71166298 GCAGCCAGCGCAGGAGCCCACGG + Intronic
1099534570 12:83828135-83828157 GCTTCCAGCCAAAGGGGCCAGGG + Intergenic
1102112222 12:110373138-110373160 ACTCCCAGCCCCAGAGCTCAGGG + Exonic
1102197478 12:111035098-111035120 ACTCCCAGCCCTCGGGCCCAAGG + Intronic
1103955304 12:124573079-124573101 GCTGCCACCTCAAGAGCCCTGGG + Intergenic
1104214030 12:126718185-126718207 GCTCTCAGGAGAAGAGCCCAGGG - Intergenic
1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG + Intronic
1104865387 12:131950300-131950322 GCCCCCAGCCCAGGAGCCCGGGG - Intronic
1105859207 13:24394773-24394795 CCTCCCAGCCCATGAGGGCAAGG - Intergenic
1106756781 13:32829815-32829837 GCTCCTTCCCCATGAGCCCAAGG + Intergenic
1107723988 13:43279061-43279083 GCCCCTAGCCCAACAGGCCAAGG - Intronic
1108199174 13:48025710-48025732 GCCAAAAGCCCAAGAGCCCATGG - Intergenic
1108592193 13:51922076-51922098 ACTCCCTGCTCAAGAGGCCAGGG - Intergenic
1109476708 13:62887880-62887902 TCTCCCAGCTCAAGTGTCCATGG + Intergenic
1109923823 13:69106915-69106937 GCTCACAGCCTAAGACACCAGGG - Intergenic
1111137456 13:84066975-84066997 GCTCCAAGACCAAGAACACAGGG + Intergenic
1111907184 13:94268958-94268980 CCTCCCAGCCCATGAGCCCCTGG - Intronic
1112011886 13:95300219-95300241 CCTCCCAGCTCAGGAGCCCTGGG + Intronic
1112802649 13:103129642-103129664 ACTCTCAGTCCAAGAGCCCAGGG - Intergenic
1113285870 13:108848548-108848570 GATCCCAGCACTAGAGGCCAAGG + Intronic
1114683261 14:24505267-24505289 ATTCCCAGCCCAAGCACCCAAGG - Intronic
1115472155 14:33779186-33779208 GCTCCCAGCCCCTGAGCCACAGG + Intronic
1116241728 14:42352182-42352204 GCTGCAGGCCCAAGAGCCCCTGG - Intergenic
1117499961 14:56341741-56341763 GTTCCCAGCCCTAGGTCCCATGG + Intergenic
1119210880 14:72830945-72830967 GCTCCCACCCACAGAGCCCAGGG - Intronic
1119483662 14:74974975-74974997 GCCCGCAGCCCAAGGGACCAGGG + Intergenic
1121311681 14:92938752-92938774 GTCCCCACCCCAAGAGCCAAGGG - Exonic
1121435717 14:93917873-93917895 GCTCCCATCCCAGGAGGCAAGGG + Intergenic
1122140591 14:99660701-99660723 GCTGTCAGGCCCAGAGCCCATGG - Intronic
1122797269 14:104212322-104212344 GCCCCCAGCCCATGAGGGCAGGG - Intergenic
1122820596 14:104342930-104342952 GGTCCAAGCCCAGGACCCCATGG - Intergenic
1124250965 15:28106470-28106492 GGTCCCAGCCCGGGAGCCCGCGG - Intergenic
1124360869 15:29035789-29035811 GCTCCCAGCCCTAGAGCTTCTGG - Intronic
1124645227 15:31433729-31433751 GCTTCCAGACCAAGGGCTCAGGG - Intronic
1126890880 15:53202980-53203002 ACTCCCAGCCCCAGACCACAAGG - Intergenic
1127244233 15:57153909-57153931 GATCTCAGCCCAAGAGTTCAAGG + Intronic
1128683774 15:69669065-69669087 GTTCCATGCCCAGGAGCCCAGGG + Intergenic
1129154689 15:73710479-73710501 TCTCCCAGCCCAGGATCCCCTGG - Intronic
1129237982 15:74235141-74235163 GCCCCCAGCCCCAGAGCCCCAGG + Intergenic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1131056313 15:89377439-89377461 GCTCCCAGCCCCAGCCCCCTGGG - Intergenic
1132373695 15:101314603-101314625 GAAGCCAGCCCCAGAGCCCAGGG - Intronic
1132501791 16:287790-287812 GATCCCAGCACACGTGCCCAAGG + Exonic
1132723182 16:1327062-1327084 GCTCCCACCCCCAAAGCCCAGGG - Intergenic
1132886975 16:2186648-2186670 GCTTCCAGCCCCCAAGCCCAGGG + Intronic
1137400124 16:48146443-48146465 GTCCCCAGGCCAAAAGCCCAGGG - Exonic
1137731694 16:50694501-50694523 GCTTCCAGCCTCAGATCCCAGGG - Intronic
1137787275 16:51150046-51150068 GCTCCCAGGCCTAGCGCCCGAGG - Intronic
1139295621 16:65897943-65897965 TATCCCAGCCCAAGAGGTCAAGG - Intergenic
1139480071 16:67225936-67225958 GCAGCCAGCCCAAGAGCAAAGGG + Intronic
1139490542 16:67283728-67283750 GCTCCAGGCCCAAGACCCAAGGG - Intronic
1139670901 16:68492098-68492120 GCTCACAGGCCAGGAGCCAATGG - Intergenic
1140477841 16:75247875-75247897 GTTCTCTGCCCAAGACCCCAGGG + Intronic
1141801374 16:86311609-86311631 GCTCCCTACCCCAGAGCCCTGGG - Intergenic
1142203225 16:88770875-88770897 GCTCCTCGCCCAAGCCCCCAGGG - Intronic
1142765164 17:2060432-2060454 TCTCCCAGCACAGGAGCCGAGGG + Exonic
1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG + Intronic
1144005711 17:11097222-11097244 TCTCGCAGCCCAAGACCTCAGGG + Intergenic
1144060645 17:11580951-11580973 GGAGCCAGCCCAAGAGCACATGG + Intergenic
1144935067 17:18891173-18891195 ACTGCCAGCCCACGAGCCCAGGG - Intronic
1146662358 17:34673276-34673298 GTCCCCAGCCAGAGAGCCCAAGG - Intergenic
1146935405 17:36809808-36809830 CCCCCCAGCCCCAGAGCACAGGG + Intergenic
1148346860 17:46908936-46908958 TCTCCCAGCCTGACAGCCCAGGG - Intergenic
1148769987 17:50061052-50061074 GCTCCCAGCCCAGGATCCAATGG - Intronic
1149656474 17:58311955-58311977 GCTCCCACCCCAAGGGCCCTGGG - Exonic
1150281784 17:63933118-63933140 GTTCCCTGCCCAAGACCCCCTGG - Intergenic
1151194743 17:72423551-72423573 GCTCCCAGACCAATGGCCCAGGG - Intergenic
1151504237 17:74516036-74516058 GCTGAAAGCCCAAGAGCCCCTGG + Intergenic
1151844703 17:76644306-76644328 GCTGCCAGCCCAAGAGCACATGG + Intergenic
1152556084 17:81053947-81053969 GCTCCCACCCCAAGGGGCCCGGG - Intronic
1152556169 17:81054233-81054255 GCTCCCACCCCAAGGGGCCCGGG - Intronic
1156257476 18:35411424-35411446 CTTCCCAGCCCAAGAGCCCTTGG - Intergenic
1157926163 18:51768224-51768246 GCTCCCAGAACTACAGCCCAGGG - Intergenic
1159442772 18:68502943-68502965 GTGCCCAGCCCCAGGGCCCACGG + Intergenic
1160141142 18:76324337-76324359 GCGCCAAGCCCAGGACCCCATGG + Intergenic
1160887950 19:1360767-1360789 GCCCCCAGCCCCTGAGCCCTCGG + Exonic
1161043113 19:2120584-2120606 CCTCCCAGTCCTAGTGCCCACGG + Intronic
1161456646 19:4373015-4373037 GCTCCCAGACCAGGAGCCCAGGG - Intronic
1161635536 19:5386547-5386569 GCTCCTAGCTCAAGTCCCCAGGG + Intergenic
1161683513 19:5692194-5692216 GCCCCCAGGCCAAGCGCGCAGGG - Exonic
1161709781 19:5841526-5841548 GCTCCCAGCCCTGGGCCCCAGGG - Intergenic
1161713554 19:5863406-5863428 GCTCCCAGCCCTGGGCCCCACGG - Intergenic
1161879457 19:6937590-6937612 GCTCCCAGTCCCAGACCTCAAGG + Exonic
1161994028 19:7701586-7701608 GCTCCCAGCTCAAGGGTCCCGGG - Intronic
1163557228 19:17999660-17999682 GCTCCCAGCACCCAAGCCCATGG - Exonic
1167246449 19:48375951-48375973 GCTCACTGCCCAGGAGCCCTAGG - Intronic
1167250679 19:48396982-48397004 GCTCCCAGCCCAACCACCCCAGG + Intronic
1167705750 19:51079905-51079927 GAGCCCAGCCCAAGAGCGGAAGG - Intronic
1168316975 19:55488775-55488797 TCTGCCAGCCCAGAAGCCCAAGG + Intronic
1168452069 19:56474384-56474406 CCTGCCAGCCCCAGAGGCCAGGG + Intronic
925148109 2:1594544-1594566 GCTTCCAGCCCAGGAGCACTGGG - Intergenic
925175614 2:1781691-1781713 GCCCCCAGATGAAGAGCCCAGGG - Intergenic
925902913 2:8521230-8521252 GCTTGCAGCCCATGTGCCCATGG + Intergenic
926209878 2:10861997-10862019 GCTCACAGCCCAACAGGACAGGG - Intergenic
927258260 2:21059756-21059778 GCTCTGAGCCCATGAGACCAAGG + Intergenic
928935588 2:36674215-36674237 TCTCCCAGCCAAAGGCCCCAGGG - Intergenic
929426646 2:41850931-41850953 GCTCCCAGCTCAGGAGCTCCAGG + Intergenic
929823191 2:45289798-45289820 CCTTCCAGCCAAAGAGCCCTGGG - Intergenic
929913572 2:46114709-46114731 GTGCCCAGCCCCAGAGTCCAAGG + Intronic
929961428 2:46499551-46499573 CCTCCCATCCCCAGAGCCCTTGG - Intronic
931823228 2:65973367-65973389 GCTCCCCACCCCTGAGCCCATGG + Intergenic
934519474 2:95010811-95010833 ACTGCCAGGCCTAGAGCCCAGGG - Intergenic
934754660 2:96816677-96816699 GCCCCCAGGCCCAGAGCCCAGGG - Exonic
934909868 2:98241730-98241752 GCACCAAGCACAAGTGCCCATGG - Intronic
934917409 2:98311527-98311549 ACTCCCAGCCCAAAAGCCCCTGG - Intronic
934991385 2:98924325-98924347 GTCCCCAGCCCAGGAGACCAAGG - Intronic
935738113 2:106122443-106122465 GCTCACAGACCAAGAGGCCGAGG - Intronic
937448761 2:121982533-121982555 GCTCCCAGCCCTATAGCCATAGG + Intergenic
937766307 2:125664740-125664762 GGTGCCAGACCAAGAACCCACGG - Intergenic
939986077 2:148831049-148831071 GCTGCCAGCAAAAGAGGCCATGG - Intergenic
940282317 2:152000789-152000811 TGTCCCAGCCCAAGAGGTCAGGG - Intronic
942324502 2:174764552-174764574 GCCCTCAGCCCTGGAGCCCAGGG + Intergenic
947676518 2:231986115-231986137 GCTGAAAGCCCAAGAGCCCCGGG - Intronic
948271271 2:236674879-236674901 GCTCCCAGCCCTCGAGCCACAGG - Intergenic
948850591 2:240703613-240703635 GCTCCCAGCCCAGGAAAGCAAGG - Intergenic
1171085724 20:22236511-22236533 GCTGACAGCCCACGAGCCCAGGG + Intergenic
1171386349 20:24771786-24771808 GCTCCAAGCCCAGGAGCAGAGGG + Intergenic
1171475838 20:25407938-25407960 CCGCCCCGCCCCAGAGCCCAGGG - Intronic
1171481876 20:25460640-25460662 GCTGCAAGGCCAAGAGCCTATGG + Intronic
1171960088 20:31487091-31487113 GCTCCCACCTCAACATCCCAAGG + Intergenic
1173716620 20:45212657-45212679 GATCACAGCCCAAGTGCTCAGGG + Intergenic
1173896578 20:46555529-46555551 CCTCCCAGCCCAAGGCCTCAAGG - Intergenic
1174042379 20:47709103-47709125 TCTCCCAGCCCAGGAGCCCCGGG - Intronic
1174080394 20:47967253-47967275 TCTCCCAGCACAGTAGCCCATGG - Intergenic
1175402836 20:58710456-58710478 GCTAACACCCCCAGAGCCCAGGG - Intronic
1176200095 20:63856164-63856186 GCTCTTAGGCCAAGAGCCAAGGG + Intergenic
1176380244 21:6109014-6109036 GCTCCTTGCCCACGGGCCCAGGG + Intergenic
1178496353 21:33089694-33089716 GCTGAAAGCCCAAGAGCCCCTGG + Intergenic
1178687549 21:34723384-34723406 TCTCCAAACCCAGGAGCCCATGG + Intergenic
1178905645 21:36633760-36633782 GCTACCAGCCCAAGACCACCAGG + Intergenic
1178973450 21:37201318-37201340 GCTCCAGGCCCAAGAGACCAAGG + Intronic
1179743230 21:43429224-43429246 GCTCCTTGCCCACGGGCCCAGGG - Intergenic
1180070343 21:45432698-45432720 GATCCCAGCCCACGGACCCACGG - Intronic
1180162655 21:46005289-46005311 GCTCCCGACCCCAAAGCCCAGGG - Intergenic
1180659252 22:17451599-17451621 CCTCCGAGCACCAGAGCCCAGGG + Intronic
1180958674 22:19752351-19752373 GCTCCCTGGCCAAGCCCCCAAGG - Intergenic
1181182774 22:21079152-21079174 GCCCGCAGGCCAAGGGCCCAAGG + Intergenic
1181184409 22:21092420-21092442 GTTCCCAGCCCACGAGGTCAAGG - Intergenic
1181705181 22:24645571-24645593 CCTCACAGCCCAAGGTCCCAAGG - Intergenic
1181805616 22:25372879-25372901 CCACCCAGCCCCAGAGCCCAGGG + Intronic
1182271682 22:29157767-29157789 TCTCCCAGCCCAAGGGCTCAGGG - Intronic
1182280636 22:29216112-29216134 CCTCCCATCCCTGGAGCCCAGGG - Intronic
1182964095 22:34505301-34505323 GCTCCCACCTCAACAGCCCCTGG + Intergenic
1183028203 22:35082382-35082404 GCTCCAAGCTCAAGAAGCCAGGG + Intronic
1183093917 22:35541126-35541148 GCCCCCAGCCCGAGAGCCCCAGG + Exonic
1184403234 22:44285982-44286004 GATCCCAGCCCAAGGACTCAGGG - Intronic
1184665616 22:45987401-45987423 GCTCCTGTCCCAAGAGCACAGGG - Intergenic
1185182738 22:49372575-49372597 GCTCCAGGCCCCAGAGTCCAGGG - Intergenic
1185222796 22:49637354-49637376 GCTGCCAGCACAGGAGCACACGG + Intronic
950081860 3:10228278-10228300 CCTCCCTACCCCAGAGCCCAGGG - Intronic
950211111 3:11124320-11124342 CCTCCCAGCCCGAGATGCCAGGG + Intergenic
953118277 3:40014435-40014457 GTTCTCATCCCAAGATCCCAGGG - Intronic
953658468 3:44872648-44872670 TCTTCCAGACCAAAAGCCCAGGG - Intronic
954661478 3:52229094-52229116 TCGCCAAGCCCAAGGGCCCAGGG - Exonic
960284560 3:115812537-115812559 CCTACCAGCCCAAAAGCCCTGGG - Intronic
960527959 3:118731801-118731823 TCTCCCAGCACAAGAGAACATGG + Intergenic
961440039 3:126947310-126947332 GCTCCCAGCCCAGGAGCCACAGG - Intronic
963805021 3:149714249-149714271 GCTCCCAGCCCCTAAGCACAGGG - Intronic
966653485 3:182327190-182327212 GCTCCCTTCCCCAGAGCCCGCGG + Intergenic
966736316 3:183189801-183189823 GCTGCCAGCCCAGGAGGTCAAGG + Intronic
967602031 3:191401657-191401679 GGCCAAAGCCCAAGAGCCCATGG + Intergenic
968538834 4:1151886-1151908 GCTCCCGGCCCGAGAGCACAGGG + Intergenic
969138607 4:5050807-5050829 GCTCCCGCCGCAGGAGCCCAGGG + Intergenic
969461050 4:7329146-7329168 GCTCCCAAGCCGAGAGCACAGGG + Intronic
969632020 4:8344363-8344385 GCTCCCAAGCACAGAGCCCAGGG + Intergenic
969635196 4:8365118-8365140 GGTCCCAGCCCAAGAGCAGTTGG - Intergenic
969669615 4:8582461-8582483 GAACCCAGGCCCAGAGCCCAGGG - Intronic
969680591 4:8641268-8641290 GCGCCCAGCACAACAGCACAGGG + Intergenic
972715414 4:41641148-41641170 GCCCTCATCCCAACAGCCCAAGG + Intronic
976264049 4:83173558-83173580 GAGCCCAGCGCAAGACCCCAGGG - Intergenic
976623457 4:87152885-87152907 GCTCCGTTCCCAACAGCCCACGG + Intergenic
986521849 5:8627767-8627789 GCTCCCGGCCCAAGATCTGATGG - Intergenic
986836613 5:11646126-11646148 TCTCTCAGTCCATGAGCCCATGG + Intronic
988782409 5:34534359-34534381 TCTCCCAGCTCATGAGCTCATGG + Intergenic
990008590 5:50969444-50969466 GCTTCCCGCCCAGGGGCCCAGGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991028147 5:62052652-62052674 TCTGCCAGCTCAAGAGTCCATGG + Intergenic
991951197 5:71948123-71948145 GCTCCCATCCCTAGACCCAAAGG - Intergenic
995382292 5:111548566-111548588 GCTCCCAGGTCAAGTGACCAAGG - Intergenic
995991795 5:118248069-118248091 GCTCACTGCCCAGGAGCCCAAGG + Intergenic
996223342 5:120960362-120960384 GCACACTGCCCAAGGGCCCAAGG - Intergenic
997419448 5:133754669-133754691 ACACCAAGCCCAAGAGACCATGG + Intergenic
1000021207 5:157320877-157320899 GCTCCCAGTCCCACTGCCCATGG - Intronic
1001307213 5:170584196-170584218 GCTCCCAGGTCCAGTGCCCATGG - Intronic
1001351812 5:170974953-170974975 TCTCCCAGGCCCAGAGCGCAAGG - Intronic
1003074417 6:2971168-2971190 GCGCCCAGGCCCAGCGCCCACGG - Intronic
1003164684 6:3665878-3665900 GCTCCCAGCCCCAGAGCTCTGGG - Intergenic
1004503587 6:16229787-16229809 GCTCCCAGACCAAGACCCCAGGG - Intergenic
1005920673 6:30397888-30397910 GCTCTCTGCCCATGACCCCAGGG - Intergenic
1005987753 6:30884746-30884768 GCCCCCACCCCAAGAGCCCCAGG - Intronic
1006093536 6:31642191-31642213 GCTGCCAGCCCGAGCCCCCAGGG + Exonic
1006379691 6:33690300-33690322 GCTCCCAGCCCAGCAGCAAAAGG - Intronic
1006397546 6:33796996-33797018 GCTCCCTCCTCAGGAGCCCAGGG + Intronic
1007124882 6:39417591-39417613 GTTTCCTGCCCAAGAGCCAAGGG - Intronic
1010582430 6:77616082-77616104 GCTCAAAGCCCAGGACCCCATGG - Intergenic
1015477828 6:133673107-133673129 AGTCCCAACCCAAGAGTCCAAGG + Intergenic
1015726385 6:136303626-136303648 GCTGAAAGCCCAAGAGCCCCTGG - Intergenic
1017121423 6:151027855-151027877 ACTCACAGCTCAAAAGCCCATGG - Intronic
1017887415 6:158610522-158610544 GCTCCCTGCCAAAGAGCCACTGG - Intronic
1018969815 6:168519304-168519326 GCACCTGGCCCAGGAGCCCAGGG - Intronic
1019124543 6:169829678-169829700 GCTCACAGCCAAAGACCACAGGG + Intergenic
1019160175 6:170064109-170064131 GGTCCCAGTCCAAGAATCCATGG + Intergenic
1019414851 7:922474-922496 TCCCCCAGCCCAAGATGCCATGG + Intronic
1020211290 7:6159786-6159808 GCTCACAGCGGCAGAGCCCACGG + Intronic
1023876184 7:44287417-44287439 GCTGCCAGCCCAAGTTCCCCGGG - Intronic
1024230701 7:47361232-47361254 GGGCCCAGCCCAAGACCCCAAGG + Intronic
1026476854 7:70743856-70743878 GCTCCCAGGCAAAGTGACCATGG - Intronic
1029114375 7:98229812-98229834 GTCCCCAGCCCCAGTGCCCACGG + Intronic
1033544675 7:142389207-142389229 GTTCCCAGCAGAGGAGCCCAGGG - Intergenic
1033552818 7:142463122-142463144 GCGCCCAGCAGAGGAGCCCAGGG - Intergenic
1033555143 7:142482560-142482582 GCACCCAGCAGAGGAGCCCAGGG - Intergenic
1034292111 7:149941075-149941097 GCTCTCAGCCTCTGAGCCCAGGG - Intergenic
1034416946 7:150970302-150970324 GCCCCCCTCCCCAGAGCCCAAGG + Intronic
1034813962 7:154155822-154155844 GCTCTCAGCCTCTGAGCCCAGGG + Intronic
1035158569 7:156934476-156934498 GCGCCCGGCCCAAGATTCCAGGG + Intergenic
1037469602 8:19194468-19194490 AATCCCAGCACAAGAGCCCGAGG - Intergenic
1037507198 8:19542455-19542477 TCTCCCAGTCCCAGAGCCCTCGG + Intronic
1038238729 8:25787991-25788013 GCTCCCAACCCACCAGCTCAAGG + Intergenic
1038271030 8:26076140-26076162 CCTCCTAGCCAAAGGGCCCAGGG - Intergenic
1039888605 8:41669752-41669774 CGTCCCAGCCCACAAGCCCACGG + Intronic
1040098225 8:43469857-43469879 GCTCCCATCTCAAGATCCTAGGG + Intergenic
1041558123 8:59182751-59182773 CCTCCCAGCCCACTAGCCCCTGG - Intergenic
1046695140 8:117331511-117331533 AGTCCCAGCCCTGGAGCCCATGG + Intergenic
1048361942 8:133705017-133705039 GTTGCCAGGTCAAGAGCCCATGG - Intergenic
1048427797 8:134338787-134338809 GCTCCAACCCCCAGTGCCCAGGG - Intergenic
1049162470 8:141106123-141106145 GCTCCCAGCCCAGCTTCCCAGGG + Intergenic
1049204121 8:141355454-141355476 GCTCCCAGCCACACAGGCCACGG + Intergenic
1049368893 8:142254115-142254137 GCTCCCGGGGCCAGAGCCCACGG - Intronic
1052857286 9:33415307-33415329 GCTCCAAGCCCTTGAGCCCTGGG + Intergenic
1057299608 9:93870253-93870275 GCTCCCTGACCAGGAGGCCAAGG + Intergenic
1057526529 9:95808014-95808036 GCTCCCAGCCCAACAGCTGCAGG + Intergenic
1061016165 9:127981797-127981819 GCTCCCAGCTCAAGACCACCAGG + Intergenic
1061144738 9:128791066-128791088 GCTCCCAGCTCAGGTGGCCATGG + Intronic
1061196129 9:129108211-129108233 CCTCCCAGCCCTAGAGCTCTAGG + Intronic
1061396065 9:130343815-130343837 GCTCCGAGCCCAAGGCCACAGGG - Intronic
1061715470 9:132515907-132515929 TCTCTCTTCCCAAGAGCCCAAGG - Intronic
1061725427 9:132579925-132579947 AATCCCAACCCAAGAGCCAAAGG + Intergenic
1061882482 9:133575160-133575182 GCCCCCAGCCGAGGGGCCCAGGG + Exonic
1062204872 9:135330431-135330453 GCTCCCATACGCAGAGCCCAAGG - Intergenic
1062373758 9:136252969-136252991 TCTCCCAGGCCAAGTGCCCTTGG - Intergenic
1187854723 X:23625839-23625861 GCCCCCATCCCAAAAGACCACGG + Intergenic
1188013921 X:25086802-25086824 GCTCCCAGCAAAAGAGTCTAAGG - Intergenic
1188970823 X:36613295-36613317 GCAGCCAGCCCAAGCGTCCATGG - Intergenic
1189091900 X:38092415-38092437 GCTGAAAGCCCAAGAGCCCCTGG + Intronic
1189446780 X:41086669-41086691 GCTCCCACTCCAGGAGCCCAGGG - Intronic
1189856552 X:45229854-45229876 ACTCCCAGCCCACGAGCACAGGG + Intergenic
1189897683 X:45672963-45672985 GCTGCCAGCTCAAGTGTCCATGG - Intergenic
1191224819 X:58031816-58031838 GCTACCAGCCTGAGAGCCCTGGG + Intergenic
1191858275 X:65645069-65645091 CCTCCCAGCCCAGTAGCCCAGGG - Intronic
1192434048 X:71131713-71131735 TCTCTCAGCTCAAGAGCCCAAGG - Intronic
1192584915 X:72312018-72312040 GTTCCAATTCCAAGAGCCCAGGG + Intergenic
1193156822 X:78183140-78183162 GCTCCACCCCCAACAGCCCAGGG - Intergenic
1193392869 X:80949439-80949461 GCTCCCACACCAAGACCCCTGGG + Intergenic
1195298875 X:103507887-103507909 GCTCCCACCCCTTGACCCCAAGG + Intronic
1195410940 X:104567255-104567277 CCTCCCAGGCGAAGAGCCCCTGG - Intronic
1196495390 X:116318361-116318383 CCTTAAAGCCCAAGAGCCCAAGG - Intergenic
1196734748 X:118974090-118974112 AGTCCCAGCCCGAGAGCCCTGGG - Intergenic
1199744226 X:150761734-150761756 GCCCCCAGCCAAAGAGCTCCAGG + Intronic
1200039631 X:153355815-153355837 GGCCCCAGCCACAGAGCCCATGG + Intronic
1200050260 X:153425629-153425651 GCCCCCAGCCCAACACCTCATGG - Intergenic
1200097568 X:153671346-153671368 GCCCCCAGCCCCAGAGCTCTTGG - Exonic
1200618911 Y:5415799-5415821 GCTGCTAGCTCAAGTGCCCATGG + Intronic